spacer

ClustalW Results


Results of search
Number of sequences 5
Alignment score 41243
Sequence format Pearson
Sequence type nt
ClustalW version 1.83
JalView
Output file clustalw-20070604-07480067.output
Alignment file clustalw-20070604-07480067.aln
Guide tree file clustalw-20070604-07480067.dnd
Your input file clustalw-20070604-07480067.input

To save a result file right-click the file link in the above table and choose "Save Target As".
If you cannot see the JalView button, reload the page and check your browser settings to enable Java Applets.




Scores Table

SeqA Name                 Len(nt)  SeqB Name                 Len(nt)  Score
===========================================================================
1    Lhelveticus          1350     2    Lcasei               1347     60   
1    Lhelveticus          1350     3    Lactococcus_lactis   2748     53   
1    Lhelveticus          1350     4    L.delbrueckii        2026     71   
1    Lhelveticus          1350     5    Rhodothermus         2907     1    
2    Lcasei               1347     3    Lactococcus_lactis   2748     56   
2    Lcasei               1347     4    L.delbrueckii        2026     60   
2    Lcasei               1347     5    Rhodothermus         2907     1    
3    Lactococcus_lactis   2748     4    L.delbrueckii        2026     34   
4    L.delbrueckii        2026     5    Rhodothermus         2907     1    
===========================================================================
PLEASE NOTE: Some scores may be missing from the above table if the alignment was done using multiple CPU mode. Please check the output.




Alignment

CLUSTAL W (1.83) multiple sequence alignment


Lhelveticus             ------------------------------------------------------------
L.delbrueckii           ------------------------------------------------------------
Lcasei                  ------------------------------------------------------------
Lactococcus_lactis      ------------------------------------------------------------
Rhodothermus            GAGGAGATGAATGTGCTTCCCCCTTTGCAGATCGAAATCGAAGGCACCGGCATTTCCCGG 60
                                                                                    

Lhelveticus             ------------------------------------------------------------
L.delbrueckii           ------------------------------------------------------------
Lcasei                  ------------------------------------------------------------
Lactococcus_lactis      CAGCTGAACAACTGGTAATTGATTATTCAGAGAAAAGTGTGATAGTTCAAAAAGAAAAAT 60
Rhodothermus            CCGCTCAGCGAGCACGTGAACCTGCTTGGCGGCCTGCTGGGACAGGTCATCCAGGAAATG 120
                                                                                    

Lhelveticus             ------------------------------------------------------------
L.delbrueckii           ------------------------------------------------------------
Lcasei                  ------------------------------------------------------------
Lactococcus_lactis      TAATTGCAAAAAATACTGACGAAAATTTGAAGCTAATTTTTACTGATGGAGTGCAACAAA 120
Rhodothermus            GCCGGTCCCGAAATGCTGGAGCTGGTCGAGACGCTACGGCGCCTGTGCAAGCAGGCGGCC 180
                                                                                    

Lhelveticus             ------------------------------------------------------------
L.delbrueckii           ------------------------------------------------------------
Lcasei                  ------------------------------------------------------------
Lactococcus_lactis      AAGAGATTAACCAGTTTATCAGTAAGAGTCAAGCTTTTGTTGCTGGACTTATGCATGATA 180
Rhodothermus            CAGGAAAACCGTCCCGAGTTCCGGGAGCAGGCCTACACGCGCATTCACAGCGCCACCTAC 240
                                                                                    

Lhelveticus             ------------------------------------------------------------
L.delbrueckii           ------------------------------------------------------------
Lcasei                  ------------------------------------------------------------
Lactococcus_lactis      TTGGTGGGGTTTATCCAAATCATCAGCGAGTAGAAAAAGCAGAATTATTTGGTATAGAAT 240
Rhodothermus            GACGAGCTGCTCTGGCTGCTGCGCGCCTACACGGCGTTTTTCCACCTGGTCAACCAGGCC 300
                                                                                    

Lhelveticus             ------------------------------------------------------------
L.delbrueckii           ------------------------------------------------------------
Lcasei                  ------------------------------------------------------------
Lactococcus_lactis      TACTGACAGAAGAGCGTGAATTTCCTTTGATTATTCATCAAAAACTTTCTAAATATCTGG 300
Rhodothermus            GAGCAGCAGGAGATCATCCGGATCAACCGGGAACGGGCACAGCAGAGTACGCCCGAACGT 360
                                                                                    

