Job Title: Mus musculus Shc1

BLASTN 2.2.16 (Mar-25-2007)
RID: 65Z8613012


Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
           5,319,389 sequences; 20,775,880,397 total letters

If you have any problems or questions with the results of this search
please refer to the BLAST FAQs Taxonomy reports

Query=  Mus musculus Shc1
Length=3143


Distance tree of resultsNew  
Legend for links to other resources: UniGene GEO Gene Structure Map Viewer Sequences producing significant alignments: (Click headers to sort columns)
Accession Description Max score Total score Query coverage E value Max ident Links
NM_011368.4
Mus musculus src homology 2 domain-containing transforming protein C1 (Shc1), mRNA
58055805100%0.0100% Gene info
BC036172.1
Mus musculus src homology 2 domain-containing transforming protein C1, mRNA (cDNA clone MGC:37600 IMAGE:4988907), complete cds
58055805100%0.0100% GeoGene info
AK049357.1
Mus musculus ES cells cDNA, RIKEN full-length enriched library, clone:C330027D01 product:src homology 2 domain-containing transforming protein C1, full insert sequence
5674567497%0.099% GeoGene info
XM_484699.4
PREDICTED: Mus musculus similar to src homology collagen protein 66 kDa isoform (LOC433158), mRNA
4361436179%0.098% Gene info
XM_909974.2
PREDICTED: Mus musculus similar to src homology collagen protein 66 kDa isoform (LOC433158), mRNA
4361436179%0.098% Gene info
AC123951.3
Mus musculus BAC clone RP23-166M23 from 18, complete sequence
4361441980%0.0100%
XR_002567.1
PREDICTED: Mus musculus similar to src homology 2 domain-containing transforming protein C (LOC669542), mRNA
4338465779%0.098% Gene info
AK155158.1
Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN full-length enriched library, clone:F630204K04 product:src homology 2 domain-containing transforming protein C1, full insert sequence
3814381465%0.099% UniGene infoGene info
AC121079.20
Mus musculus chromosome 3, clone RP24-178P12, complete sequence
3140647297%0.0100% Geo
AC104329.22
Mus musculus strain C57BL/6J clone rp23-418c12 map 3, complete sequence
3140637897%0.0100%
AC171273.1
Mus musculus BAC clone RP23-137J12 from chromosome 3, complete sequence
3140656797%0.0100%
NM_053517.1
Rattus norvegicus src homology 2 domain-containing transforming protein C1 (Shc1), mRNA >gb|BC088298.1| Rattus norvegicus src homology 2 domain-containing transforming protein C1, mRNA (cDNA clone MGC:109497 IMAGE:7323045), complete cds
2754275462%0.092% UniGene infoGene info
U15784.1
Mus musculus Shcp52 (Shc) mRNA, complete cds
2700270046%0.0100% UniGene infoGeoGene info
U46956.2
Mus musculus src homology collagen protein 66 kDa isoform gene, partial cds
2606260644%0.0100% GeoGene info
XR_002563.1
PREDICTED: Mus musculus similar to src homology 2 domain-containing transforming protein C1 (LOC669532), mRNA
2220222041%0.097% UniGene infoGene info
NM_003029.3
Homo sapiens SHC (Src homology 2 domain containing) transforming protein 1 (SHC1), transcript variant 2, mRNA >gb|BC014158.2| Homo sapiens SHC (Src homology 2 domain containing) transforming protein 1, mRNA (cDNA clone MGC:20839 IMAGE:4541216), complete cds
2034203458%0.086% UniGene infoGeoGene info
X68148.1
H.sapiens SHC mRNA
2028202857%0.086% UniGene infoGeoGene info
XM_001112447.1
PREDICTED: Macaca mulatta similar to SHC (Src homology 2 domain containing) transforming protein 1 isoform p66Shc (LOC718982), mRNA
1991199165%0.084% UniGene infoGene info
XM_513843.2
PREDICTED: Pan troglodytes SHC (Src homology 2 domain containing) transforming protein 1 (SHC1), mRNA
1947194755%0.087% Gene info
U73377.1
Human p66shc (SHC) mRNA, complete cds
1936193655%0.086% GeoGene info
BX647136.1
Homo sapiens mRNA; cDNA DKFZp686J19171 (from clone DKFZp686J19171)
1930193055%0.086% UniGene infoGene info
CR859992.1
