Job Title: gi|535189|emb|Z30340.1| L.helveticus pepC...

RID=5NHU88JX012, gi|535189|emb|Z30340.1| L.helveticus pepC gene for aminopeptidase C BLASTN 2.2.16 (Mar-25-2007)
RID: 5NHU88JX012


Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
           5,295,485 sequences; 20,715,146,261 total letters

If you have any problems or questions with the results of this search
please refer to the BLAST FAQs Taxonomy reports

Query=  gi|535189|emb|Z30340.1| L.helveticus pepC gene for aminopeptidase C
Length=1655


Distance tree of resultsNew  
Legend for links to other resources: UniGene GEO Gene Structure Map Viewer Sequences producing significant alignments: (Click headers to sort columns)
Accession Description Max score Total score Query coverage E value Max ident Links
Z30340.1
L.helveticus pepC gene for aminopeptidase C
30573057100%0.0100%
L26223.1
Lactobacillus helveticus aminopeptidase C (pepC) gene, complete cds
2678267890%0.099%
CP000033.2
Lactobacillus acidophilus NCFM, complete genome
1367136781%0.085%
CP000413.1
Lactobacillus gasseri ATCC 33323, complete genome
1013101375%0.081%
CP000412.1
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365, complete genome
503 69276%1e-13995%
CR954253.1
Lactobacillus delbrueckii subsp. bulgaricus ATCC 11842 complete genome
503 69882%1e-13996%
X80643.1
L.delbrueckii pepC gene
475 47575%2e-13174%
DQ222973.1
Lactobacillus helveticus CRL 1176 insertion sequence IS15807 transposase gene, complete cds; and EpsE (epsE) gene, complete cds
211 2117%8e-5297%
X81979.1
L.helveticus plasmid pLH3 DNA (2 ORFs)
209 2096%3e-51100%
AJ002481.1
Lactobacillus helveticus gene encoding transmembrane protein
150 1504%2e-33100%
AY616518.1
Lactobacillus helveticus DPC4571 disrupted lactose operon, complete sequence; insertion sequence ISLhe1, complete sequence; and insertion sequence ISLhe6, complete sequence
117 1176%2e-2385%
AY365129.1
Lactobacillus helveticus CNRZ32 endopeptidase F (pepF) gene, complete cds
115 1157%6e-2384%
EF015485.1
Streptococcus infantarius subsp. infantarius putative aminopeptidase C (pepC) gene, partial cds
110 11012%3e-2176%
CP000416.1
Lactobacillus brevis ATCC 367, complete genome
106 10617%4e-2074%
DQ221764.1
Lactobacillus helveticus strain WSU19 aminopeptidase N (pepN) gene, complete cds
106 1066%4e-2084%
DQ221765.1
Lactobacillus helveticus strain WSU19 endopeptidase O (pepO) gene, complete cds
95.395.36%8e-1783%
CP000425.1
Lactococcus lactis subsp. cremoris SK11, complete genome
82.482.414%6e-1374%
M86245.1
Lactococcus lactis cysteine aminopeptidase (pepC) gene, complete cds
82.482.414%6e-1374%
AM406671.1
Lactococcus lactis subsp. cremoris MG1363, complete genome
76.876.814%3e-1174%
Alignments
>emb|Z30340.1|LHPEPCG L.helveticus pepC gene for aminopeptidase C Length=1655 Score = 3057 bits (1655), Expect = 0.0 Identities = 1655/1655 (100%), Gaps = 0/1655 (0%) Strand=Plus/Plus Query 1 TAAGCTTAAGGCAGTTCAATCAGATCAGACTCTTTTCTTTTTGATACTACAACTTGAGTC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1 TAAGCTTAAGGCAGTTCAATCAGATCAGACTCTTTTCTTTTTGATACTACAACTTGAGTC 60 Query 61 TAGTCCGATTGGACTTTTTTATTAACTAAAACGATTTAACTAGCACCACGCGTAAATTAA 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 61 TAGTCCGATTGGACTTTTTTATTAACTAAAACGATTTAACTAGCACCACGCGTAAATTAA 120 Query 121 ATATTTTTAATGAGTCTTTATCGTGATATATTCATCTAGAGATAGACTACTTCCTTTTTA 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 121 ATATTTTTAATGAGTCTTTATCGTGATATATTCATCTAGAGATAGACTACTTCCTTTTTA 180 Query 181 TCAGCTAAAATATAGAATAAGAAGGTATACATTAAAGGAGGATTTTTAATGGCAAAAGAA 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 181 TCAGCTAAAATATAGAATAAGAAGGTATACATTAAAGGAGGATTTTTAATGGCAAAAGAA 240 Query 241 ATTAATAACGATACCATTGCAAAATTTGAAAATGATTTAAACAATCATCCTGTTTTCAAT 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 241 ATTAATAACGATACCATTGCAAAATTTGAAAATGATTTAAACAATCATCCTGTTTTCAAT 300 Query 301 GTTGCAAGTCACGCAGCACAAGAAAACGGTATTTACAAAGCAAGTCAAAACTTACAAACT 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 301 GTTGCAAGTCACGCAGCACAAGAAAACGGTATTTACAAAGCAAGTCAAAACTTACAAACT 360 Query 361 AAGATCGACTTAGACCCAATTTTCTCAATTGAAATTGATACTGGTAAGCCAGCTGATCAA 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 361 AAGATCGACTTAGACCCAATTTTCTCAATTGAAATTGATACTGGTAAGCCAGCTGATCAA 420 Query 421 AAGCAATCAGGTCGTTGCTGGATGTTTAGTGCTTTAAACACTATGCGCCACCCATTACAA 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 421 AAGCAATCAGGTCGTTGCTGGATGTTTAGTGCTTTAAACACTATGCGCCACCCATTACAA 480 Query 481 AAGAAGTTTAAGTTACAGGACTTCGAATTATCTCAAAACTACACTAACTTCTGGGATAAA 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 481 AAGAAGTTTAAGTTACAGGACTTCGAATTATCTCAAAACTACACTAACTTCTGGGATAAA 540 Query 541 TTTGAAAAATCTAACTGGTTCTTCGAAAACGTGATTGCGACTGCTGACAAAGATTTAGGC 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 541 TTTGAAAAATCTAACTGGTTCTTCGAAAACGTGATTGCGACTGCTGACAAAGATTTAGGC 600 Query 601 GATCGTAAGGTTTCATTCTTGTTTGCAACACCACAACAAGATGGTGGTCAATGGGATATG 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 601 GATCGTAAGGTTTCATTCTTGTTTGCAACACCACAACAAGATGGTGGTCAATGGGATATG 660 Query 661 CTTTGCGGTATTATCGAAAAATACGGTATCGTACCAAAGAGCGTTTACCCAGAAACTGCT 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 661 CTTTGCGGTATTATCGAAAAATACGGTATCGTACCAAAGAGCGTTTACCCAGAAACTGCT 720 Query 721 AATGCAACCAACTCAAGTGCATTAAATGATACTTTAAACACCTTGCTTCGCAAAGATGGT 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 721 AATGCAACCAACTCAAGTGCATTAAATGATACTTTAAACACCTTGCTTCGCAAAGATGGT 780 Query 781 CTTGAATTACGCAGACTTGTTAATGCTGGCAAATCAGAAGACGAAGTACAAGCTCGCAAG 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 781 CTTGAATTACGCAGACTTGTTAATGCTGGCAAATCAGAAGACGAAGTACAAGCTCGCAAG 840 Query 841 GAAGAAATGTTAAATGATGTCTTCCGTGTTCTTGCAATTTCAACTTGTGTTCCACCAAAG 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 841 GAAGAAATGTTAAATGATGTCTTCCGTGTTCTTGCAATTTCAACTTGTGTTCCACCAAAG 900 Query 901 AAATTTAACTTCGAATACCGTGACGATAATCACAACTACCACATCGACAAGGACATTACG 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 901 AAATTTAACTTCGAATACCGTGACGATAATCACAACTACCACATCGACAAGGACATTACG 960 Query 961 CCTAAGGAATTCTTTGACAAATATGTTGGTATGGATTTAGCCAACCATATTTCAACTATC 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 961 CCTAAGGAATTCTTTGACAAATATGTTGGTATGGATTTAGCCAACCATATTTCAACTATC 1020 Query 1021 AATGCCCCAACTAGCGACAAGCCTTTCCACAAGGTATTCTCAGTTGAATACTTAGGTAAC 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1021 AATGCCCCAACTAGCGACAAGCCTTTCCACAAGGTATTCTCAGTTGAATACTTAGGTAAC 1080 