Lhelveticus             ------------------------------------------------------------
L.delbrueckii           --------------------------------------------------AAAGTCATTG 10
Lcasei                  ------------------------------------------------------------
Lactococcus_lactis      CGCGTGAGCATTTTAAAATTACTGACGAAAATATATTGTCAGCGATTGAGTGCCACACAA 360
Rhodothermus            CCGCGTCCGGAGTCGATCGACGAGGCCATCCTGGCCCTCAAGCAGCAGGGCCGGACGCTG 420
                                                                                    

Lhelveticus             ------------------------------------------------------------
L.delbrueckii           AAATCAAGCGACGGCCAGTTGGTTGCCAAAAGTCCCCTCCTCTTGATCGAGAGAAAGAGC 70
Lcasei                  ------------------------------------------------------------
Lactococcus_lactis      CACTGAAGGAAAATTTTACAGAGTTAGATTTGATTGTTTTTCTTGCTGACAAAATTTCTT 420
Rhodothermus            GACGACGTGCTGACGCTGCTGGAGCGGCTGGACATCCAGCCCACGGTGACCGCCCATCCC 480
                                                                                    

Lhelveticus             ------------------------------------------------------------
L.delbrueckii           GGGCCGGTTTGGGCCATGAACCAGCTTTTTATTG--CGCCGGGGGCACCAGAAGGAACTT 128
Lcasei                  ------------------------------------------------------------
Lactococcus_lactis      GGGATGGTGGGGATAATGCACCATTCAAAGAAGGATTACTGACAGCTCTGTCAGTAAATT 480
Rhodothermus            ACCGAGGCGCGCCGTCGCAGCATCCTCTACAAGCAGCAGCACATTGCCCAGATGCTTTCC 540
                                                                                    

Lhelveticus             ------------------------------------------------------------
L.delbrueckii           TGGACCAAGTGATGAAGCAAGTAGAAAAGCTTTGCCAGGAGACGGGCTTAAAAGTTTGGC 188
Lcasei                  ------------------------------------------------------------
Lactococcus_lactis      TGCAAAGTGCAGCACTTTATTATATAGACTTCATCATCAATGATGGCTTGAAAGTTGCGC 540
Rhodothermus            CAGCAACGCCGCTGTCAGCTCACGCCCGAGGAGCAGGAGACCCTGCTGCTGGACCTGCAC 600
                                                                                    

Lhelveticus             ------------------------------------------------------------
L.delbrueckii           CTTTAGACCCGCAAGTGATCGCTTATTGTCAAAAGCACGGGGAATTGACGAACATTTGGG 248
Lcasei                  ------------------------------------------------------------
Lactococcus_lactis      ACCCGTGGCTTTTAGAAGCAAAGAAAGATTTAGAAAATCAGCTTTCCTAGCTGATTTTT- 599
Rhodothermus            AATCAGATCACGTTGCTGCTGGGCACGGCCGAAGTGCGCGAGGAGCGCCCCACCGTTCGC 660
                                                                                    

Lhelveticus             ------------------------------------------------------------
L.delbrueckii           CCGGGAAACCAACAAATTAAGCTACTTTGATAGACGGCCTTGCTTTTATGGGCTAAAATG 308
Lcasei                  ------------------------------------------------------------
Lactococcus_lactis      TTGATAATTTAGATTATAATAGAAGAATGTAAAAATAATAGAATATCATTAATCAAAATC 659
Rhodothermus            GACGAAGTCGAACAGGGCCTGTACTTTATCCAGAGTACGATCTGGGAGGCGGTGCCCCGC 720
                                                                                    

Lhelveticus             --------------------------------------------ATGGCAAAAGAAATTA 16
L.delbrueckii           GGCTTAGACAGTTTTTTTAAAAAAGAGAAACAGGAGGCAATAGGATGTCAAAAGAAATCA 368
Lcasei                  --------------------------------------------ATGTCTGCAGAAATTA 16
Lactococcus_lactis      GATAATGATTATTTTTATCGAAACTTTTGTCAGAAGTTT-CGATTTATTGGGAGGTATTA 718
Rhodothermus            ATCTATGAAGACGTGCGCCGGGCGCTGCGCCGCTACTACGGCGCCGATGTGGACTTCCGG 780
                                                                            *       