Pongo pygmaeus mRNA; cDNA DKFZp459K018 (from clone DKFZp459K018)
1925192555%0.086%
AK096169.1
Homo sapiens cDNA FLJ38850 fis, clone MESAN2010031, highly similar to SHC TRANSFORMING PROTEIN
1916191655%0.086% UniGene infoGene info
BX647149.1
Homo sapiens mRNA; cDNA DKFZp686L06171 (from clone DKFZp686L06171)
1916191655%0.086% UniGene infoGene info
BC017283.1
Homo sapiens cDNA clone IMAGE:4890240, containing frame-shift errors
1914191455%0.086% UniGene infoGene info
BC011813.1
Homo sapiens cDNA clone IMAGE:3161064, containing frame-shift errors
1914191455%0.086% UniGene infoGene info
NM_001075305.1
Bos taurus SHC (Src homology 2 domain containing) transforming protein 1 (SHC1), mRNA >gb|BC122688.1| Bos taurus SHC (Src homology 2 domain containing) transforming protein 1, mRNA (cDNA clone MGC:142708 IMAGE:8097781), complete cds
1910191064%0.084% UniGene infoGene info
Y09847.1
H.sapiens shc gene, p66 isoform
1842184247%0.089% Gene info
NM_183001.3
Homo sapiens SHC (Src homology 2 domain containing) transforming protein 1 (SHC1), transcript variant 1, mRNA
1836183644%0.090% UniGene infoGeoGene info
AK225332.1
Homo sapiens mRNA for SHC transforming protein 1 variant, clone: HEP09014
1823182345%0.089% UniGene infoGene info
XR_005512.1
PREDICTED: Rattus norvegicus similar to src homology 2 domain-containing transforming protein C1 (LOC500206), mRNA
1770192442%0.094% UniGene infoGene info
XM_860039.1
PREDICTED: Canis familiaris similar to src homology 2 domain-containing transforming protein C, transcript variant 2 (LOC490439), mRNA
1755175548%0.087% UniGene infoGene info
XM_547561.2
PREDICTED: Canis familiaris similar to src homology 2 domain-containing transforming protein C, transcript variant 1 (LOC490439), mRNA
1650165045%0.087% UniGene infoGene info
AL034408.2
Human DNA sequence from clone RP4-710L4 on chromosome Xq11.2-12, complete sequence
1519151956%0.082% Geo
NG_001195.1
Homo sapiens SHC (Src homology 2 domain containing) transforming protein 1 pseudogene 1 (SHC1P1) on chromosome X >emb|Y09846.1|HSSHCPS H.sapiens shc pseudogene, p66 isoform
1519151955%0.082% Gene info
AC192165.3
Pan troglodytes BAC clone CH251-481L4 from chromosome x, complete sequence
1517151765%0.080%
XR_024057.1
PREDICTED: Pan troglodytes similar to SHC (Src homology 2 domain containing) transforming protein 1 (LOC473641), mRNA
1517151765%0.080% Gene info
AK130014.1
Homo sapiens cDNA FLJ26504 fis, clone KDN07054, highly similar to SHC transforming protein
1434165650%0.091% UniGene infoGene info
BC033925.1
Homo sapiens SHC (Src homology 2 domain containing) transforming protein 1, mRNA (cDNA clone MGC:39145 IMAGE:4896385), complete cds
1423142344%0.085% UniGene infoGene info
AL772404.5
Mouse DNA sequence from clone RP23-374O4 on chromosome 2, complete sequence
1282182629%0.092%
XM_001366442.1
PREDICTED: Monodelphis domestica similar to SHC (Src homology 2 domain containing) transforming protein 1 (LOC100016090), mRNA
1182118243%0.082% Gene info
AB208849.1
Homo sapiens mRNA for SHC (Src homology 2 domain containing) transforming protein 1 isoform p66Shc variant protein
1129143144%0.088% UniGene infoGene info
XM_860082.1
PREDICTED: Canis familiaris similar to src homology 2 domain-containing transforming protein C, transcript variant 4 (LOC490439), mRNA
904131830%0.091% UniGene infoGene info
AF197017.1
Pan troglodytes adaptor protein (Shc) pseudogene, partial sequence
867 86728%0.084%
AF196996.1
Homo sapiens adaptor protein pseudogene, partial sequence
861 86128%0.084%
XR_008689.1
PREDICTED: Rattus norvegicus similar to src homology 2 domain-containing transforming protein C (LOC500206), mRNA
776168037%0.094% UniGene infoGene info
AC003102.1
Homo sapiens chromosome 17, clone hRPC.882_C_2, complete sequence
767 76726%0.083%
AK182226.1