Query 1081 GTTGAAGGTGGTCGTCAAGTTCGTCACTTAAACTTAAAGGTTGATGAAATGAAGGATTTG 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1081 GTTGAAGGTGGTCGTCAAGTTCGTCACTTAAACTTAAAGGTTGATGAAATGAAGGATTTG 1140 Query 1141 ATCATCAAGCAATTAAACAACGGCGAAGTTGTATGGTTTGGTTCAAACGTTGTTAAGGAT 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1141 ATCATCAAGCAATTAAACAACGGCGAAGTTGTATGGTTTGGTTCAAACGTTGTTAAGGAT 1200 Query 1201 TCTGAACGTCGCGCTGGACTTCTTGCCACCAATCTTTACCGCCGTGATCAATTATTTGAC 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1201 TCTGAACGTCGCGCTGGACTTCTTGCCACCAATCTTTACCGCCGTGATCAATTATTTGAC 1260 Query 1261 GTTGACTTCTCAATGTCTAAGGCTGATAAGCTTGACTCAGGCGAAAGCATGATGGACCAC 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1261 GTTGACTTCTCAATGTCTAAGGCTGATAAGCTTGACTCAGGCGAAAGCATGATGGACCAC 1320 Query 1321 GCAATGGTTATTACTGGTGTTGACATCGTTGATGGCAAACCAACTAAGTGGAAGATTGAA 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1321 GCAATGGTTATTACTGGTGTTGACATCGTTGATGGCAAACCAACTAAGTGGAAGATTGAA 1380 Query 1381 AACTCATGGGGTGAAAAGCCAGGCTTTAAAGGCTACTTCGTAATGAGTGATTCATGGTTT 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1381 AACTCATGGGGTGAAAAGCCAGGCTTTAAAGGCTACTTCGTAATGAGTGATTCATGGTTT 1440 Query 1441 GACTCATTTGTATACCAAGCAGTTATTAACAAAGATATTTTGCCAGAAGATCTTAAGAAG 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1441 GACTCATTTGTATACCAAGCAGTTATTAACAAAGATATTTTGCCAGAAGATCTTAAGAAG 1500 Query 1501 GCTTACGACGAAGGCAAGGATAATCCTATTCAATTATTGCCATGGGATCCAATGGGTGCT 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1501 GCTTACGACGAAGGCAAGGATAATCCTATTCAATTATTGCCATGGGATCCAATGGGTGCT 1560 Query 1561 TTAGCATTTAAGTATTAATAATTAGATTTATTCCACATAATTAAAAGACTAGGAATGTTT 1620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1561 TTAGCATTTAAGTATTAATAATTAGATTTATTCCACATAATTAAAAGACTAGGAATGTTT 1620 Query 1621 GACACTTCTAGTCTTTTTCATGAAAAGGCAAAAAA 1655 ||||||||||||||||||||||||||||||||||| Sbjct 1621 GACACTTCTAGTCTTTTTCATGAAAAGGCAAAAAA 1655 >gb|L26223.1|LBAPEPC Lactobacillus helveticus aminopeptidase C (pepC) gene, complete cds Length=1740 Score = 2678 bits (1450), Expect = 0.0 Identities = 1479/1493 (99%), Gaps = 1/1493 (0%) Strand=Plus/Plus Query 163 TAGACTACTTCCTTTTTATCAGCTAAAATATAGAATAAGAAGGTATACATTAAAGGAGGA 222 |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| Sbjct 124 TAGACTACTTCCTTTTTATCAGCTAAAATATAGAATGAGAAGGTATACATTAAAGGAGGA 183 Query 223 TTTTTAATGGCAAAAGAAATTAATAACGATACCATTGCAAAATTTGAAAATGATTTAAAC 282 ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| Sbjct 184 TTTTTAATGGCAAAAGAAATTAATACCGATACCATTGCAAAATTTGAAAATGATTTAAAC 243 Query 283 AATCATCCTGTTTTCAATGTTGCAAGTCACGCAGCACAAGAAAACGGTATTTACAAAGCA 342 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 244 AATCATCCTGTTTTCAATGTTGCAAGTCACGCAGCACAAGAAAACGGTATTTACAAAGCA 303 Query 343 AGTCAAAACTTACAAACTAAGATCGACTTAGACCCAATTTTCTCAATTGAAATTGATACT 402 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 304 AGTCAAAACTTACAAACTAAGATCGACTTAGACCCAATTTTCTCAATTGAAATTGATACT 363 Query 403 GGTAAGCCAGCTGATCAAAAGCAATCAGGTCGTTGCTGGATGTTTAGTGCTTTAAACACT 462 |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 364 GGTAAGCCAGCTAATCAAAAGCAATCAGGTCGTTGCTGGATGTTTAGTGCTTTAAACACT 423 Query 463 ATGCGCCACCCATTACAAAAGAAGTTTAAGTTACAGGACTTCGAATTATCTCAAAACTAC 522 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 424 ATGCGCCACCCATTACAAAAGAAGTTTAAGTTACAGGACTTCGAATTATCTCAAAACTAC 483 Query 523 ACTAACTTCTGGGATAAATTTGAAAAATCTAACTGGTTCTTCGAAAACGTGATTGCGACT 582 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 484 ACTAACTTCTGGGATAAATTTGAAAAATCTAACTGGTTCTTCGAAAACGTGATTGCGACT 543 Query 583 GCTGACAAAGATTTAGGCGATCGTAAGGTTTCATTCTTGTTTGCAACACCACAACAAGAT 642 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 544 GCTGACAAAGATTTAGGCGATCGTAAGGTTTCATTCTTGTTTGCAACACCACAACAAGAT 603 Query 643 GGTGGTCAATGGGATATGCTTTGCGGTATTATCGAAAAATACGGTATCGTACCAAAGAGC 702 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 604 GGTGGTCAATGGGATATGCTTTGCGGTATTATCGAAAAATACGGTATCGTACCAAAGAGC 663 Query 703 GTTTACCCAGAAACTGCTAATGCAACCAACTCAAGTGCATTAAATGATACTTTAAACACC 762 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 664 GTTTACCCAGAAACTGCTAATGCAACCAACTCAAGTGCATTAAATGATACTTTAAACACC 723 Query 763 TTGCTTCGCAAAGATGGTCTTGAATTACGCAGACTTGTTAATGCTGGCAAATCAGAAGAC 822 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 724 GTGCTTCGCAAAGATGGTCTTGAATTACGCAGACTTGTTAATGCTGGCAAATCAGAAGAC 783 Query 823 GAAGTACAAGCTCGCAAGGAAGAAATGTTAAATGATGTCTTCCGTGTTCTTGCAATTTCA 882 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 784 GAAGTACAAGCTCGCAAGGAAGAAATGTTAAATGATGTCTTCCGTGTTCTTGCAATTTCA 843 Query 883 ACTTGTGTTCCACCAAAGAAATTTAACTTCGAATACCGTGACGATAATCACAACTACCAC 942 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct 844 ACTTGTGTTCCACCAAAGAAATTTAACTTCGAATACCGTGACGATGATCACAACTACCAC 903 Query 943 ATCGACAAGGACATTACGCCTAAGGAATTCTTTGACAAATATGTTGGTATGGATTTAGCC 1002 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 904 ATCGACAAGGACATTACGCCTAAGGAATTCTTTGACAAATATGTTGGTATGGATTTAGCC 963 Query 1003 AACCATATTTCAACTATCAATGCCCCAACTAGCGACAAGCCTTTCCACAAGGTATTCTCA 1062 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 964 AACCATATTTCAACTATCAATGCCCCAACTAGCGACAAGCCTTTCCACAAGGTATTCTCA 1023 Query 1063 GTTGAATACTTAGGTAACGTTGAAGGTGGTCGTCAAGTTCGTCACTTAAACTTAAAGGTT 1122 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1024 GTTGAATACTTAGGTAACGTTGAAGGTGGTCGTCAAGTTCGTCACTTAAACTTAAAGGTT 1083 Query 1123 GATGAAATGAAGGATTTGATCATCAAGCAATTAAACAACGGCGAAGTTGTATGGTTTGGT 1182 ||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||| Sbjct 1084 GATGAAATGAAGGATTTGATCATCAAGCAATTAAAGAGCGGCGAAGTTGTATGGTTTGGT 1143 Query 1183 TCAAACGTTGTTAAGGATTCTGAACGTCGCGCTGGACTTCTTGCCACCAATCTTTACCGC 1242 ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| Sbjct 1144 TCAAACGTTGTTAAGGATTCTGAACGTCGCGCTGGACTTCTTGACACCAATCTTTACCGC 1203 Query 1243 CGTGATCAATTATTTGACGTTGACTTCTCAATGTCTAAGGCTGATAAGCTTGACTCAGGC 1302 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1204 CGTGATCAATTATTTGACGTTGACTTCTCAATGTCTAAGGCTGATAAGCTTGACTCAGGC 1263 Query 1303 GAAAGCATGATGGACCACGCAATGGTTATTACTGGTGTTGACATCGTTGATGGCAAACCA 1362 ||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| Sbjct 1264 GAAAGCATGATGGACCACGCAATGGTTATTACTGGTGTTGACAACGGTGATGGCAAACCA 1323 Query 1363 ACTAAGTGGAAGATTGAAAACTCATGGGGTGAAAAGCCAGGCTTTAAAGGCTACTTCGTA 1422 |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| Sbjct 1324 ACTAAGTGGAAGATTGAAAACTCATGGGGTGAAAAGCCCGGCTTTAAAGGCTACTTCGTA 1383 Query 