Lhelveticus             ATAACG--ATACCATTGCAA--AATTTGAAAATGATTTAAACAATCATCCTGTTTTCAAT 72
L.delbrueckii           GCTTTG--ACACGATCGAAG--ACTTCACCAGCAACTTGAGCAAGCACCCAGCTTACGGG 424
Lcasei                  CCACTG--GCGATCTGGCTC--AATTCAAACAAGATCTCCAAGCCACACCCGGTGCCTCC 72
Lactococcus_lactis      -TGACA--GTAACAT--CAG--ATTTCACACAAAAACTCTACGAAAATTTTGCTGAAAAC 771
Rhodothermus            CCGTTTTTGCGCTACCGCTCCTGGATCGGGAGCGACCGCGACGGCA-ACCCGTACGTCAC 839
                                                 *        *                *        

Lhelveticus             GTTGCAAGTCACGCAGCACAAGAAAACGGTATTTACAAAG--CAAGTCAAAACTTACAAA 130
L.delbrueckii           GTAGCTGCCAACGCTGCCCAAACCAACGGGATTTTCAAGG--CCAGCCAAAGCACCCAAA 482
Lcasei                  GCTCTTCAAAAAGCGGTCATGAACAACGGTATCAACGCAA--CTGCTGAGAACACCGACA 130
Lactococcus_lactis      ACAAAATTGCGTGCGGTGGAAAATGCCGTGACTAAAAATGGTTTGCTTTCATCACTCGAA 831
Rhodothermus            GCCGGAAATCACGCGCTGGACGGCCCTGACG-CAACGACGTTTGGCGCTCCAGCGCTACA 898
                                    **             *                               *

Lhelveticus             C--TAAGATCGACTTAGACCCAATTT-------TCTCAATTGAAATTGATACTGG-TAAG 180
L.delbrueckii           G--CAAGGTTGACCTGGACCCAACCT-------TCTCAGTGGAAATCGACACTGG-TTCA 532
Lcasei                  G--CAAAGTTGCCATGACCCCGACTT-------TTTCTATTGAACTTGATACCGG-CAGC 180
Lactococcus_lactis      GTGCGTGGTTCACATGCAGCGAATTTGCCTGAGTTTTCACTTGACTTGACAAAAGACCCT 891
Rhodothermus            TGGAAGAGCTGCGTCAGCTCCGGCGTCGGTTGAGCCTGTCGGATCGTTACGTGGCACCGC 958
                                           *     *                      *           

Lhelveticus             CCAGCTGATCAAAA-GCAATCAGGTC---GTTGCTGGATGTTTAGTGCTTTAAACAC-TA 235
L.delbrueckii           GTTACCAACCAAAA-ACAGTCAGGCC---GCTGCTGGATGTTCAGTGCTTTGAACAC-CA 587
Lcasei                  GTTGCTAACCAAAA-GCAAAGTGGCC---GTTGCTGGATGTTTGCCGCCCTCAACAC-GA 235
Lactococcus_lactis      GTAACGAATCAAAA-ACAATCTGGAC---GTTGCTGGATGTTTGCTGCTTTGAACAC-TT 946
Rhodothermus            CCGAGGAACTGCGTCGCTCACTGGCCCGCGACGCCCGGGAGGTATCGCTCCCGCCCCATG 1018
                               *        *     ** *   *  **  *         **      * *   

Lhelveticus             TGCGCCACCCATTACAAAAGAAGT--TTAAGTTACAGGACTTCGAATTATCTCAAA--AC 291
L.delbrueckii           TGCGTCACTCAATCCAAAAGGAAT--TCAAGCTGAAGGGCTTTGAATTGTCACAGA--GC 643
Lcasei                  TGCGTCACGGCATTCAAGCACAAT--TTAAAATCAAAGACTTCGAACTTTCTCAGA--AT 291
Lactococcus_lactis      TCCGTCATAAATTTATTAATGAAT--TTAAAACAGAAGATTTTGAATTTTCACAAG--CT 1002
Rhodothermus            TACTTCGCCAGTTCCGGCACGAGTCGTTCCGGTTGAAGATCTCGTACATCATGGGGCGGC 1078
                        * *  *      *        * *  *        * *   * * *              

Lhelveticus             TACAC---TAACTTCTGGGATAAATTTGAAAAATCTAACTGGTTCTTCGAAAACGTGATT 348
L.delbrueckii           TACAC---CTTCTTCTGGGACAAGTTTGAAAAGTCAAACTTCTTCTTTGAAAACGTGATC 700
Lcasei                  TACAC---CTTCTTCTGGGACAAATTTGAAAAATCCAATTATTTTTATGAAAATGTTCTA 348
Lactococcus_lactis      TATAC---TTTCTTCTGGGATAAATATGAAAAATCAAACTGGTTTATGGAACAAATTATA 1059
Rhodothermus            TGCACGGGCTGCTTCAGGCGCTGGATGACCCGACGCAGCCTGCGCC-CGACTACGACGCC 1137
                        *  **      **** **                  *           **  *       