Mus musculus cDNA, clone:Y0G0121E02, strand:plus, reference:ENSEMBL:Mouse-Transcript-ENST:ENSMUST00000039110, based on BLAT search
760 76013%0.098% UniGene infoGene info
AK190954.1
Mus musculus cDNA, clone:Y1G0104F15, strand:plus, reference:ENSEMBL:Mouse-Transcript-ENST:ENSMUST00000039110, based on BLAT search
699 69912%0.097% UniGene info
AK195140.1
Mus musculus cDNA, clone:Y1G0117I05, strand:plus, reference:ENSEMBL:Mouse-Transcript-ENST:ENSMUST00000039110, based on BLAT search
697 69712%0.098% UniGene info
AK194449.1
Mus musculus cDNA, clone:Y1G0115F22, strand:minus, reference:ENSEMBL:Mouse-Transcript-ENST:ENSMUST00000039110, based on BLAT search
695 69512%0.099% UniGene info
AK199216.1
Mus musculus cDNA, clone:Y1G0130I08, strand:plus, reference:ENSEMBL:Mouse-Transcript-ENST:ENSMUST00000039110, based on BLAT search
693 69312%0.098% UniGene infoGene info
D83015.1
Rattus norvegicus shc mRNA for shc transforming protein, partial cds
691 69113%0.096% UniGene infoGeoGene info
XM_860059.1
PREDICTED: Canis familiaris similar to src homology 2 domain-containing transforming protein C, transcript variant 3 (LOC490439), mRNA
689 94722%0.092% UniGene infoGene info
NM_001090464.1
Xenopus laevis src homology collagen (Shc1), mRNA >ref|NM_001090463.1| Xenopus laevis src homology collagen (Shc1), mRNA >gb|AY027793.1| Xenopus laevis src homology collagen mRNA, complete cds
647 92133%0.083% Gene info
BC089178.1
Xenopus laevis src homology collagen, mRNA (cDNA clone MGC:98812 IMAGE:3400241), complete cds
647 92733%0.083% UniGene infoGene info
DQ125497.1
Bos taurus src homology 2 domain-containing transforming protein C1 mRNA, partial cds
632 63213%2e-17792% UniGene infoGene info
AK205229.1
Mus musculus cDNA, clone:Y2G0101B02, strand:plus, reference:ENSEMBL:Mouse-Transcript-ENST:ENSMUST00000039110, based on BLAT search
610 61010%1e-17099% UniGene infoGene info
AF440201.1
Synthetic construct EGF-receptor reporter mRNA, complete cds
507 5078%1e-13999%
AK203451.1
Mus musculus cDNA, clone:Y1G0144O18, strand:minus, reference:ENSEMBL:Mouse-Transcript-ENST:ENSMUST00000039110, based on BLAT search
477 4779%1e-13095% UniGene infoGene info
AK036980.1
Mus musculus adult female vagina cDNA, RIKEN full-length enriched library, clone:9930032M20 product:src homology 2 domain-containing transforming protein C1, full insert sequence
473 78713%1e-129100% GeoGene info
AK195313.1
Mus musculus cDNA, clone:Y1G0118B15, strand:minus, reference:ENSEMBL:Mouse-Transcript-ENST:ENSMUST00000039110, based on BLAT search
446 4467%3e-12199% UniGene infoGene info
AK211173.1
Mus musculus cDNA, clone:Y2G0120O03, strand:minus, reference:ENSEMBL:Mouse-Transcript-ENST:ENSMUST00000039110, based on BLAT search
366 3666%3e-9799% UniGene infoGene info
AC196865.9
Rhesus Macaque BAC CH250-498O8 () complete sequence
363 85234%3e-9696%
AK191292.1
Mus musculus cDNA, clone:Y1G0105G20, strand:minus, reference:ENSEMBL:Mouse-Transcript-ENST:ENSMUST00000039110, based on BLAT search
326 3265%4e-85100% UniGene infoGene info
AF455140.1
Mus musculus Src homology 2 domain-containing transforming protein 1 isoform p66 and Src homology 2 domain-containing transforming protein 1 isoform p52 genes, alternative promoter regions, exons 1 and 2 and partial cds
313 58510%3e-81100% GeoGene info
CR617132.1
full-length cDNA clone CS0DI004YK21 of Placenta Cot 25-normalized of Homo sapiens (human)
303 30314%2e-7879% UniGene info
AL451085.20
Human DNA sequence from clone RP11-307C12 on chromosome 1, complete sequence
302 78524%7e-7896%
BC012812.1
Homo sapiens zinc finger and SCAN domain containing 18, mRNA (cDNA clone IMAGE:2964582), **** WARNING: chimeric clone ****
291 2915%2e-7495% Geo
BC006198.1
Homo sapiens zinc finger and SCAN domain containing 18, mRNA (cDNA clone IMAGE:2964582), **** WARNING: chimeric clone ****