1423 ATGAGTGATTCATGGTTTGACTCATTTGTATACCAAGCAGTTATTAACAAAGATATTTTG 1482 ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| Sbjct 1384 ATGAGTGATTCATGGTTTGACTCATTTGTTTACCAAGCAGTTATTAACAAAGATATTTTG 1443 Query 1483 CCAGAAGATCTTAAGAAGGCTTACGACGAAGGCAAGGATAATCCTATTCAATTATTGCCA 1542 ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct 1444 CCAGAAGATCTTAAGAAGGCTTACGACGAAGGCAAGGATAATCCTAT-CAATTATTGCCA 1502 Query 1543 TGGGATCCAATGGGTGCTTTAGCATTTAAGTATTAATAATTAGATTTATTCCACATAATT 1602 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1503 TGGGATCCAATGGGTGCTTTAGCATTTAAGTATTAATAATTAGATTTATTCCACATAATT 1562 Query 1603 AAAAGACTAGGAATGTTTGACACTTCTAGTCTTTTTCATGAAAAGGCAAAAAA 1655 ||| ||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1563 AAAGGACTAGGAATGTTTGACACTTCTAGTCTTTTTCATGAAAAGGCAAAAAA 1615 >gb|CP000033.2| Download subject sequence spanning the HSP Lactobacillus acidophilus NCFM, complete genome Length=1993561 Features in this part of subject sequence: aminopeptidase C Score = 1367 bits (740), Expect = 0.0 Identities = 1172/1377 (85%), Gaps = 44/1377 (3%) Strand=Plus/Minus Query 226 TTAATGGCAAAAGAAATTAATAACGATACCATTGCA-AAATTTGAA-AATGATTTAAAC- 282 |||||| ||||||||||| ||| ||||| ||| | ||||||||| || ||||| ||| Sbjct 325565 TTAATGTCAAAAGAAATTTCTAAGGATACTATT-AATAAATTTGAACAA-GATTT-AACT 325509 Query 283 AATCATCCTG-TTTTCAATGTTGCAAGTCACGCAGCACAAGAAAACGGTATTTACAAAGC 341 ||||| || | || | || ||||| || | |||||||||||||| || |||| ||||| Sbjct 325508 AATCACCCAGCTTAT-AAAGTTGCCAGCCGTGCAGCACAAGAAAATGGCATTTTTAAAGC 325450 Query 342 AAGTCAAAACTTACAAACTAAGATCGA-CTTAGACCCAA-TTTTCTCAATTGAAATTGAT 399 ||||||| | ||||||||||| || || ||| || |||| |||| |||||||||||||| Sbjct 325449 AAGTCAAGATTTACAAACTAAAATTGATCTT-GATCCAACTTTT-TCAATTGAAATTGAA 325392 Query 400 ACTGGTAAGCCAGCTGATCAAAAGCAATCAGGTCGTTGCTGGATGTTTAGTGCTTTAAAC 459 |||||||| |||||||| ||||||||||| ||||||||||||||||| || || ||||| Sbjct 325391 ACTGGTAAACCAGCTGACCAAAAGCAATCCGGTCGTTGCTGGATGTTCAGCGCATTAAAT 325332 Query 460 ACTATGCGCCACCCA-TTACAAAAGAAGTT-TAAGTT-ACAGGACTTCGAATTATCTCAA 516 || ||||| |||||| || |||||||| || || || | |||||||||||||||||||| Sbjct 325331 ACCATGCGTCACCCACTT-CAAAAGAAATTCCAA-TTGA-AGGACTTCGAATTATCTCAA 325275 Query 517 AACTACACTAACTTCTGGGATAAATTTGAAAAATCTAACTGGTTCTTCGAAAACGTGATT 576 || ||||| ||||||||||||||||||||||| || ||||||||||| ||||| || ||| Sbjct 325274 AATTACACCAACTTCTGGGATAAATTTGAAAAGTCAAACTGGTTCTTTGAAAATGTTATT 325215 Query 577 GCGACTGCTGACAAAG--ATTTAGGCGATCGTAAGGTTTCATTCTTGTTTGCAACACCAC 634 || ||||| || ||| | | |||||||| || ||||||||||||||||| || |||| Sbjct 325214 GCAACTGCAGA-TAAGCCA-CTCGGCGATCGCAAAGTTTCATTCTTGTTTGCCACTCCAC 325157 Query 635 AACAAGATGGTGGTCAATGGGATATGCTTTGCGGTATTATCGAAAAATACGGTATCGTAC 694 ||||||| ||||||||||||||||||||||| || ||||| ||||||||||||||||||| Sbjct 325156 AACAAGACGGTGGTCAATGGGATATGCTTTGTGGCATTATTGAAAAATACGGTATCGTAC 325097 Query 695 CAAAGAGCGTTTACCCAGAAACTGCTAATGCAACCAACTCAAGTGCATTAAATGATACTT 754 ||||||| |||||||||||||||||||||||||| ||||||||||||||||| || |||| Sbjct 325096 CAAAGAGTGTTTACCCAGAAACTGCTAATGCAACTAACTCAAGTGCATTAAACGACACTT 325037 Query 755 TAAACACCTTGCTTCGCAAAGATGGTCTTGAATTACGCAGACTT-GTTAATGCTGGCAAA 813 |||||||||||||||| ||||||||||| |||||||| | | || ||||| | ||| || Sbjct 325036 TAAACACCTTGCTTCGTAAAGATGGTCTAGAATTACGTA-AATTGGTTAACGATGGTAAG 324978 Query 814 TCAGAAGACGAAGTACAAGCTCGCAAGGAAGAAATG-TTAAATGATGTCTTCCGTGTTCT 872 |||||||| ||| | ||| |||| |||||||||||| || || ||||||||||| || || Sbjct 324977 TCAGAAGAAGAAATTCAAACTCGTAAGGAAGAAATGCTT-AACGATGTCTTCCGCGTACT 324919 Query 873 TGCAATTTCAACTT-GTGTTCCACCAAAGAAATTTAACTTCGAATACCGTGACGATAATC 931 || |||| |||| | ||||||||||||||||||||||||||||| ||||||||| | | Sbjct 324918 AGCTGTTTC-ACTTGGCGTTCCACCAAAGAAATTTAACTTCGAATATCGTGACGATGA-C 324861 Query 932 -ACAACTACCACATCGACAAGGACATTACGCCTAAGGAATTCTTTGACAAATATGTTGGT 990 | || ||||| || || ||||||||||| || |||||||||||||| |||||||||||| Sbjct 324860 AAGAATTACCATATTGATAAGGACATTACTCCAAAGGAATTCTTTGATAAATATGTTGGT 324801 Query 991 ATGGA-TTTAGCCA-ACCATATTTCAACTATCAATGCCCCAACTAGCGACAAGCCTTTCC 1048 ||||| || | | |||| || |||||||||||||| |||||||| |||||||| |||| Sbjct 324800 ATGGACCTT-G-AAGACCACATCTCAACTATCAATGCTCCAACTAGTGACAAGCCATTCC 324743 Query 1049 ACAAGGTATTCTCAGTTGAATACTTAGGTAACGTTGAAGGTGGTCGTCAAGTTCGTCACT 1108 | || |||||||||||||||||||||||||| |||||||||||||||||||||||||||| Sbjct 324742 ATAAAGTATTCTCAGTTGAATACTTAGGTAATGTTGAAGGTGGTCGTCAAGTTCGTCACT 324683 Query 1109 TAAACTTAAAGGTTGATGAAATGAAGGATTTGATCATCAAGCAATTAAACAACGGCGAAG 1168 | ||||||||||||||||||||||| || || |||||||||||| |||| | |||||||| Sbjct 324682 TGAACTTAAAGGTTGATGAAATGAAAGACTTAATCATCAAGCAACTAAAGAGCGGCGAAG 324623 Query 1169 TTGTATGGTTTGGTTCAAACGTTGTTAAGGATTCTGAACGTCGCGCTGGACTTCTTGCCA 1228 ||||||||||||||||||||||||||||||| || ||| | | ||||| ||||||| | Sbjct 324622 TTGTATGGTTTGGTTCAAACGTTGTTAAGGACTCAGAAAGAAGAGCTGGTCTTCTTGATA 324563 Query 1229 CCAATCTTTACCGCCGTGATC-AATTATTTGACGTTGACTTCTCAATGTCTAAGGCTGAT 1287 | | |||||| | ||||| | ||||||||||||| ||||| |||||||| |||||||| Sbjct 324562 CTGACCTTTACAGACGTGA-CGAATTATTTGACGTGGACTTTTCAATGTCAAAGGCTGAA 324504 Query 1288 AAGCTTGACTCAGGCGAAAGCATGATGGACCACGCAATGGTTATTACTGGTGTTGACATC 1347 |||||||| || || ||||| ||||||||||| || |||||||| ||||||||||| || Sbjct 324503 AAGCTTGATTCTGGTGAAAGTATGATGGACCATGCTATGGTTATCACTGGTGTTGATATT 324444 Query 1348 GTTGATGGCAAACCAACTAAGTGGAAGATTGAAAACTCATGGGGTGAAAAGCCAGGCTTT 1407 ||||||||||||||||||||||||||||| |||||||||||||| |||||||| ||||| Sbjct 324443 GTTGATGGCAAACCAACTAAGTGGAAGATCGAAAACTCATGGGGCGAAAAGCCTGGCTTC 324384 Query 1408 AAAGGCTACTTCGTAATGAGTGATTCATGGTTTGACTCATTTGTATACCAAGCAGTTATT 1467 ||||| ||||| |||||||| || ||||||||| |||||||| |||||||| ||||| Sbjct 324383 AAAGGTTACTTTGTAATGAGCGACAAATGGTTTGATTCATTTGTTTACCAAGCTGTTATC 324324 Query 1468 AACAAAGATATT-TTGCCAGAAGATCTT-AAGAAGGCTTACGACGAAGGCAAG-GATA-A 1523 ||| |||| ||| |||||||| || ||| ||||| || ||||| ||||| | | | | Sbjct 324323 AAC-AAGAAATTCTTGCCAGACGA-CTTAAAGAAAGCCTACGATGAAGG--TGTTAAAGA 324268 Query 1524 TCCTATTCAATTATTGCCATGGGATCCAATGGGTGCTTTAGCATTTAAGTATTAATA 1580 ||| || |||||||| |||||||||||||||||||||||||||||| | | |||||| Sbjct 324267 TCCAATCCAATTATTACCATGGGATCCAATGGGTGCTTTAGCATTTGATTTTTAATA 324211 >gb|CP000413.1| Download subject sequence spanning the HSP Lactobacillus gasseri ATCC 33323, complete genome Length=1894360 Features in this part of subject sequence: Aminopeptidase C Score = 1013 bits (548), Expect = 0.0 Identities = 1051/1284 (81%), Gaps = 74/1284 (5%) Strand=Plus/Minus Query 319 