Lhelveticus             GCGACTGCTGACAAAGATTT-AGGCGATCGTAAGGTTTCATT----CTTGTTTGCAACAC 403
L.delbrueckii           GGCTCAGCTGACAAGCCACT-GGGCGACCGGAAGGTCTCCTT----CCTCTTTGCCACTC 755
Lcasei                  AAAACCGCCGATCAACCACT-CGACAGCCGTAAAGTTGCTTT----TTTGATGACCACAC 403
Lactococcus_lactis      GGAGATGTTG------CGAT-GGACGACCGTCGTTTGAAATT----CCTCTTGCAAACTC 1108
Rhodothermus            GACGCCTTCGTCGAAGACCTGCGGCTGCTGCAGCGCTGCCTGGAGGCCTGCGGTCTGGAG 1197
                                 *         *  * *    *          *       *           

Lhelveticus             CACAACAAG-ATGGTGGTCAATGGGATATGCTTTGCGGT-ATTATCGAAAAATACGG--- 458
L.delbrueckii           CGCAATCAG-ACGGCGGGCAATGGGACATGCTCTGCGGC-TTGATTGAAAAGTACGG--- 810
Lcasei                  CACAACAGG-ATGGTGGTCAGTGGGATATGTTGTCTGCT-TTGATCGAAAAATACGG--- 458
Lactococcus_lactis      CACAACAAG-ATGGTGGTCAATGGGATATGATGGTAGCC-ATTTTTGACAAATATGG--- 1163
Rhodothermus            CGCATTGCGCGTCACGATCAGCTC-ACACGCCTGCTGGTGCTGGCCCAGACGTTCGGCTT 1256
                        * **    *      *  **     * * *      *    *     * *  *  **   

Lhelveticus             ------TATCGTACCAAA-GAGCGTTTACCCAGAAACTGCTAA--------TGCAACCAA 503
L.delbrueckii           ------GATCGTGCCGAA-GAAGGTTTACCCGGAAACTGCTAA--------CTCAGAAAA 855
Lcasei                  ------GATCGTTCCTAA-GTCCGTGATGCCGGAAACTTACAG--------CTCAAGTAA 503
Lactococcus_lactis      ------AATTGTTCCAAA-AGCTGTTTATCCTGAATCACAAGC--------TTCAAGTAG 1208
Rhodothermus            CCACCTGGTCACGCTCGACGTGCGCCAGCACAGCAGCGTGCACGAAGCCGCCGTGGCCGA 1316
                                *    *   *     *      * * * *                       

Lhelveticus             CTCAAGTGCATTAAATGATACTTTAAACACCTTGCTTCGCAAAGATGGTCTTGAATT-AC 562
L.delbrueckii           CTCCCGCGCTTTGAATGACACTTTGAACACCATGCTCCGCAAGGGCGGTTTGGAACT-GC 914
Lcasei                  AAGTAGCGAGTTGAACGGTTTGTTGAACTTGAAGTTACGCAAGGACGCTGTTGCGCT-TC 562
Lactococcus_lactis      CTCACGCGAATTGAATCAATACTTGAACAAATTGCTCCGACAAGATGCTGAAATCTT-AC 1267
Rhodothermus            GCTGCTCAGGCTGGCCGGTGTCGAGAACG-ACTACCGGGCATTGCCCGAGTCGCGCCGCC 1375
                                   *             ***          *    *               *

Lhelveticus             GCAGACTTGTTAATGCTGGCAAATCAGAA--GACGAAGTACAAGCTCGCAAGGAAG-AAA 619
L.delbrueckii           GGGCTTTGGTCAACGAAGGCAAGAGTACA--GAAGAAGTAGAGGCGCACAAGGCTG-AAC 971
Lcasei                  GCAAACTGGTTGCTGATAAAGCAAGCGAT--GCTGATATTGAGGCAGCTAAACAGA-AAA 619
Lactococcus_lactis      GTTATACAATTGAGCAAGAC-----------GGTGATGTTCAAGCGGTCAAAGAAG-AAC 1315
Rhodothermus            AGGAGCTGCTGGCCGAGGAGCTGAGCAATCCACGGCCGCTGCTGCCGCCGGGTGCCCGGG 1435
                                 *                        *        **               