291 2915%2e-7495% Geo
BC002386.1
Homo sapiens zinc finger and SCAN domain containing 18, mRNA (cDNA clone IMAGE:2964582), **** WARNING: chimeric clone ****
291 2915%2e-7495%
AC190310.5
Rhesus Macaque BAC CH250-550M15 () complete sequence
279 48910%3e-7196%
AF455141.1
Homo sapiens Src homology 2 domain-containing transforming protein 1 isoform p66 and Src homology 2 domain-containing transforming protein 1 isoform p52 genes, alternative promoter regions, exons 1 and 2 and partial cds
274 3958%2e-6995% Gene info
AK210297.1
Mus musculus cDNA, clone:Y2G0117O21, strand:minus, reference:ENSEMBL:Mouse-Transcript-ENST:ENSMUST00000039110, based on BLAT search
252 2524%7e-63100% UniGene info
EF026651.1
Mus musculus cyclin-dependent kinase subunit 1 (Cks1) gene, promoter region and partial cds
180 1803%4e-41100%
AK198488.1
Mus musculus cDNA, clone:Y1G0128F05, strand:plus, reference:ENSEMBL:Mouse-Transcript-ENST:ENSMUST00000039110, based on BLAT search
165 1652%1e-3698%
AC167135.3
Mus musculus chromosome 1, clone RP24-335L18, complete sequence
14818434%1e-3191%
AC160101.7
Mus musculus chromosome 1, clone RP24-126E20, complete sequence
14818434%1e-3191%
AL731811.24
Mouse DNA sequence from clone RP23-60A1 on chromosome X, complete sequence
148 3434%1e-3186%
AC167036.6
Mus musculus chromosome 1, clone RP23-76P9, complete sequence
14812614%1e-3191%
AL591711.22
Mouse DNA sequence from clone RP23-19L12 on chromosome 2, complete sequence
147 9654%4e-3188%
AC109139.15
Mus musculus chromosome 8, clone RP23-47L13, complete sequence
143 5934%5e-3086%
AC126938.2
Mus musculus BAC clone RP23-50I16 from chromosome 5, complete sequence
143 8324%5e-3089%
AC098705.2
Mus musculus BAC clone RP23-1B19 from 3, complete sequence
143 2714%5e-30100%
AC113049.22
Mus musculus chromosome 8, clone RP23-248P8, complete sequence
143 4964%5e-3086%
AL731731.14
Mouse DNA sequence from clone RP23-331L13 on chromosome X, complete sequence
143 1434%5e-3085%
AL732560.11
Mouse DNA sequence from clone RP24-209P15 on chromosome 2, complete sequence
143 6654%5e-3086%
AC154842.2
Mus musculus BAC clone RP23-55C11 from chromosome 17, complete sequence
141 2384%2e-2985%
AC154851.3
Mus musculus BAC clone RP23-28P10 from chromosome 13, complete sequence
141 7484%2e-2986%
AC147992.3
Mus musculus BAC clone RP24-384K8 from chromosome 18, complete sequence
139 4534%6e-2984%
AC124432.5
Mus musculus BAC clone RP24-243L15 from chromosome 18, complete sequence
139 4534%6e-2984%
AC026385.19
Mus musculus 17 BAC RP23-413K14 complete sequence
139 7664%6e-2985%
CT025760.12
Mouse DNA sequence from clone RP23-351E9 on chromosome 17, complete sequence
139 4524%6e-2985%
AC124027.2
Mus musculus chromosome X clone RP21-282L18 map qA7.2, complete sequence
137 5264%2e-2890%
AC124026.2
Mus musculus chromosome X clone RP21-564N13 map qA7.2, complete sequence
137 6384%2e-2890%
AC124020.2
Mus musculus chromosome X clone RP21-564N13 map qA7.2, complete sequence
137 5444%2e-2890%
AC117693.9
Mus musculus chromosome 1, clone RP23-448D22, complete sequence
137 1374%2e-2885%
AC117663.13
Mus musculus chromosome 5, clone RP23-354E8, complete sequence
137 9744%2e-2887%
AC115880.11
Mus musculus chromosome 9, clone RP24-365N15, complete sequence
137 7804%2e-2890%
AC159973.2
Mus musculus chromosome 1, clone RP24-207D15, complete sequence
137 2424%2e-2885%
Alignments