CAAGAAAACGGTATTTACAAAGCAAGTCAAAACTTACAAACTAAGATCGACTTAGACCCA 378 ||||||||||| |||| |||||| |||||||| ||||||||||| || ||||||||||| Sbjct 359260 CAAGAAAACGGCATTTTCAAAGCTAGTCAAAATTTACAAACTAAAATTAACTTAGACCCA 359201 Query 379 A-TTTTCTCAATTGAAATTGATACTGGT-AAGCCAGCTGATCAAAAGCAATCAGGTCGTT 436 | |||| ||||||||||| || |||||| ||| ||| | ||||| ||||| ||||||| Sbjct 359200 ACTTTT-TCAATTGAAATCGACACTGGTAAAG-TTGCTAACCAAAAACAATCTGGTCGTT 359143 Query 437 GCTGGATGTTTAGTGCTTTAAACACTATGCGCCA-CCCATTACAAAAGAAGTTT--AAGT 493 |||||||||||||||||||||| |||||||| || | ||| |||||||| ||| || | Sbjct 359142 GCTGGATGTTTAGTGCTTTAAATACTATGCGTCATTCGATT-CAAAAGAA-TTTCAAAAT 359085 Query 494 TACAGGACTTCGAATTATCTCAAAACTACACTAACTTCTGGGATAAATTTGAAAAATCTA 553 || |||| || ||||||||||||||||||||||||||||||||||||||||||||||| | Sbjct 359084 TA-AGGATTTTGAATTATCTCAAAACTACACTAACTTCTGGGATAAATTTGAAAAATCAA 359026 Query 554 ACTGGTTCTTCGAAAACGTGATTGCGACTGCTGACAAAGATTTAGGCGATCGTAAGGTTT 613 |||||||||| ||||| || || || |||||||||||||| |||||||||||||| ||| Sbjct 359025 ACTGGTTCTTTGAAAATGTTATCGCTACTGCTGACAAAGACTTAGGCGATCGTAAAGTTA 358966 Query 614 CATTCTTGTTTGCAACACCACAACAAGATGGTGGTCAATGGGATATGCTTTGCGGTATTA 673 ||||| || | || |||||||||||||||||||||||||| ||||||||||| |||| Sbjct 358965 GTTTCTTATTCACTACTCCACAACAAGATGGTGGTCAATGGGACATGCTTTGCGGAATTA 358906 Query 674 TCGAAAAATACGGTATCG-TACCAAAGAGCGTTTACCCAGAAACTGCTAATGCAACCAAC 732 | ||||||||||| || | | ||||||| ||||| ||||||||||| |||||||| || Sbjct 358905 TTGAAAAATACGGCATTGCT-CCAAAGAAAGTTTATCCAGAAACTGCCAATGCAACAAAT 358847 Query 733 TCAAGTGCATTAAATGATACTTTAAACACCTTGCTTCGCAAAGATGGTCTTGAATTACGC 792 || ||||| ||||| ||||||||||| || |||||| | |||||||||||||||||||| Sbjct 358846 TCTAGTGCTTTAAACGATACTTTAAATACTTTGCTTAGAAAAGATGGTCTTGAATTACGT 358787 Query 793 A-GACTTGTT-AATGCTGGCAA-ATCAGAAGACGAAGTACAAGCTCGCAAGGAA-GAAAT 848 | || | ||| || | ||| || | | ||||| ||||| ||||| || ||| || ||||| Sbjct 358786 AAGA-TGGTTCAA-GATGGGAAGAGC-GAAGATGAAGTTCAAGCACGTAAG-AATGAAAT 358731 Query 849 G-TTAAATGATGTCTT-CCGTGTTCTT-GCAATTTCAACTTG-TGTTCCACCAAAGAAAT 904 | || ||| || || |||| || || || ||||| |||| ||||||||| ||||||| Sbjct 358730 GCTTCG-TGAAGT-TTACCGTATT-TTAGCCATTTCT-CTTGGTGTTCCACCTAAGAAAT 358675 Query 905 TTAACTTCGAATACCGTGACGATAATCACAACTACCACATCGACAAG--GACATT-ACGC 961 || | || |||||| ||||| || |||||| |||| || | | ||| || | || Sbjct 358674 TTGATTTTGAATACAAAGACGACGATGGCAACTATCACA--GAGATGCTGAC-TTGA-GC 358619 Query 962 CTA-AGGAATTCTTTGACAAATATGTTGGTATGG-ATTT-AGCCAACCATATTTCAACTA 1018 | | | || |||||| | ||||||||| ||| |||| || ||| ||||||| || | Sbjct 358618 CCACAAGACTTCTTTAAGAAATATGTTAAC-TGGGATTTGAGTCAAT-ATATTTCCACAA 358561 Query 1019 TCAATGCCCCAACTA-GCGACAAGCCTTTCCACAAGGTATTCTCAGTTGAATACTTAGGT 1077 | ||||||||||||| | || |||||||||||||||||||| || |||||||||||||| Sbjct 358560 TTAATGCCCCAACTAAG-GATAAGCCTTTCCACAAGGTATTTTCTGTTGAATACTTAGGA 358502 Query 1078 AACGTTGAAGGTGGTCGTCAAGTTCGTCACTTAAACTTAA-AGGTTGATGAAATGAAGGA 1136 ||||||||||| |||||||||||||||||||| || ||| || ||||||||||||| || Sbjct 358501 AACGTTGAAGGCGGTCGTCAAGTTCGTCACTTGAATTTACCAG-TTGATGAAATGAAAGA 358443 Query 1137 TTTGATCATCAAGCAA-TTAAACAACGGCGAAGTTGTATGGTTTGGTTCAAACGTTGTTA 1195 || || ||||||||| ||||| || || |||||||| |||||||||||||| ||||||| Sbjct 358442 CTTAATTATCAAGCAACTTAAA-AATGGTGAAGTTGTTTGGTTTGGTTCAAATGTTGTTA 358384 Query 1196 AGGATTCTGAACGTCGCGCTGGACTT-CTTGCCACC-AATCTTTACC-GC-CG-TGATCA 1250 | || |||||||||| ||||| || || | |||| ||| | ||| || || ||||| Sbjct 358383 AAGACTCTGAACGTCAAGCTGGT-TTACTAGACACCGAAT-TGTACAAGCGCGATGATC- 358327 Query 1251 ATTATTTGACGTTGACTTCTCA-ATGTCTAAGGCTGATAAGCTTGACTCAGGCGAAAGCA 1309 | ||||| |||||||| | | ||||| || ||||||| |||||| ||||||||||| | Sbjct 358326 -TG-TTTGATGTTGACTT-TAATATGTCAAAAGCTGATATGCTTGATTCAGGCGAAAGTA 358270 Query 1310 TGATGGACCACGCAATGGTTATTACTGGTGTTGACATCGTTGATGGCAAACCAACTAAGT 1369 ||||||| ||||| |||||||| ||||||||||| | || ||||||||||||||||||| Sbjct 358269 TGATGGATCACGCCATGGTTATAACTGGTGTTGATTTAGTAGATGGCAAACCAACTAAGT 358210 Query 1370 GGAAGATTGAAAACTCATGGGGTGAAAAGCCAGGCTTTAAAGGCTACTTCGTAATGAGTG 1429 |||||||||||||||||||||| ||||| ||||| |||||||| ||||| || ||||||| Sbjct 358209 GGAAGATTGAAAACTCATGGGGCGAAAAACCAGGATTTAAAGGTTACTTTGTCATGAGTG 358150 Query 1430 ATTCA-TGGTTTGACTCA-TTTGTATACCAAGCAGTTATTAACAA-AGATATTTT-GCCA 1485 || | |||||||| | | ||||| |||||||||||||| ||||| | ||| || || Sbjct 358149 ATA-AGTGGTTTGA-TAAATTTGTTTACCAAGCAGTTATCAACAAGAAATACCTTAGC-- 358094 Query 1486 GAAGATCTT-AAGAAGGC-TTACGACGAAGGCAAGGATA-ATCCTATTCAATTA-TTGCC 1541 || || ||| ||||| || || || ||||| ||| | | |||| ||||||||| || || Sbjct 358093 GACGA-CTTGAAGAAAGCATTT-GAAGAAGG-AAGCAAAGATCCAATTCAATTACTT-CC 358038 Query 1542 ATGGGATCCAATGGGTGCTTTAGC 1565 ||||||||||||||||||||||| Sbjct 358037 TTGGGATCCAATGGGTGCTTTAGC 358014 >gb|CP000412.1| Download subject sequence spanning the HSP Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365, complete genome Length=1856951 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Features in this part of subject sequence: Aminopeptidase C Score = 503 bits (272), Expect = 1e-139 Identities = 899/1192 (75%), Gaps = 81/1192 (6%) Strand=Plus/Plus Query 418 CAAAAGCAATCAGGTCGTTGCTGGATGTTTAGTGCTTTAAACACTATGCGCCACCCATTA 477 |||| ||| ||||| || ||||||||||| |||||||| ||||| ||||| ||| || | Sbjct 1490973 CAAAGGCAGTCAGGCCGCTGCTGGATGTTCAGTGCTTTGAACACCATGCGTCACTCAATC 1491032 Query 478 CAAAA-GAAGTTTAAG-TTACAGGACTTCGAATTATCTCAAAACTACA-CTAACTTCTGG 534 ||||| ||| || ||| | | ||| ||| ||||| || || | ||||| || ||||||| Sbjct 1491033 CAAAAGGAA-TTCAAGCTGA-AGGGCTTTGAATTGTCACAGAGCTACACCT-TCTTCTGG 1491089 Query 535 GATAAATTTGAAAAATCTAACTGGTTCTTCGAAAACGTGATTGCGACT--GCTGACAAAG 592 || || |||||||| || |||| ||||| |||||||||| | || || |||||| ||| Sbjct 1491090 GACAAGTTTGAAAAGTCAAACTTCTTCTTTGAAAACGTGA-T-CGGCTCAGCTGAC-AAG 1491146 Query 593 --ATTTAGGCGATCGTAAGGTTTCATTCTTGTTTGCAACACCACAA-CAAGATGGTGGTC 649 | | ||||| || ||||| || ||| | ||||| || || ||| | ||| || || | Sbjct 1491147 CCA-CTGGGCGACCGAAAGGTCTCCTTCCTCTTTGCCACTCCGCAATC-AGACGGCGGGC 1491204 Query 650 AATGGGATATGCTTTGCGGTATT-ATCGAAAAATACGGTATCGTACCAAAG-AGCGTTTA 707 ||||||| ||||| ||||| || || ||||| ||||| ||||| || ||| || ||||| Sbjct 1491205 AATGGGACATGCTCTGCGG-CTTGATTGAAAAGTACGGGATCGTGCCGAAGAAG-GTTTA 1491262 Query 708 CCCAGAAACTGCTAA-TGCA-ACCAACTCAAGTGCATTAAATGATACTTTAAACACCTTG 765 ||| ||||||||||| | || | ||||| | || || ||||| ||||| |||||| || Sbjct 1491263 CCCGGAAACTGCTAACT-CAGA-AAACTCCCGCGCTTTGAATGACACTTTGAACACCATG 1491320 Query 766 CTTCGCAAAGATGGTCTT-GAATTACGCAGAC-TT-GTTAATGCTGGCAA-ATCAGAAGA 