Lhelveticus             TGTTAAATGATGTCTTCCGTGTTCTTGCAATTTCAACTTGTGTTCC---ACCAAAGAAAT 676
L.delbrueckii           TTTTGGACGCTATCTTCCGCATGCTGGCCACTTCACTTGGCCTGCC---GCCAAAGAGCT 1028
Lcasei                  TGTTAGCTGAAGATTATCGGATTTTGGCTTACACCTTAGGCAACCC---GCCGACGAAGT 676
Lactococcus_lactis      TTTTACAAGAAGTTTTTAATTTCCTTGCTGTAACTCTAGGTTTGCC---ACCACAAAATT 1372
Rhodothermus            TGTCGGAGGCTACCCGGCAGGTGCTGGAGACCTTCGCGGTCATCCGCGAGCTGGTGCAGC 1495
                        * *     *            *  * *                 *     *         

Lhelveticus             TTAACTTCGAATACCGTGACG-----ATAATCACAACTAC-CACATCGACAAGGACATTA 730
L.delbrueckii           TCAACTTTGAATACACTGACG-----ATGACGGCAACTAC-CACATCGACAAGGACATCA 1082
Lcasei                  TCGACTTCGAATATCGCGATG-----ATGATAAGCAGTAT-CATATTGACCGCGAACTCA 730
Lactococcus_lactis      TTGAATTTGCTTTCCGCAACA-----AAGATAATGAATAC-AAAA---AATTTGTTGGAA 1423
Rhodothermus            TCGACCCCCGCCTCGTGGGCAGCTACATCGTGAGCATGACGCACACCGTCAGCGACCTGC 1555
                        *  *                      *        *  *   * *        *      

Lhelveticus             CGCCTAAGGAATTCTTTGACAAATATGTTGGTATGGATTTAGCCAACCATATTTCAACTA 790
L.delbrueckii           CCCCGCAAGACTTCTTCAAAAAGTACGTTGGCTGGGACCTGGAAAACTACATCTCAGTTA 1142
Lcasei                  CCCCGCAGACCTTCTTCAAGAAGTACGTTGCATGGAACCTTGATGATTACCAAAGTATCA 790
Lactococcus_lactis      CGCCAAAAGAATTCTACAACGAATATGTTGGGATTGATTTGAACAATTATGTTTCGGTCA 1483
Rhodothermus            TCGAGCCCATGCTGCTGGCCAAAGAAGTCGGGCTCTGGCATTACGAGCGCGACCCCCGCA 1615
                                    *        *  * ** *               *             *

Lhelveticus             TCAATGCCCCAACTAGCGACAAGCCTTTCCACAAGGTATTCTCAG----TTGAATACTTA 846
L.delbrueckii           TCAACGGGCCTACTGCTGACAAACCATACAACAAGGTCTTCTCAG----TAGAATACCTG 1198
Lcasei                  TCAATGCGCCAACTGACGACAAGCCATACAACCATTTATACACGG----TTGAAATGCTC 846
Lactococcus_lactis      TTAATGCTCCAACTGCTGATAAACCTTATAACAAAAGCTATACCG----TTGAATTTCTT 1539
Rhodothermus            CCGGCAAGCCGGGCCACG-TGCGCTGCCCCATCGATTTTGTGCCGCTTTTCGAAACGATC 1674
                                **       *     *      *       *   * *    * ***    * 

Lhelveticus             GGTAACGTTGAAGGTGGTCGTCAA--GTTCGTCA-----CTTAAACTTAAAGGTTGATGA 899
L.delbrueckii           GGCAACGTGGTTGGCGGCCGGCAA--GTCCGCCA-----CCTCAACCTGGAACTGTCCAA 1251
Lcasei                  GGCAACGTTGTCGGTGGCCGCGAA--GTTCGGCA-----CTTGAACCTCGATATCGATAC 899
Lactococcus_lactis      GGTAATGTAGTCGGTGGTAAAGAA--GTCAAACA-----CTTGAACGTTGAGATGGACCG 1592
Rhodothermus            GAAGAC-CTGGAGGCGGCCGCCAGCCGCATGGAAGCCATCCTGAGCCATCCCGTCTACCG 1733
                        *   *    *  ** **     *   *      *     * * * *       *      