>ref|NM_011368.4| Gene info Mus musculus src homology 2 domain-containing transforming protein C1 (Shc1), mRNA Length=3143 Score = 5805 bits (3143), Expect = 0.0 Identities = 3143/3143 (100%), Gaps = 0/3143 (0%) Strand=Plus/Plus Query 1 GGACGCGTGGGTCCTGGGGTGAAAGTTGGGGCGGTGACTTAAGCAGACAGTTGCGTGATC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1 GGACGCGTGGGTCCTGGGGTGAAAGTTGGGGCGGTGACTTAAGCAGACAGTTGCGTGATC 60 Query 61 CGGAACCAGATCGGCCCGCGGTGCGGTGCGGAGACTCCATGAGACCCTGGACATGAACAA 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 61 CGGAACCAGATCGGCCCGCGGTGCGGTGCGGAGACTCCATGAGACCCTGGACATGAACAA 120 Query 121 GCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCTGGGGGGCGAGGA 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 121 GCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCTGGGGGGCGAGGA 180 Query 181 GTGGACCAGACACGGGAGCTTTGTCAATAAGCCCACACGAGGCTGGCTGCATCCCAACGA 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 181 GTGGACCAGACACGGGAGCTTTGTCAATAAGCCCACACGAGGCTGGCTGCATCCCAACGA 240 Query 241 CAAAGTCATGGGACCTGGGGTTTCCTACTTGGTTCGGTACATGGGCTGTGTGGAGGTCTT 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 241 CAAAGTCATGGGACCTGGGGTTTCCTACTTGGTTCGGTACATGGGCTGTGTGGAGGTCTT 300 Query 301 ACAGTCAATGCGAGCCCTTGACTTCAATACCCGGACTCAGGTCACCAGGGAGGCCATCAG 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 301 ACAGTCAATGCGAGCCCTTGACTTCAATACCCGGACTCAGGTCACCAGGGAGGCCATCAG 360 Query 361 TTTGGTGTGTGAAGCTGTGCCTGGTGCCAAAGGGGCGACAAGGAGGAGAAAGCCTTGTAG 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 361 TTTGGTGTGTGAAGCTGTGCCTGGTGCCAAAGGGGCGACAAGGAGGAGAAAGCCTTGTAG 420 Query 421 CCGCCCACTCAGCTCCATCCTGGGGAGGAGTAACCTGAAGTTTGCTGGAATGCCAATCAC 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 421 CCGCCCACTCAGCTCCATCCTGGGGAGGAGTAACCTGAAGTTTGCTGGAATGCCAATCAC 480 Query 481 TCTCACTGTGTCTACCAGCAGCCTTAACCTCATGGCAGCCGACTGCAAACAGATCATTGC 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 481 TCTCACTGTGTCTACCAGCAGCCTTAACCTCATGGCAGCCGACTGCAAACAGATCATTGC 540 Query 541 CAACCATCACATGCAATCTATCTCTTTCGCGTCCGGTGGGGATCCGGACACAGCTGAGTA 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 541 CAACCATCACATGCAATCTATCTCTTTCGCGTCCGGTGGGGATCCGGACACAGCTGAGTA 600 Query 601 TGTTGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCATATCCTGGAGTGTCC 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 601 TGTTGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCATATCCTGGAGTGTCC 660 Query 661 TGAAGGGCTTGCTCAGGATGTCATCAGCACCATCGGGCAGGCCTTTGAGTTGCGCTTCAA 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 661 TGAAGGGCTTGCTCAGGATGTCATCAGCACCATCGGGCAGGCCTTTGAGTTGCGCTTCAA 720 Query 721 ACAGTATCTCAGGAATCCACCGAAGCTGGTCACCCCCCATGACAGGATGGCTGGCTTTGA 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 721 ACAGTATCTCAGGAATCCACCGAAGCTGGTCACCCCCCATGACAGGATGGCTGGCTTTGA 780 Query 781 TGGCTCAGCTTGGGATGAGGAGGAAGAAGAGCCCCCTGACCATCAGTACTACAATGACTT 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 781 TGGCTCAGCTTGGGATGAGGAGGAAGAAGAGCCCCCTGACCATCAGTACTACAATGACTT 840 Query 841 TCCAGGGAAGGAACCCCCTCTTGGTGGGGTGGTAGATATGAGGCTTCGGGAAGGGGCTGC 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 841 TCCAGGGAAGGAACCCCCTCTTGGTGGGGTGGTAGATATGAGGCTTCGGGAAGGGGCTGC 900 Query 901 TCGACCCACTCTGCCTAGTGCCCAGATGTCCAGCCACTTGGGAGCTACACTGCCTATAGG 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 901 TCGACCCACTCTGCCTAGTGCCCAGATGTCCAGCCACTTGGGAGCTACACTGCCTATAGG 960 Query 961 GCAGCATGCTGCAGGAGACCATGAAGTCCGTAAACAGATGTTGCCTCCGCCGCCTTGCCC 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 961 GCAGCATGCTGCAGGAGACCATGAAGTCCGTAAACAGATGTTGCCTCCGCCGCCTTGCCC 1020 Query 1021 AGGCAGAGAACTCTTCGATGACCCCTCCTATGTCAACATCCAGAATCTAGACAAGGCCCG 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1021 AGGCAGAGAACTCTTCGATGACCCCTCCTATGTCAACATCCAGAATCTAGACAAGGCCCG 1080 Query 1081 GCAGGCTGGGGGTGGGGCTGGGCCCCCAAATCCTTCTCTTAATGGCAGTGCACCCCGAGA 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1081 GCAGGCTGGGGGTGGGGCTGGGCCCCCAAATCCTTCTCTTAATGGCAGTGCACCCCGAGA 1140 Query 1141 CCTTTTTGACATGAAGCCCTTTGAAGATGCACTTCGGGTGCCACCCCCACCGCAGTCCAT 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1141 CCTTTTTGACATGAAGCCCTTTGAAGATGCACTTCGGGTGCCACCCCCACCGCAGTCCAT 1200 Query 1201 GTCCATGGCTGAGCAGCTGCAAGGGGAGCCCTGGTTCCACGGGAAGCTGAGCCGGAGGGA 