821 || ||||| | ||| || ||| | || | | || || |||| ||||| | | | ||| Sbjct 1491321 CTCCGCAAGGGCGGT-TTGGAACT--GCGGGCTTTGGTCAATGAAGGCAAGAGC-GCAGA 1491376 Query 822 CGAAGTACAAGCTCGCAAGGAAGAAATGTTAAATGATGTCTTCCGTGTTCTTGCAATTTC 881 |||||| |||| | ||||| ||| | || | | | ||||||| | || || | ||| Sbjct 1491377 AGAAGTAGAAGCGCACAAGGCTGAACTTTTGGACGCTATCTTCCGCATGCTGGCTACTTC 1491436 Query 882 AACTTGTG-TT-CCACCAAAGAAATTTAACTTCGAATAC-CGTGACGATAATC-ACAACT 937 | ||| | || || ||||||| || ||||| |||||| | ||||||| | | ||||| Sbjct 1491437 -A-TTGGGCTTGCCGCCAAAGAGCTTCAACTTTGAATACAC-TGACGATGA-CGGCAACT 1491492 Query 938 ACCACATCGACAAGGACATTACGCC-TAAGGAATTCTTTGACAAATATGTTGGTAT-GGA 995 ||||||||||||||||||| || || || || ||||| | || || ||||| | ||| Sbjct 1491493 ACCACATCGACAAGGACATCACCCCGCAA-GACTTCTTCAAGAAGTACGTTGG-CTGGGA 1491550 Query 996 TTTAGCCAACCATATTTCAACT-ATCAATGCCCCAACTAGC-GACAAGCCTTTCCACAAG 1053 | | ||| | || || | | ||||| | || ||| || |||||||| | | ||||| Sbjct 1491551 CCTGGAAAACTACATCTC-AGTCATCAACGGGCCTACT-GCTGACAAGCCATACAACAAG 1491608 Query 1054 GTATTCTCAGTTGAATACTTAGGTAACGTTGAAGGTGGTCGTCAAGTTCGTCA-CTTAAA 1112 || ||||||||||||||| | || ||||| | || || || ||||| || || || || Sbjct 1491609 GTCTTCTCAGTTGAATACCTGGGCAACGTGGTTGGCGGCCGGCAAGTCCGCCACCTCAAC 1491668 Query 1113 CT-TAAAGGTTGATGAAATGAAGGATTTGATCATCAAGCAATT-AAACAACGGCGAAGTT 1170 || || || | | | ||||| ||||||||||| ||||| || ||| ||||||||| Sbjct 1491669 CTGGAACTGTCCA--AGTTCAAGGACTTGATCATCAACCAATTGAAGCAA-GGCGAAGTT 1491725 Query 1171 GTATGGTTTGGTTCAAACGTTGT-TAAGGATTCTGAACGTCG-CGCTGGACTTCTT-GCC 1227 || |||||||||||| ||||| | |||| ||| || | || || ||| || | | Sbjct 1491726 GTTTGGTTTGGTTCAGACGTT-TCCAAGGGCGGTGACCG-GGAAGCCGGGCTT-TTGGAC 1491782 Query 1228 ACCAATCTTTACCGCCGTGATCA-ATTATTTGACGT-TGACTTCTCAATG-TCTAAGGCT 1284 || || | |||| | || || || |||||| | |||||||||||| | |||||| Sbjct 1491783 ACTAAGATCTACCAAAGAGACCAGCTT-TTTGAC-TACGACTTCTCAATGAGC-AAGGCT 1491839 Query 1285 GATAAG-CTTGACTCAGGCGAAAGCATGATGGACCACGCAATGGTTATTACTGGTGTTGA 1343 || | || ||||||||||||||||||||| ||||||| |||||||| |||| ||||| Sbjct 1491840 GA-CCGCCTGGACTCAGGCGAAAGCATGATGAACCACGCCATGGTTATCACTGCCGTTGA 1491898 Query 1344 CATCGTTGATGGCAAACCAACTAAGTGGAAGATTGAAAACTCATGGGGTGAAAAGCCAGG 1403 | | ||||| | ||| ||||||||||||||||| ||||||||||||||||| |||||||| Sbjct 1491899 CCTGGTTGACGACAAGCCAACTAAGTGGAAGATCGAAAACTCATGGGGTGACAAGCCAGG 1491958 Query 1404 CTTTAAAGGCTACTTCGTAATGAGTGATTCATGGTTTGACTC-ATTTGTATACCAAGCAG 1462 ||| || ||||||||||| ||||| || |||||| ||| | ||| || ||||| || | Sbjct 1491959 CTTCAAGGGCTACTTCGTCATGAGCGACGAATGGTTCGAC-CAATTCGTTTACCAGGCTG 1492017 Query 1463 TTATT-AACAAAGATATT-TTGCCAGAAGATC-TTAAGAAGGCTTACGACGAAGGCAAGG 1519 || || ||| ||| || ||||||||||| | ||||||||||||||||||||||||||| Sbjct 1492018 TT-TTGAAC-AAGGCCTTCTTGCCAGAAGA-CGTTAAGAAGGCTTACGACGAAGGCAAGG 1492074 Query 1520 ATAATCCTATTC-AA-TTATTGCCATGGGATCCAATGGGTGCTTTAGCATTT 1569 | || || || | || || | ||||||||| |||||||| ||||| || ||| Sbjct 1492075 AAAACCCAAT-CGAACTTCT-GCCATGGGACCCAATGGGCGCTTTGGC-TTT 1492123 Features flanking this part of subject sequence: 300 bp at 5' side: Transposase 833 bp at 3' side: Carbamoylphosphate synthase large subunit Score = 189 bits (102), Expect = 4e-45 Identities = 114/119 (95%), Gaps = 3/119 (2%) Strand=Plus/Minus Query 1 TAAGCTTAAGGCAGTTCAATCAGATCAGACTCTTTTCTTTTTG-ATACTACAACTTGAGT 59 |||||||||||||| |||||||||||||||||||||| | ||| |||||||||||||||| Sbjct 1771490 TAAGCTTAAGGCAGCTCAATCAGATCAGACTCTTTTC-TATTGAATACTACAACTTGAGT 1771432 Query 60 CTAGTCCGATTGGACTTTTTTATTAACTAAAACGATTTAACTAGCACCACGCGTA-AAT 117 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct 1771431 CTAGTCCGATTGGACTTTTTTATTAACTAAAACGATTTAACTAGCACCACGCGTAGAAT 1771373 >emb|CR954253.1| Download subject sequence spanning the HSP Lactobacillus delbrueckii subsp. bulgaricus ATCC 11842 complete genome Length=1864998 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Features in this part of subject sequence: Aminopeptidase C Score = 503 bits (272), Expect = 1e-139 Identities = 963/1287 (74%), Gaps = 85/1287 (6%) Strand=Plus/Plus Query 325 AACGGTATTTACAAAGCAAGTCAAAACTTACAAA-CTAAGATCGACTTAGACCCAATTTT 383 ||||| |||| ||| || || |||| | |||| | ||| | ||| | ||||| | || Sbjct 1477656 AACGGGATTTTCAAGGCCAGCCAAAGCACCCAAAGC-AAGGTTGACCTGGACCCGACCTT 1477714 Query 384 CTCAATTGAAATTGATACTGG-TAAGCCAGCTGATCAAAAGCAATCAGGTCGTTGCTGGA 442 |||| | ||||| || ||||| | || | | | |||||||| ||||| || ||||||| Sbjct 1477715 CTCAGTGGAAATCGACACTGGTTCAGTTA-CCAACCAAAAGCAGTCAGGCCGCTGCTGGA 1477773 Query 443 TGTTTAGTGCTTTAAACACTATGCGCCACCCATTACAAAA-GAAGTTTAAG-TTACAGGA 500 |||| |||||||| ||||| ||||| ||| || | ||||| ||| || ||| | | ||| Sbjct 1477774 TGTTCAGTGCTTTGAACACCATGCGTCACTCAATCCAAAAGGAA-TTCAAGCTGA-AGGG 1477831 Query 501 CTTCGAATTATCTCAAAACTACA-CTAACTTCTGGGATAAATTTGAAAAATCTAACTGGT 559 ||| ||||| || || | ||||| || ||||||||| || |||||||| || |||| | Sbjct 1477832 CTTTGAATTGTCACAGAGCTACACCT-TCTTCTGGGACAAGTTTGAAAAGTCAAACTTCT 1477890 Query 560 TCTTCGAAAACGTGATTGCGACT--GCTGACAAAG--ATTTAGGCGATCGTAAGGTTTCA 615 |||| |||||||||| | || || |||||| ||| | | ||||| || ||||| || Sbjct 1477891 TCTTTGAAAACGTGA-T-CGGCTCAGCTGAC-AAGCCA-CTGGGCGACCGAAAGGTCTCC 1477946 Query 616 TTCTTGTTTGCAACACCACAA-CAAGATGGTGGTCAATGGGATATGCTTTGCGGTATT-A 673 ||| | ||||| || || ||| | ||| || || |||||||| ||||| ||||| || | Sbjct 1477947 TTCCTCTTTGCCACTCCGCAATC-AGACGGCGGGCAATGGGACATGCTCTGCGG-CTTGA 1478004 Query 674 TCGAAAAATACGGTATCGTACCAAAG-AGCGTTTACCCAGAAACTGCTAA-TGCA-ACCA 730 | ||||| ||||| ||||| || ||| || |||||||| ||||||||||| | || | | Sbjct 1478005 TTGAAAAGTACGGGATCGTGCCGAAGAAG-GTTTACCCGGAAACTGCTAACT-CAGA-AA 1478061 Query 731 ACTCAAGTGCATTAAATGATACTTTAAACACCTTGCTTCGCAAAGATGGTCTT-GAATTA 789 |||| | || || | || ||||| |||||| |||| ||||| | || ||| ||| | Sbjct 1478062 ACTCCCGCGCTTTGGACGACACTTTGAACACCATGCTCCGCAAGGGCGG-CTTGGAACT- 1478119 Query 790 CGCAGAC-TT-GTTAATGCTGGCAA-ATCAGAAGACGAAGTACAAGCTCGCAAGGAAGAA 846 || | | || || |||| ||||| | | | ||| |||||| |||| | ||||| ||| Sbjct 1478120 -GCGGGCTTTGGTCAATGAAGGCAAGAGC-GCAGAAGAAGTAGAAGCGCACAAGGCTGAA 1478177 Query 847 ATGTTAAATGATGTCTTCCGTGTTCTTGCAATTTCAACTTGTG-TT-CCACCAAAGAAAT 904 | || | | | ||||||| | || || | ||| | ||| | || || ||||||| | Sbjct 1478178 CTTTTGGACGCTATCTTCCGCATGCTGGCTACTTC-A-TTGGGCTTGCCGCCAAAGAGCT 1478235 Query 905 TTAACTTCGAATAC-CGTGACGATAATC-ACAACTACCACATCGACAAGGACATTACGCC 962 | ||||| |||||| | ||||||| | | |||||||||||||||||||||||| || || Sbjct 1478236 TCAACTTTGAATACAC-TGACGATGA-CGGCAACTACCACATCGACAAGGACATCACCCC 