Lhelveticus             AATGAAGGATTTGATCATCAAGCAATTAAACAACGGCGAAGTTGTATGGTTTG---GTTC 956
L.delbrueckii           GTTCAAGGAACTGATCATCAACCAATTGAAGCAAGGCGAAGTTGTTTGGTTTG---GTTC 1308
Lcasei                  TTTCAAAGCCTTGGCCGTTAAGCAGCTCAAGGCAGGCGAATCAGTTTGGTTCG---GTTC 956
Lactococcus_lactis      TTTCAAAAAATTGGCTATTGCCCAAATGCAAGCGGGCGAAACTGTCTGGTTTG---GTTG 1649
Rhodothermus            GATGCAGGTGGCTGCCCGCGGTGGCTTTCAGGAAATCATGCTGGGCTACTCCGACAGCAC 1793
                          *  *                    *  *      *      *  *  *  *   *   

Lhelveticus             AAACGTTGTTAAGGATTCTGAACGTCGCGCTGGACT--TCTTGCCACCAATCTTTACCGC 1014
L.delbrueckii           AGACGTTTCCAAGGGCGGTGACCGGGAAGCCGGCCT--TTTGGACACTAAGATCTACCAA 1366
Lcasei                  TGATGTTGGTCAGAGTTCTGATCGGCAATTGGGCAT--CATGGATACCAACATCTATAAG 1014
Lactococcus_lactis      TGACGTTGGTCAAGAATCAAACCGTTCAGCAGGACT--TTTGACAATGGATTCTTATGAT 1707
Rhodothermus            GAAAGACGGTGGCTACT-GGATGGCCAACTGGGCGCTGCACCGGGCCCAGGAGCAGCTGG 1852
                          * *               *  *       **                           

Lhelveticus             CGTGATCAATTATTTGACG------------TTGACTTCTCAATGTCTAAGGCTGATAAG 1062
L.delbrueckii           AGAGACCAGCTTTTTGACT------------ACGACTTCTCAATGAGCAAGGCTGACCGC 1414
Lcasei                  AAGGATGATCTTTTCAACA------------CCGACTTCACCATGACCAAGGCGGAACGC 1062
Lactococcus_lactis      TTTAAATCTTCATTGGATA------------TTGAATTCACACAAAGTAAGGCTGGACGT 1755
Rhodothermus            CCGAAGTATGTCTTCGCCATGGCGTGGACTTCCGGCTGTTTCACGGGCGCGGCGGTAC-T 1911
                            *       **                   *  *             *** *     

Lhelveticus             CTTGACTCAGGCGAAAGCATGATGGACCACGCAATGGT--TATTACTGGTGTTGACAT-- 1118
L.delbrueckii           CTGGACTCAGGCGAAAGCATGATGAACCACGCCATGGT--TATCACTGCCGTTGACCT-- 1470
Lcasei                  CTCGATTACGGCGAAAGCCTCATGACCCACGCAATGGT--CCTCACCGGCGTTGACAT-- 1118
Lactococcus_lactis      CTTGACTATGGCGAATCACTGATGACTCATGCCATGGT--TTTAGCGGGTGTTGATTTA- 1812
Rhodothermus            GTGGGACGTGGGGGCGGCCGCGCCAACCAGGCCATCCTGGCCATGCCGCCGGTGGTCCAC 1971
                         * *     ** *              ** ** **  *       * *  * **      

Lhelveticus             --CGTTGATGGCAAACCAACTAAGTGGAAGATTGAAAACTCATGGGGTGAAAAGCCAGGC 1176
L.delbrueckii           --GGTTGACGACAAGCCAACTAAGTGGAAGATCGAAAACTCATGGGGTGACAAGTCAGGC 1528
Lcasei                  --TGTCGACGGCAAGCCAACCAAGTGGAAGGTTGAAAACTCTTGGGGCGACAAGGTCGGT 1176
Lactococcus_lactis      GATGCTGACGGAAATTCAACTAAATGGAAAGTTGAAAATTCTTGGGGTAAAGATGCCGGT 1872
Rhodothermus            AACGGTCGCATTCGCTTCACCGAGCAGGGCGAGGTGATCTCGTTCCGCTATGCCCTGCCC 2031
                           *              **  *   *      *  *  ** *   *  *          

Lhelveticus             TTTAAAGGCTACT-----TCGTAATGAGTGATTCATG----GTTTGACTCATTTGTATAC 1227
L.delbrueckii           TTCAAGGGCTACT-----TCGTCATGAGCGACGAATG----GTTCGACCAATTCGTTTAC 1579
Lcasei                  GACAAAGGCTATT-----TTGTGGCCAGTGATTCTTG----GTTTGACGAGTTCGTTTAC 1227
Lactococcus_lactis      CAAAAAGGATATT-----TCGTTGCTTCTGATGAATG----GATGGATGAATATACTTAT 1923
Rhodothermus            GAGATCGCCCATCGCCACCTGGAGCAGATCGTCAATGCCATGCTCCGCGTGGTCGGCCTC 2091
                           *  *   *         *              **    * *                