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1201 GTCCATGGCTGAGCAGCTGCAAGGGGAGCCCTGGTTCCACGGGAAGCTGAGCCGGAGGGA 1260 Query 1261 GGCCGAGGCGCTGCTGCAGCTCAATGGTGACTTCTTGGTGCGAGAGAGCACGACCACGCC 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1261 GGCCGAGGCGCTGCTGCAGCTCAATGGTGACTTCTTGGTGCGAGAGAGCACGACCACGCC 1320 Query 1321 TGGCCAGTATGTGCTCACTGGCCTGCAGAGTGGGCAGCCCAAGCACTTGCTGCTGGTGGA 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1321 TGGCCAGTATGTGCTCACTGGCCTGCAGAGTGGGCAGCCCAAGCACTTGCTGCTGGTGGA 1380 Query 1381 CCCTGAAGGTGTGGTTCGGACAAAGGATCACCGCTTTGAGAGTGTCAGTCACCTGATCAG 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1381 CCCTGAAGGTGTGGTTCGGACAAAGGATCACCGCTTTGAGAGTGTCAGTCACCTGATCAG 1440 Query 1441 CTACCACATGGACAATCACTTGCCCATCATCTCTGCGGGCAGCGAACTGTGCCTACAGCA 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1441 CTACCACATGGACAATCACTTGCCCATCATCTCTGCGGGCAGCGAACTGTGCCTACAGCA 1500 Query 1501 ACCCGTGGATCGGAAAGTGTGATCCTTCTCAGCTTCTCCAACAGGATGCTCTCCATTTCC 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1501 ACCCGTGGATCGGAAAGTGTGATCCTTCTCAGCTTCTCCAACAGGATGCTCTCCATTTCC 1560 Query 1561 GTCTCCCGTATTCTCTAACTTGTGGGACCTCTGTTTTGTGGGTCTGGCCTTGGGTGGGAA 1620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1561 GTCTCCCGTATTCTCTAACTTGTGGGACCTCTGTTTTGTGGGTCTGGCCTTGGGTGGGAA 1620 Query 1621 CTGGGAGCAACGAGGACATGGGTTTAGTGCCCACTTGAGAGAGAGAAAAAGAGGGTTTCA 1680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1621 CTGGGAGCAACGAGGACATGGGTTTAGTGCCCACTTGAGAGAGAGAAAAAGAGGGTTTCA 1680 Query 1681 GTAAGGAGCCTGGGGTAGCATCCTGCCTCTGGCCAAACTTCACCAAAGTATTAATGTGCA 1740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1681 GTAAGGAGCCTGGGGTAGCATCCTGCCTCTGGCCAAACTTCACCAAAGTATTAATGTGCA 1740 Query 1741 GAGTGGTCCCTTGTCTGGGCCTTGCCTGTGCCAACCTGATGCCCTTcccccccAAAGGGT 1800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1741 GAGTGGTCCCTTGTCTGGGCCTTGCCTGTGCCAACCTGATGCCCTTCCCCCCCAAAGGGT 1800 Query 1801 GGGTTCTTATAATGGAAAATGCCCTGTGATGATAGGCCCAGTGGAGCAACTGCCCTTTGG 1860 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1801 GGGTTCTTATAATGGAAAATGCCCTGTGATGATAGGCCCAGTGGAGCAACTGCCCTTTGG 1860 Query 1861 GGGAAGGGAAATAATTATACCTCTGGTTTACTCCTGGGTCTTCAGGGTACCCCAGATCCC 1920 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1861 GGGAAGGGAAATAATTATACCTCTGGTTTACTCCTGGGTCTTCAGGGTACCCCAGATCCC 1920 Query 1921 GCATAACATATCCCACTCCCTCTGCTTCCCCTTAAACTTTGTGCCTTTGACTATCATAGG 1980 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1921 GCATAACATATCCCACTCCCTCTGCTTCCCCTTAAACTTTGTGCCTTTGACTATCATAGG 1980 Query 1981 TCTGCAGATACTTAATGCAGAGTTCTCAGGCCCTTCACGTGTGGACAGGGGTTACTGCCA 2040 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1981 TCTGCAGATACTTAATGCAGAGTTCTCAGGCCCTTCACGTGTGGACAGGGGTTACTGCCA 2040 Query 2041 CCTTGGCTTCTGGAGCCCTGTCCTATTCAGCACCCCTTCCTGTGTCTAGGGAGAATAGGG 2100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2041 CCTTGGCTTCTGGAGCCCTGTCCTATTCAGCACCCCTTCCTGTGTCTAGGGAGAATAGGG 2100 Query 2101 ACAGGAGTGGCCGCTATCTGCTCTGCCTTTCGGATGTGCAGCCCTTAAGAGATTGCCCCA 2160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2101 ACAGGAGTGGCCGCTATCTGCTCTGCCTTTCGGATGTGCAGCCCTTAAGAGATTGCCCCA 2160 Query 2161 AGCCTGAATATGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA 2220 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2161 AGCCTGAATATGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA 2220 Query 2221 ATTGTGAGGCCATCCGATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAG 2280 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2221 ATTGTGAGGCCATCCGATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAG 2280 Query 2281 AGAACCTGTCTCCAAAAACCAAAAAGAGCGATTACCCCAGAGCCTTCTTCCTGATGGTAG 2340 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2281 AGAACCTGTCTCCAAAAACCAAAAAGAGCGATTACCCCAGAGCCTTCTTCCTGATGGTAG 2340 Query 2341 