1478293 Query 963 -TAAGGAATTCTTTGACAAATATGTTGGTAT-GGATTTAGCCAACCATATTTCAACT-AT 1019 || || ||||| | || || ||||| | ||| | | ||| | || || | | || Sbjct 1478294 GCAA-GACTTCTTCAAGAAGTACGTTGG-CTGGGACCTGGAAAACTACATCTC-AGTCAT 1478350 Query 1020 CAATGCCCCAACTAGC-GACAAGCCTTTCCACAAGGTATTCTCAGTTGAATACTTAGGTA 1078 ||| | || ||| || |||||||| | | ||||||| ||||||||||||||| | || | Sbjct 1478351 CAACGGGCCTACT-GCTGACAAGCCATACAACAAGGTCTTCTCAGTTGAATACCTGGGCA 1478409 Query 1079 ACGTTGAAGGTGGTCGTCAAGTTCGTCACTTAAACTT--AAAGGTTGATGAAATGAAGGA 1136 |||| | || || || ||||| || ||| | ||||| || || | | | ||||| Sbjct 1478410 ACGTGGTTGGCGGCCGGCAAGTCCGCCACCTCAACTTGGAACTGTCCA--AGTTCAAGGA 1478467 Query 1137 TTTGATCATCAAGCAATT-AAACAACGGCGAAGTTGTATGGTTTGGTTCAAACGTTGT-T 1194 ||||||||||| ||||| || ||| ||||||||||| |||||||||||| ||||| | Sbjct 1478468 CTTGATCATCAACCAATTGAAGCAA-GGCGAAGTTGTTTGGTTTGGTTCAGACGTT-TCC 1478525 Query 1195 AAGGATTCTGAACGTCG-CGCTGGACTTCTT-GCCACCAATCTTTACCGCCGTGATCA-A 1251 |||| ||| || | || || ||| || | ||| || | |||| | || || Sbjct 1478526 AAGGGCGGTGACCG-GGAAGCCGGGCTT-TTGGACACTAAGATCTACCAAAGAGACCAGC 1478583 Query 1252 TTATTTGACGT-TGACTTCTCAATG-TCTAAGGCTGATAAG-CTTGACTCAGGCGAAAGC 1308 || |||||| | |||||||||||| | |||||||| | || ||||||||||||||| Sbjct 1478584 TT-TTTGAC-TACGACTTCTCAATGAGC-AAGGCTGA-CCGCCTGGACTCAGGCGAAAGC 1478639 Query 1309 ATGATGGACCACGCAATGGTTATTACTGGTGTTGACATCGTTGATGGCAAACCAACTAAG 1368 |||||| ||||||| |||||||| |||| |||||| | ||||| | ||| ||||||||| Sbjct 1478640 ATGATGAACCACGCCATGGTTATCACTGCCGTTGACCTGGTTGACGACAAGCCAACTAAG 1478699 Query 1369 TGGAAGATTGAAAACTCATGGGGTGAAAAGCCAGGCTTTAAAGGCTACTTCGTAATGAGT 1428 |||||||| ||||||||||||||||| ||||||||||| || ||||||||||| ||||| Sbjct 1478700 TGGAAGATCGAAAACTCATGGGGTGACAAGCCAGGCTTCAAGGGCTACTTCGTCATGAGC 1478759 Query 1429 GATTCATGGTTTGACTC-ATTTGTATACCAAGCAGTTATT-AACAAAGATATT-TTGCCA 1485 || |||||| ||| | ||| || ||||| || ||| || ||| ||| || ||||| Sbjct 1478760 GACGAATGGTTCGAC-CAATTCGTTTACCAGGCTGTT-TTGAAC-AAGGCCTTCCTGCCA 1478816 Query 1486 GAAGATC-TTAAGAAGGCTTACGACGAAGGCAAGGATAATCCTATTC-AA-TTATTGCCA 1542 ||||| | |||||||||||||||||||||||||||| || || || | || || | |||| Sbjct 1478817 GAAGA-CGTTAAGAAGGCTTACGACGAAGGCAAGGAAAACCCAAT-CGAACTTCT-GCCA 1478873 Query 1543 TGGGATCCAATGGGTGCTTTAGCATTT 1569 ||||| |||||||| ||||| || ||| Sbjct 1478874 TGGGACCCAATGGGCGCTTTGGC-TTT 1478899 Features flanking this part of subject sequence: 300 bp at 5' side: Transposase (fragment) 419 bp at 3' side: Putative transposase (fragment) Score = 195 bits (105), Expect = 8e-47 Identities = 115/119 (96%), Gaps = 3/119 (2%) Strand=Plus/Minus Query 1 TAAGCTTAAGGCAGTTCAATCAGATCAGACTCTTTTCTTTTTG-ATACTACAACTTGAGT 59 ||||||||||||||||||||||||||||||||||||| | ||| |||||||||||||||| Sbjct 1766640 TAAGCTTAAGGCAGTTCAATCAGATCAGACTCTTTTC-TATTGAATACTACAACTTGAGT 1766582 Query 60 CTAGTCCGATTGGACTTTTTTATTAACTAAAACGATTTAACTAGCACCACGCGTA-AAT 117 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct 1766581 CTAGTCCGATTGGACTTTTTTATTAACTAAAACGATTTAACTAGCACCACGCGTAGAAT 1766523 >emb|X80643.1|LDPEPC L.delbrueckii pepC gene Length=2026 Score = 475 bits (257), Expect = 2e-131 Identities = 958/1287 (74%), Gaps = 85/1287 (6%) Strand=Plus/Plus Query 325 AACGGTATTTACAAAGCAAGTCAAAACTTACAAA-CTAAGATCGACTTAGACCCAATTTT 383 ||||| |||| ||| || || |||| | |||| | ||| | ||| | ||||||| || Sbjct 449 AACGGGATTTTCAAGGCCAGCCAAAGCACCCAAAGC-AAGGTTGACCTGGACCCAACCTT 507 Query 384 CTCAATTGAAATTGATACTGG-TAAGCCAGCTGATCAAAAGCAATCAGGTCGTTGCTGGA 442 |||| | ||||| || ||||| | || | | | ||||| || ||||| || ||||||| Sbjct 508 CTCAGTGGAAATCGACACTGGTTCAGTTA-CCAACCAAAAACAGTCAGGCCGCTGCTGGA 566 Query 443 TGTTTAGTGCTTTAAACACTATGCGCCACCCATTACAAAA-GAAGTTTAAG-TTACAGGA 500 |||| |||||||| ||||| ||||| ||| || | ||||| ||| || ||| | | ||| Sbjct 567 TGTTCAGTGCTTTGAACACCATGCGTCACTCAATCCAAAAGGAA-TTCAAGCTGA-AGGG 624 Query 501 CTTCGAATTATCTCAAAACTACA-CTAACTTCTGGGATAAATTTGAAAAATCTAACTGGT 559 ||| ||||| || || | ||||| || ||||||||| || |||||||| || |||| | Sbjct 625 CTTTGAATTGTCACAGAGCTACACCT-TCTTCTGGGACAAGTTTGAAAAGTCAAACTTCT 683 Query 560 TCTTCGAAAACGTGATTGCGACT--GCTGACAAAG--ATTTAGGCGATCGTAAGGTTTCA 615 |||| |||||||||| | || || |||||| ||| | | ||||| || ||||| || Sbjct 684 TCTTTGAAAACGTGA-T-CGGCTCAGCTGAC-AAGCCA-CTGGGCGACCGGAAGGTCTCC 739 Query 616 TTCTTGTTTGCAACACCACAA-CAAGATGGTGGTCAATGGGATATGCTTTGCGGTATT-A 673 ||| | ||||| || || ||| | ||| || || |||||||| ||||| ||||| || | Sbjct 740 TTCCTCTTTGCCACTCCGCAATC-AGACGGCGGGCAATGGGACATGCTCTGCGG-CTTGA 797 Query 674 TCGAAAAATACGGTATCGTACCAAAG-AGCGTTTACCCAGAAACTGCTAA-TGCA-ACCA 730 | ||||| ||||| ||||| || ||| || |||||||| ||||||||||| | || | | Sbjct 798 TTGAAAAGTACGGGATCGTGCCGAAGAAG-GTTTACCCGGAAACTGCTAACT-CAGA-AA 854 Query 731 ACTCAAGTGCATTAAATGATACTTTAAACACCTTGCTTCGCAAAGATGGTCTT-GAATTA 789 |||| | || || ||||| ||||| |||||| |||| ||||| | ||| || ||| | Sbjct 855 ACTCCCGCGCTTTGAATGACACTTTGAACACCATGCTCCGCAAGGGCGGT-TTGGAACT- 912 Query 790 CGCAGAC-TT-GTTAATGCTGGCAAATCAG-A-AGACGAAGTACAAGCTCGCAAGGAAGA 845 || | | || || || | ||| || || | ||| |||||| | || | ||||| || Sbjct 913 -GCGGGCTTTGGTCAACGAAGGC-AA-GAGTACAGAAGAAGTAGAGGCGCACAAGGCTGA 969 Query 846 AATGTTAAATGATGTCTTCCGTGTTCTTGCAATTTCAACTT-GTGTTCCACCAAAGAAAT 904 | | || | | | ||||||| | || || | ||| |||| | | || ||||||| | Sbjct 970 ACTTTTGGACGCTATCTTCCGCATGCTGGCCACTTC-ACTTGGCCTGCCGCCAAAGAGCT 1028 Query 905 TTAACTTCGAATAC-CGTGACGATAATC-ACAACTACCACATCGACAAGGACATTACGCC 962 | ||||| |||||| | ||||||| | | |||||||||||||||||||||||| || || Sbjct 1029 TCAACTTTGAATACAC-TGACGATGA-CGGCAACTACCACATCGACAAGGACATCACCCC 1086 Query 963 -TAAGGAATTCTTTGACAAA-TATGTTGGTAT-GGATTTAGCCAACCATATTTCAACTAT 1019 || || ||| || | ||| || ||||| | ||| | | ||| | || ||| ||| Sbjct 1087 GCAA-GACTTC-TTCAAAAAGTACGTTGG-CTGGGACCTGGAAAACTACATCTCAGTTAT 1143 Query 1020 CAATGCCCCAACTAGC-GACAAGCCTTTCCACAAGGTATTCTCAGTTGAATACTTAGGTA 1078 ||| | || ||| || ||||| || | | ||||||| |||||||| |||||| | || | Sbjct 1144 CAACGGGCCTACT-GCTGACAAACCATACAACAAGGTCTTCTCAGTAGAATACCTGGGCA 1202 Query 1079 ACGTTGAAGGTGGTCGTCAAGTTCGTCA-CTTAAACT-TAAAGGTTGATGAAATGAAGGA 1136 |||| | || || || ||||| || || || || || || || | | | ||||| Sbjct 1203 ACGTGGTTGGCGGCCGGCAAGTCCGCCACCTCAACCTGGAACTGTCCA--AGTTCAAGGA 1260 Query 1137 TTTGATCATCAAGCAATT-AAACAACGGCGAAGTTGTATGGTTTGGTTCAAACGTTGT-T 1194 |||||||||| ||||| || ||| ||||||||||| |||||||||||| ||||| | Sbjct 1261 ACTGATCATCAACCAATTGAAGCAA-GGCGAAGTTGTTTGGTTTGGTTCAGACGTT-TCC 1318 Query 1195 AAGGATTCTGAACGTCG-CGCTGGACTTCTT-GCCACCAATCTTTACCGCCGTGATCA-A 1251 |||| ||| || | || || ||| || | ||| || | |||| | || || Sbjct 1319 AAGGGCGGTGACCG-GGAAGCCGGCCTT-TTGGACACTAAGATCTACCAAAGAGACCAGC 1376 Query 1252 TTATTTGACGT-TGACTTCTCAATG-TCTAAGGCTGATAAG-CTTGACTCAGGCGAAAGC 1308 || |||||| | |||||||||||| | |||||||| | || ||||||||||||||| Sbjct 1377 TT-TTTGAC-TACGACTTCTCAATGAGC-AAGGCTGA-CCGCCTGGACTCAGGCGAAAGC 1432 Query 1309 ATGATGGACCACGCAATGGTTATTACTGGTGTTGACATCGTTGATGGCAAACCAACTAAG 1368 |||||| ||||||| |||||||| |||| |||||| | ||||| | ||| ||||||||| Sbjct 1433 ATGATGAACCACGCCATGGTTATCACTGCCGTTGACCTGGTTGACGACAAGCCAACTAAG 1492 Query 1369 TGGAAGATTGAAAACTCATGGGGTGAAAAGCCAGGCTTTAAAGGCTACTTCGTAATGAGT 1428 |||||||| ||||||||||||||||| ||| ||||||| || ||||||||||| ||||| Sbjct 1493 TGGAAGATCGAAAACTCATGGGGTGACAAGTCAGGCTTCAAGGGCTACTTCGTCATGAGC 1552 Query 1429 GATTCATGGTTTGACTC-ATTTGTATACCAAGCAGTTATT-AACAAAGATATT-TTGCCA 1485 || |||||| ||| | ||| || ||||| || ||| || ||| ||| || ||||| Sbjct 1553 GACGAATGGTTCGAC-CAATTCGTTTACCAGGCTGTT-TTGAAC-AAGGCCTTCCTGCCA 1609 Query 1486 GAAGATC-TTAAGAAGGCTTACGACGAAGGCAAGGATAATCCTATTC-AA-TTATTGCCA 1542 ||||| | |||||||||||||||||||||||||||| || || || | || || | |||| Sbjct 1610 GAAGA-CGTTAAGAAGGCTTACGACGAAGGCAAGGAAAACCCAAT-CGAACTTCT-GCCA 1666 Query 1543 TGGGATCCAATGGGTGCTTTAGCATTT 1569 ||||| |||||||| ||||| || ||| Sbjct 1667 TGGGACCCAATGGGCGCTTTGGC-TTT 1692 >gb|DQ222973.1| Lactobacillus helveticus CRL 1176 insertion sequence IS15807 transposase gene, complete cds; and EpsE (epsE) gene, complete cds Length=2523 Score = 211 bits (114), Expect = 8e-52 Identities = 121/124 (97%), Gaps = 2/124 (1%) Strand=Plus/Plus Query 1 TAAGCTTAAGGCAGTTCAATCAGATCAGACTCTTTTCTTTTTGATACTACAACTTGAGTC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 936 TAAGCTTAAGGCAGTTCAATCAGATCAGACTCTTTTCTTTTTGATACTACAACTTGAGTC 995 Query 61 TAGTCCGATTGGACTTTTTTATTAACTAAAACGATTTAACTAGCACCACGCGTAAATTAA 120 ||||||||||||||||||||||||||||||||||||||||||||||||||||| | | || Sbjct 996 TAGTCCGATTGGACTTTTTTATTAACTAAAACGATTTAACTAGCACCACGCGTTA-T-AA 1053 Query 121 ATAT 124 |||| Sbjct 1054 ATAT 1057 >emb|X81979.1|LHPLH3 L.helveticus plasmid pLH3 DNA (2 ORFs) Length=3414 Score = 209 bits (113), Expect = 3e-51 Identities = 113/113 (100%), Gaps = 0/113 (0%) Strand=Plus/Minus Query 1 TAAGCTTAAGGCAGTTCAATCAGATCAGACTCTTTTCTTTTTGATACTACAACTTGAGTC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 113 TAAGCTTAAGGCAGTTCAATCAGATCAGACTCTTTTCTTTTTGATACTACAACTTGAGTC 54 Query 61 TAGTCCGATTGGACTTTTTTATTAACTAAAACGATTTAACTAGCACCACGCGT 113 ||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 53 TAGTCCGATTGGACTTTTTTATTAACTAAAACGATTTAACTAGCACCACGCGT 1 >emb|AJ002481.1|LHAJ2481 Lactobacillus helveticus gene encoding transmembrane protein Length=1344 Score = 150 bits (81), Expect = 2e-33 Identities = 81/81 (100%), Gaps = 0/81 (0%) Strand=Plus/Plus Query 1575 TTAATAATTAGATTTATTCCACATAATTAAAAGACTAGGAATGTTTGACACTTCTAGTCT 1634 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1 TTAATAATTAGATTTATTCCACATAATTAAAAGACTAGGAATGTTTGACACTTCTAGTCT 60 Query 1635 TTTTCATGAAAAGGCAAAAAA 1655 ||||||||||||||||||||| Sbjct 61 TTTTCATGAAAAGGCAAAAAA 81 >gb|AY616518.1| Download subject sequence spanning the HSP Lactobacillus helveticus DPC4571 disrupted lactose operon, complete sequence; insertion sequence ISLhe1, complete sequence; and insertion sequence ISLhe6, complete sequence Length=11771 Score = 117 bits (63), Expect = 2e-23 Identities = 105/123 (85%), Gaps = 12/123 (9%) Strand=Plus/Minus Query 1 TAAGCTTAAGGCAGTTCAATC-AGATCAGACTCTTTTCT-T-T-TTGA-TA-CTACAACT 54 |||||||||| |||||||||| || |||||||||||||| | | || | || ||||| | Sbjct 2991 TAAGCTTAAGACAGTTCAATCTAG-TCAGACTCTTTTCTATATATT-ACTATTTACAAGT 2934 Query 55 TGAGTCTAGTC-CGATTGGACTTTTTTA-TTAACTAAAACGATTTAACTAGCACCACGCG 112 ||||||| | |||||||| |||||| ||||||||||||||||||||||||||||||| Sbjct 2933 CGAGTCTA-ACAAGATTGGAC-TTTTTATTTAACTAAAACGATTTAACTAGCACCACGCG 2876 Query 113 TAA 115 ||| Sbjct 2875 TAA 2873 >gb|AY365129.1| Lactobacillus helveticus CNRZ32 endopeptidase F (pepF) gene, complete cds Length=2580 Score = 115 bits (62), Expect = 6e-23 Identities = 108/128 (84%), Gaps = 12/128 (9%) Strand=Plus/Plus Query 1 TAAGCTTAAGGCAGTTCAATC-AGATCAGACTCTTTTCT-TT-TTGA-TA-CTACAACTT 55 |||||||||| ||||||||| || |||||||||||||| || || | || ||||| | Sbjct 96 TAAGCTTAAGATAGTTCAATCTAG-TCAGACTCTTTTCTATTATT-ACTATTTACAAGTC 153 Query 56 GAGTCTAGTC-CGATTGGACTTTTTTA-TTAACTAAAACGATTTAACTAGCACCACGCGT 113 ||||||| | |||||||| |||||| |||||||||||||||||||||||||||||||| Sbjct 154 GAGTCTA-ACAAGATTGGAC-TTTTTATTTAACTAAAACGATTTAACTAGCACCACGCGT 211 Query 114 AA-ATTAA 120 | ||||| Sbjct 212 ATTATTAA 219 >gb|EF015485.1| Streptococcus infantarius subsp. infantarius putative aminopeptidase C (pepC) gene, partial cds Length=921 Score = 110 bits (59), Expect = 3e-21 Identities = 173/225 (76%), Gaps = 20/225 (8%) Strand=Plus/Plus Query 500 ACTTCGAA-TTATCTCAAAAC-TACACTA-ACTTCTGGGATAAATTTGAAAAATCTAACT 556 |||||||| || |||| || | |||| | ||||||||| |||| |||||||| |||| Sbjct 80 ACTTCGAACTT-TCTC-AAGCGCACAC-ATTCTTCTGGGACAAATACGAAAAATCAAACT 136 Query 557 GGTTCTTCGAA-AACGTGATTGCGACTGCTGACAAAG-ATTTAGGCGA-TCGTAAGGTTT 613 ||||||| ||| || || ||||| ||||||||| ||| | || || | ||||| || Sbjct 137 GGTTCTTAGAACAA-GTTATTGCAACTGCTGACCAAGAACTT-GG-TAGCCGTAAAGTAA 193 Query 614 CATTCTTGTTTGCA-ACACCACAACAAGATGGTGGTCAATGGGATATGCTT-T-GCGGTA 670 |||||| ||| | |||||||||||||||||||||||||||||| || | || | Sbjct 194 AATTCTTACTTG-ATGTGCCACAACAAGATGGTGGTCAATGGGATATGGTTGTTGCTCTT 252 Query 671 TTATCGAAAAATACGGTATCGTACCAAAGAGC-GTTTACCCAGAA 714 || | |||||||||||| | || || || ||| | |||||||||| Sbjct 253 TT-T-GAAAAATACGGTGTTGTGCCCAA-AGCTGCTTACCCAGAA 294 >gb|CP000416.1| Download subject sequence spanning the HSP Lactobacillus brevis ATCC 367, complete genome Length=2291220 Features in this part of subject sequence: Aminopeptidase C Score = 106 bits (57), Expect = 4e-20 Identities = 220/295 (74%), Gaps = 26/295 (8%) Strand=Plus/Minus Query 418 CAAAAGCAATCAGGTCGTTGCTGGATGTTTAG-TGCTTTAAACACTATGCGCCACCCA-T 475 ||||||||| |||||||||||||||||| | ||| ||||| || ||||| || || | Sbjct 606136 CAAAAGCAAAGTGGTCGTTGCTGGATGTTT-GCTGCATTAAATACCATGCGGCA-TCATT 606079 Query 476 TA-CAAAAGAAGTTTAAGTTACAG-GACTTCGAATTATCTCAAAACTACAC-TAACTTCT 532 || | | ||||||||| || ||||| ||| |||| || |||||||| | |||||| Sbjct 606078 TAGC-TGATCTCTTTAAGTTA-AGCGACTTTGAACTATCCCAGAACTACACGT-ACTTCT 606022 Query 533 GGGATAAATTTGAAAAATCTAACTGGTTCTTCGAAAACGTGATT-GCGACTGCTGA-C-A 589 ||||||| |||||||| | |||| |||| |||||| || || || || || || | | Sbjct 