Lhelveticus             CAAGCAGTTATTAACA--AAGATATTTTGCCAGAAGATCTTAAGAAGGCTTACGACGAAG 1285
L.delbrueckii           CAGGCTGTTTTGAACA--AGGCCTTCCTGCCAGAAGACGTTAAGAAGGCTTACGACGAAG 1637
Lcasei                  CAAGTTGTCATCTCCA--AAAAGTACCTGTCAGCTGACTTGCAAGACGTCATCAAGAACG 1285
Lactococcus_lactis      CAAATTGTTGTCCGCA--AAGACCTTTTAAGCGAAGAAGAATTAGCTGCTTATGA----- 1976
Rhodothermus            CCGGCCGCTTCCGGCACCGATGGCACCGATCCGGCCACGCGCAACCGTCTGATGG--ACG 2149
                        *     *       **                *   *                       

Lhelveticus             GCAAGGATAATCCTATTCAATTATTGCCATGGGATCCAATGGGTGCTTTAGCAT--TTAA 1343
L.delbrueckii           GCAAGGAAAACCCAATCGAACTTCTGCCATGGGACCCAATGGGCGCTTTGGCTT--TCGA 1695
Lcasei                  AATACGACAAACCAACCGTTCTGGCCCCATGGGATCCAATGGGTGCTTTAGCTT--CCAA 1343
Lactococcus_lactis      ---AGCAAAACCTCAA-GTTCTGCTTCCATGGGATCCAATGGGAGCCTTGGCTTAATTTG 2032
Rhodothermus            AGCTGGCTGCGCGCTCTATGCGGGCCTACCGGCGCCTGATCGATGCGCCTGACT--TCTG 2207
                                   *                  **   *  ** *  **    *  *      

Lhelveticus             GTATTAA----------------------------------------------------- 1350
L.delbrueckii           CTTCTAATAGATTTGAATAGATATGAAAAACGAGTTGCATCGCGCAACTCGTTTTTTGGT 1755
Lcasei                  ATAA-------------------------------------------------------- 1347
Lactococcus_lactis      TAAATTGAAACATTTAACTTTTGTTAAATGTTTTTTTATTGACTTAAAGTTCACTTCAAG 2092
Rhodothermus            GTCGTGGTACACGCGCATCACTCCGATCGACCAGATCAGCCGCCTACCCATCGCCTCGCG 2267
                                                                                    

Lhelveticus             ------------------------------------------------------------
L.delbrueckii           ATGTATGGAAATTTAGTGTTGAACAAAACATTGAATCACGTCTTTGGCATTCAAATGCGT 1815
Lcasei                  ------------------------------------------------------------
Lactococcus_lactis      TGTTAAAATAAAAGAATGAATATAAAAAAGGCCGCCGACTTATCAGGGATAAAAACAGAT 2152
Rhodothermus            GCCGGTCTCGCGCAGCAGCGCCCGTGAGGTAGATTTCGAAAGCCTGCGGGCCATCCCCTG 2327
                                                                                    

Lhelveticus             ------------------------------------------------------------
L.delbrueckii           CAGCAAAATAGCGATGTTTTGATCTGCTTTTGGCAGCCAGTCATTATTGAGGTCCACGTA 1875
Lcasei                  ------------------------------------------------------------
Lactococcus_lactis      AATATCAGATATTATGAAAGAATTGGGCTAATTCCTAAAATTGCACGGACAGAGTCTGGA 2212
Rhodothermus            GGTCTTCGCCTGGACCCAGGTCCGCTACCTGATTCCGGGCTGGTTCGGGATCGGCCAGGC 2387
                                                                                    

Lhelveticus             ------------------------------------------------------------
L.delbrueckii           TTTTTCCGTCCGCGTCCCCCCTTCTTCTGGCATGATCAAGGCATCCACCGTTCTCGCAGC 1935
Lcasei                  ------------------------------------------------------------
Lactococcus_lactis      ATACGAAATTTTTCAGAAGCGAATATTAGAACATTAAAATTCGTCAAACATATGAGAGAT 2272
Rhodothermus            CCTCGACGAGTTGCTCCAGACGTCGCCCGAGCATCTGGAGACGCTTCGCACCTGGTATCG 2447
                                                                                    