CGGGGAGGGGCAGGACTGGACCCATCTTGCTCAGTGCCTCCTGACCTCAATGCCTTTCCT 2400 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2341 CGGGGAGGGGCAGGACTGGACCCATCTTGCTCAGTGCCTCCTGACCTCAATGCCTTTCCT 2400 Query 2401 CCAAGGGGTCTGTATACATTTCTCAAGCCTGCTCCTCCCATGTTTGCATGTGTGTTATAG 2460 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2401 CCAAGGGGTCTGTATACATTTCTCAAGCCTGCTCCTCCCATGTTTGCATGTGTGTTATAG 2460 Query 2461 TCTACAGCCAAAGTATAGCCCTCACTGTAACCCCATCCTGCCTCCCTCCTTTGGGATAGG 2520 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2461 TCTACAGCCAAAGTATAGCCCTCACTGTAACCCCATCCTGCCTCCCTCCTTTGGGATAGG 2520 Query 2521 TGTGTGCGTCTGACTTGGGCCTCCAGGGTGTGTACAGTCAGTGTGGGTTTTGTGGAGGCA 2580 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2521 TGTGTGCGTCTGACTTGGGCCTCCAGGGTGTGTACAGTCAGTGTGGGTTTTGTGGAGGCA 2580 Query 2581 ATAAGACTGAAGCAGTAGACAATCCCCAATACCATTTGCAGGTCTGGAACTGCACTCTCT 2640 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2581 ATAAGACTGAAGCAGTAGACAATCCCCAATACCATTTGCAGGTCTGGAACTGCACTCTCT 2640 Query 2641 TTTTTAAAAAACATGTATACATTTTAGGGCTGTAGATTTATTTTCCTGGTTTTGTTTTTC 2700 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2641 TTTTTAAAAAACATGTATACATTTTAGGGCTGTAGATTTATTTTCCTGGTTTTGTTTTTC 2700 Query 2701 ATTGCTGACTTTTGAGCACAGAATTATGATAATCAATTACATTTATACATCACCTCGATG 2760 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2701 ATTGCTGACTTTTGAGCACAGAATTATGATAATCAATTACATTTATACATCACCTCGATG 2760 Query 2761 ACTTTTCCAAACTTTTAtttttttttttAAACAACTGTTGGGATTTTACTCCCTGGCCTT 2820 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2761 ACTTTTCCAAACTTTTATTTTTTTTTTTAAACAACTGTTGGGATTTTACTCCCTGGCCTT 2820 Query 2821 AACTAGGACAGGATTGTACCCCACTCCTccccccccccTTTTTCTTTTTCGCCAAGACAA 2880 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2821 AACTAGGACAGGATTGTACCCCACTCCTCCCCCCCCCCTTTTTCTTTTTCGCCAAGACAA 2880 Query 2881 CTGAGCAGAAATTTGGCTGAGCAGTGTTGTGGGACTATGATGTGATAGTTTTAGATCCTA 2940 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2881 CTGAGCAGAAATTTGGCTGAGCAGTGTTGTGGGACTATGATGTGATAGTTTTAGATCCTA 2940 Query 2941 CCTTCTGCTTTCGGGCAGCTGCAGCCAGCACAGAAACCTTGCAAGCTCACTCTGTGTGTA 3000 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2941 CCTTCTGCTTTCGGGCAGCTGCAGCCAGCACAGAAACCTTGCAAGCTCACTCTGTGTGTA 3000 Query 3001 GGCTTTCTGGACAAGGAATGGTCGCCAAATTTTTGGTTTGGATGTCTTATACCAAAGGGA 3060 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3001 GGCTTTCTGGACAAGGAATGGTCGCCAAATTTTTGGTTTGGATGTCTTATACCAAAGGGA 3060 Query 3061 AATAGTCTTCATTAAAGTTCGTATTTCTTTTaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 3120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3061 AATAGTCTTCATTAAAGTTCGTATTTCTTTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 3120 Query 3121 aaaaaaaaaaaaaaaaaaaaaaa 3143 ||||||||||||||||||||||| Sbjct 3121 AAAAAAAAAAAAAAAAAAAAAAA 3143 >gb|BC036172.1| GeoGene info Mus musculus src homology 2 domain-containing transforming protein C1, mRNA (cDNA clone MGC:37600 IMAGE:4988907), complete cds Length=3144 Score = 5805 bits (3143), Expect = 0.0 Identities = 3143/3143 (100%), Gaps = 0/3143 (0%) Strand=Plus/Plus Query 1 GGACGCGTGGGTCCTGGGGTGAAAGTTGGGGCGGTGACTTAAGCAGACAGTTGCGTGATC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2 GGACGCGTGGGTCCTGGGGTGAAAGTTGGGGCGGTGACTTAAGCAGACAGTTGCGTGATC 61 Query 61 CGGAACCAGATCGGCCCGCGGTGCGGTGCGGAGACTCCATGAGACCCTGGACATGAACAA 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 62 CGGAACCAGATCGGCCCGCGGTGCGGTGCGGAGACTCCATGAGACCCTGGACATGAACAA 121 Query 121 GCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCTGGGGGGCGAGGA 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 122 GCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCTGGGGGGCGAGGA 181 Query 181 GTGGACCAGACACGGGAGCTTTGTCAATAAGCCCACACGAGGCTGGCTGCATCCCAACGA 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 182 GTGGACCAGACACGGGAGCTTTGTCAATAAGCCCACACGAGGCTGGCTGCATCCCAACGA 