606021 GGGATAAGTTTGAAAAGGCCAACTATTTCTACGAAAATGT-TTTGGCAACGGCAGATCAA 605963 Query 590 --AA-GATTTAGGCGATCGTAAGGT-TTCATTCTTGTTTG-CAACACCACAACAAGATGG 644 || | | || || ||||| || | ||| | || | || |||||||||||||| Sbjct 605962 CCAACG-TCTA-GC---CGTAAAGTGGCCTTTC-T-CATGACGACCCCACAACAAGATGG 605910 Query 645 TGGTCAATGGGATATGCTTTGCGGTATTATCGAAAAATACGGTATCGTACCAAAG 699 |||||||||||||||||| || | || || ||||| ||||| ||||| || ||| Sbjct 605909 TGGTCAATGGGATATGCTCTGTGCCATCATTGAAAAGTACGGAATCGTCCCTAAG 605855 >gb|DQ221764.1| Lactobacillus helveticus strain WSU19 aminopeptidase N (pepN) gene, complete cds Length=5035 Score = 106 bits (57), Expect = 4e-20 Identities = 101/120 (84%), Gaps = 11/120 (9%) Strand=Plus/Plus Query 1 TAAGCTTAAGGCAGTTCAATC-AGATCAGACTCTTTTCT-TT-TTGA-TA-CTACAACTT 55 |||||||||| ||||||||| || |||||||||||||| || || | || ||||| | Sbjct 241 TAAGCTTAAGATAGTTCAATCTAG-TCAGACTCTTTTCTATTATT-ACTATTTACAAGTC 298 Query 56 GAGTCTAGTC-CGATTGGACTTTTTTA-TTAACTAAAACGATTTAACTAGCACCACGCGT 113 |||| || | |||||||| |||||| |||||||||||||||||||||||||||||||| Sbjct 299 GAGTTTA-ACAAGATTGGAC-TTTTTATTTAACTAAAACGATTTAACTAGCACCACGCGT 356 >gb|DQ221765.1| Lactobacillus helveticus strain WSU19 endopeptidase O (pepO) gene, complete cds Length=4334 Score = 95.3 bits (51), Expect = 8e-17 Identities = 93/111 (83%), Gaps = 12/111 (10%) Strand=Plus/Minus Query 17 CAATC-AGATCAGACTCTTTTCT-TT-TTGA-TA-CTACAACTTGAGTCTAGTC-CGATT 70 ||||| || |||||||||||||| || || | || ||||| | |||| || | |||| Sbjct 4334 CAATCTAG-TCAGACTCTTTTCTATTATT-ACTATTTACAAGTCGAGTTTA-ACAAGATT 4278 Query 71 GGACTTTTTTA-TTAACTAAAACGATTTAACTAGCACCACGCGTAA-ATTA 119 |||| |||||| |||||||||||||||||||||||||||||||||| |||| Sbjct 4277 GGAC-TTTTTATTTAACTAAAACGATTTAACTAGCACCACGCGTAATATTA 4228 >gb|CP000425.1| Download subject sequence spanning the HSP Lactococcus lactis subsp. cremoris SK11, complete genome Length=2438589 Features in this part of subject sequence: Aminopeptidase C Score = 82.4 bits (44), Expect = 6e-13 Identities = 192/258 (74%), Gaps = 32/258 (12%) Strand=Plus/Minus Query 416 ATCAAAAGCAATCAGGTCGTTGCTGGATGTTTAG-TGCTTTAAACACTATGCGCCACCCA 474 ||||||| ||||| || ||||||||||||||| | |||||| |||||| | || || | Sbjct 1965918 ATCAAAAACAATCTGGACGTTGCTGGATGTTT-GCTGCTTTGAACACTTTCCGTCATAAA 1965860 Query 475 -TTACAAAAGAAGTTTAAGTTACAG--GACTTCGAATTATCTCA-AAAC-TACACTAACT 529 ||| || ||| ||||| |||| || || ||||| | ||| || | || ||| || Sbjct 1965859 TTTATTAATGAA-TTTAA--AACAGAAGATTTTGAATT-T-TCACAAGCTTATACTTTCT 1965805 Query 530 TCTGGGATAAATTTGAAAAATCTAACTGGTTCT-TCGAA-AACGTGAT-TGCGACTGCTG 586 |||||||||||| ||||||||| |||||||| | | ||| || | || | || || || Sbjct 1965804 TCTGGGATAAATATGAAAAATCAAACTGGTT-TATGGAACAA-ATTATAGGAGA-TGTTG 1965748 Query 587 ACAAAGATTTAGG-CGATCGTAAGGTTT--CATTCTTGTTTGC-AACACCACAACAAGAT 642 | || | || ||| ||| |||| |||| | |||| ||| |||||||||||| Sbjct 1965747 -C---GA--T-GGACGACCGT--CGTTTGAAATTCCT-CTTGCAAACTCCACAACAAGAT 1965698 Query 643 GGTGGTCAATGGGATATG 660 |||||||||||||||||| Sbjct 1965697 GGTGGTCAATGGGATATG 1965680 >gb|M86245.1|LACAPEPC Lactococcus lactis cysteine aminopeptidase (pepC) gene, complete cds Length=2748 Score = 82.4 bits (44), Expect = 6e-13 Identities = 192/258 (74%), Gaps = 32/258 (12%) Strand=Plus/Plus Query 416 ATCAAAAGCAATCAGGTCGTTGCTGGATGTTTAG-TGCTTTAAACACTATGCGCCACCCA 474 ||||||| ||||| || ||||||||||||||| | |||||| |||||| | || || | Sbjct 899 ATCAAAAACAATCTGGACGTTGCTGGATGTTT-GCTGCTTTGAACACTTTCCGTCATAAA 957 Query 475 -TTACAAAAGAAGTTTAAGTTACAG--GACTTCGAATTATCTCA-AAAC-TACACTAACT 529 ||| || ||| ||||| |||| || || ||||| | ||| || | || ||| || Sbjct 958 TTTATTAATGAA-TTTAA--AACAGAAGATTTTGAATT-T-TCACAAGCTTATACTTTCT 1012 Query 530 TCTGGGATAAATTTGAAAAATCTAACTGGTTCT-TCGAA-AACGTGAT-TGCGACTGCTG 586 |||||||||||| ||||||||| |||||||| | | ||| || | || | || || || Sbjct 1013 TCTGGGATAAATATGAAAAATCAAACTGGTT-TATGGAACAA-ATTATAGGAGA-TGTTG 1069 Query 587 ACAAAGATTTAGG-CGATCGTAAGGTTT--CATTCTTGTTTGC-AACACCACAACAAGAT 642 | || | || ||| ||| |||| |||| | |||| ||| |||||||||||| Sbjct 1070 -C---GA--T-GGACGACCGT--CGTTTGAAATTCCT-CTTGCAAACTCCACAACAAGAT 1119 Query 643 GGTGGTCAATGGGATATG 660 |||||||||||||||||| Sbjct 1120 GGTGGTCAATGGGATATG 1137 >emb|AM406671.1| Download subject sequence spanning the HSP Lactococcus lactis subsp. cremoris MG1363, complete genome Length=2529478 Features in this part of subject sequence: PepC protein Score = 76.8 bits (41), Expect = 3e-11 Identities = 191/258 (74%), Gaps = 32/258 (12%) Strand=Plus/Minus Query 416 ATCAAAAGCAATCAGGTCGTTGCTGGATGTTTAG-TGCTTTAAACACTATGCGCCACCCA 474 ||||||| ||||| || ||||||||||||||| | |||||| |||||| | || || | Sbjct 2052942 ATCAAAAACAATCTGGACGTTGCTGGATGTTT-GCTGCTTTGAACACTTTCCGTCATAAA 2052884 Query 475 -TTACAAAAGAAGTTTAAGTTACAG--GACTTCGAATTATCTCA-AAAC-TACACTAACT 529 ||| || ||| ||||| |||| || || || || | ||| || | || ||| || Sbjct 2052883 TTTATTAATGAA-TTTAA--AACAGAAGATTTTGAGTT-T-TCACAAGCTTATACTTTCT 2052829 Query 530 TCTGGGATAAATTTGAAAAATCTAACTGGTTCT-TCGAA-AACGTGAT-TGCGACTGCTG 586 |||||||||||| ||||||||| |||||||| | | ||| || | || | || || || Sbjct 2052828 TCTGGGATAAATATGAAAAATCAAACTGGTT-TATGGAACAA-ATTATAGGAGA-TGTTG 2052772 Query 587 ACAAAGATTTAGG-CGATCGTAAGGTTT--CATTCTTGTTTGC-AACACCACAACAAGAT 642 | || | || ||| ||| |||| |||| | |||| ||| |||||||||||| Sbjct 2052771 -C---GA--T-GGACGACCGT--CGTTTGAAATTCCT-CTTGCAAACTCCACAACAAGAT 2052722 Query 643 GGTGGTCAATGGGATATG 660 |||||||||||||||||| Sbjct 2052721 GGTGGTCAATGGGATATG 2052704
  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS,environmental 
samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  May 27, 2007  5:48 PM
  Number of letters in database: -1,893,610,565
  Number of sequences in database:  638,589
Lambda     K      H
    1.33    0.621     1.12 
Gapped
Lambda     K      H
    1.33    0.621     1.12 
Matrix: blastn matrix:1 -2
Gap Penalties: Existence: 0, Extension: 0
Number of Sequences: 638589
Number of Hits to DB: 229956
Number of extensions: 3
Number of successful extensions: 3
Number of sequences better than 10: 2
Number of HSP's better than 10 without gapping: 0
Number of HSP's gapped: 2
Number of HSP's successfully gapped: 2
Length of query: 1655
Length of database: 2401356727
Length adjustment: 31
Effective length of query: 1624
Effective length of database: 2381560468
Effective search space: 3867654200032
Effective search space used: 3867654200032
A: 0
X1: 15 (28.8 bits)
X2: 32 (59.1 bits)
X3: 54 (99.7 bits)
S1: 15 (28.8 bits)
S2: 21 (39.9 bits)