Lhelveticus             ------------------------------------------------------------
L.delbrueckii           CCTTTTTCTAAACAAGAAGTGATAAACCAGCTGTTTGTGATTCAAGTCTGTCAGCTTAGT 1995
Lcasei                  ------------------------------------------------------------
Lactococcus_lactis      GCAGGAGTGCAAGTAGAACCCTTGACACGTTATATGGTATTGGTAACTGAAGGAAATCCT 2332
Rhodothermus            ATCCTGGCCGTTTTTCCGCACCGTGCTGCAGAACGCCCAGCGCGAGATGGTCCGCGCCCG 2507
                                                                                    

Lhelveticus             ------------------------------------------------------------
L.delbrueckii           GTAATCACATGAAAAAAGCTTTTCCCCGCAA----------------------------- 2026
Lcasei                  ------------------------------------------------------------
Lactococcus_lactis      AATACTAAAGAATAAAGAATTGAAATTCTGAAGAGTCAAGTTGAACAATTGAGAACAGAA 2392
Rhodothermus            CCTGGAAATTGCCGCCTACTACGACCGGCTACTGGGCGACGGCCCGACGGCATTCCATCA 2567
                                                                                    

Lhelveticus             ------------------------------------------------------------
L.delbrueckii           ------------------------------------------------------------
Lcasei                  ------------------------------------------------------------
Lactococcus_lactis      ATTATTGAAAAACAATCTGCTTTAGATTATTTAACATTCAAAATTGAAAATTATGATGAA 2452
Rhodothermus            GATGATCGAGGAAGACTATCATCGAGCCCGGACGGCCATCCTACGCATCACCGATCAGGA 2627
                                                                                    

Lhelveticus             ------------------------------------------------------------
L.delbrueckii           ------------------------------------------------------------
Lcasei                  ------------------------------------------------------------
Lactococcus_lactis      GTCATGCTTCCAAGCGAAATGAATTTGAATCAAAGTTCAACAGAAACAATAAAAATTTGA 2512
Rhodothermus            GTCGTTGCTCGACCACGATCCGATCATCCGCAAATCCGTGCAGCTCCGCAACCCGTACAC 2687
                                                                                    

Lhelveticus             ------------------------------------------------------------
L.delbrueckii           ------------------------------------------------------------
Lcasei                  ------------------------------------------------------------
Lactococcus_lactis      AGAGGATAAGGATAAATGGAACTTCGATTATTAAAGTATTTTTGGACAGTTGCCACTGCT 2572
Rhodothermus            CGATGTGCTGAACCTGGTGCAGCTCGAGCTGATGCGGCGCATCCGATCAGGCGCCGAGGC 2747
                                                                                    

Lhelveticus             ------------------------------------------------------------
L.delbrueckii           ------------------------------------------------------------
Lcasei                  ------------------------------------------------------------
Lactococcus_lactis      GGGACGGTATCCAAAGCTGCTGACAGTTATATATTACACAGCCAACATTATCTAGACAAA 2632
Rhodothermus            CGATCGGGAGCCGCTCCGGCGCGCTCTGTTCCTGAGCATCAACGGGATCGCCGCCGCCAT 2807
                                                                                    

Lhelveticus             ------------------------------------------------------------
L.delbrueckii           ------------------------------------------------------------
Lcasei                  ------------------------------------------------------------
Lactococcus_lactis      TTAAAGAACTTGAACGAGAATTAGATACTCAGCTTTTTATGCGTTATGGGAAAAAGCTTA 2692
Rhodothermus            GCAGAGCACCGGATAGCACAAAAAAGGGCCGGCTCAGAACCGAACCTGAATTTCCGTGTT 2867
                                                                                    

Lhelveticus             --------------------------------------------------------
L.delbrueckii           --------------------------------------------------------
Lcasei                  --------------------------------------------------------
Lactococcus_lactis      TCTTGACTGAAGATGGTCAATTTCTTAAAATCAAAGCTGAAGAGATTTTACAGCTG 2748
Rhodothermus            GCACCGCGAGGCTATTGGCGGAGCGGCGGCTCCTGCTTTG---------------- 2907
                                                                                
PLEASE NOTE: Showing colors on large alignments is slow.




Guide Tree

(
(
(
Lhelveticus:0.11075,
L.delbrueckii:0.17369)
:0.08492,
Lcasei:0.16559)
:0.04797,
Lactococcus_lactis:0.25484,
Rhodothermus:0.73824);


Cladogram

Right-click on the above tree to see display options.
Problems printing? Read how to print a Phylogram or Cladogram.
spacer
spacer