241 Query 241 CAAAGTCATGGGACCTGGGGTTTCCTACTTGGTTCGGTACATGGGCTGTGTGGAGGTCTT 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 242 CAAAGTCATGGGACCTGGGGTTTCCTACTTGGTTCGGTACATGGGCTGTGTGGAGGTCTT 301 Query 301 ACAGTCAATGCGAGCCCTTGACTTCAATACCCGGACTCAGGTCACCAGGGAGGCCATCAG 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 302 ACAGTCAATGCGAGCCCTTGACTTCAATACCCGGACTCAGGTCACCAGGGAGGCCATCAG 361 Query 361 TTTGGTGTGTGAAGCTGTGCCTGGTGCCAAAGGGGCGACAAGGAGGAGAAAGCCTTGTAG 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 362 TTTGGTGTGTGAAGCTGTGCCTGGTGCCAAAGGGGCGACAAGGAGGAGAAAGCCTTGTAG 421 Query 421 CCGCCCACTCAGCTCCATCCTGGGGAGGAGTAACCTGAAGTTTGCTGGAATGCCAATCAC 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 422 CCGCCCACTCAGCTCCATCCTGGGGAGGAGTAACCTGAAGTTTGCTGGAATGCCAATCAC 481 Query 481 TCTCACTGTGTCTACCAGCAGCCTTAACCTCATGGCAGCCGACTGCAAACAGATCATTGC 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 482 TCTCACTGTGTCTACCAGCAGCCTTAACCTCATGGCAGCCGACTGCAAACAGATCATTGC 541 Query 541 CAACCATCACATGCAATCTATCTCTTTCGCGTCCGGTGGGGATCCGGACACAGCTGAGTA 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 542 CAACCATCACATGCAATCTATCTCTTTCGCGTCCGGTGGGGATCCGGACACAGCTGAGTA 601 Query 601 TGTTGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCATATCCTGGAGTGTCC 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 602 TGTTGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCATATCCTGGAGTGTCC 661 Query 661 TGAAGGGCTTGCTCAGGATGTCATCAGCACCATCGGGCAGGCCTTTGAGTTGCGCTTCAA 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 662 TGAAGGGCTTGCTCAGGATGTCATCAGCACCATCGGGCAGGCCTTTGAGTTGCGCTTCAA 721 Query 721 ACAGTATCTCAGGAATCCACCGAAGCTGGTCACCCCCCATGACAGGATGGCTGGCTTTGA 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 722 ACAGTATCTCAGGAATCCACCGAAGCTGGTCACCCCCCATGACAGGATGGCTGGCTTTGA 781 Query 781 TGGCTCAGCTTGGGATGAGGAGGAAGAAGAGCCCCCTGACCATCAGTACTACAATGACTT 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 782 TGGCTCAGCTTGGGATGAGGAGGAAGAAGAGCCCCCTGACCATCAGTACTACAATGACTT 841 Query 841 TCCAGGGAAGGAACCCCCTCTTGGTGGGGTGGTAGATATGAGGCTTCGGGAAGGGGCTGC 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 842 TCCAGGGAAGGAACCCCCTCTTGGTGGGGTGGTAGATATGAGGCTTCGGGAAGGGGCTGC 901 Query 901 TCGACCCACTCTGCCTAGTGCCCAGATGTCCAGCCACTTGGGAGCTACACTGCCTATAGG 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 902 TCGACCCACTCTGCCTAGTGCCCAGATGTCCAGCCACTTGGGAGCTACACTGCCTATAGG 961 Query 961 GCAGCATGCTGCAGGAGACCATGAAGTCCGTAAACAGATGTTGCCTCCGCCGCCTTGCCC 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 962 GCAGCATGCTGCAGGAGACCATGAAGTCCGTAAACAGATGTTGCCTCCGCCGCCTTGCCC 1021 Query 1021 AGGCAGAGAACTCTTCGATGACCCCTCCTATGTCAACATCCAGAATCTAGACAAGGCCCG 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1022 AGGCAGAGAACTCTTCGATGACCCCTCCTATGTCAACATCCAGAATCTAGACAAGGCCCG 1081 Query 1081 GCAGGCTGGGGGTGGGGCTGGGCCCCCAAATCCTTCTCTTAATGGCAGTGCACCCCGAGA 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1082 GCAGGCTGGGGGTGGGGCTGGGCCCCCAAATCCTTCTCTTAATGGCAGTGCACCCCGAGA 1141 Query 1141 CCTTTTTGACATGAAGCCCTTTGAAGATGCACTTCGGGTGCCACCCCCACCGCAGTCCAT 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1142 CCTTTTTGACATGAAGCCCTTTGAAGATGCACTTCGGGTGCCACCCCCACCGCAGTCCAT 1201 Query 1201 GTCCATGGCTGAGCAGCTGCAAGGGGAGCCCTGGTTCCACGGGAAGCTGAGCCGGAGGGA 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1202 GTCCATGGCTGAGCAGCTGCAAGGGGAGCCCTGGTTCCACGGGAAGCTGAGCCGGAGGGA 1261 Query 1261 GGCCGAGGCGCTGCTGCAGCTCAATGGTGACTTCTTGGTGCGAGAGAGCACGACCACGCC 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1262 GGCCGAGGCGCTGCTGCAGCTCAATGGTGACTTCTTGGTGCGAGAGAGCACGACCACGCC 1321 Query 1321 TGGCCAGTATGTGCTCACTGGCCTGCAGAGTGGGCAGCCCAAGCACTTGCTGCTGGTGGA 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1322 TGGCCAGTATGTGCTCACTGGCCTGCAGAGTGGGCAGCCCAAGCACTTGCTGCTGGTGGA 1381 Query 1381 CCCTGAAGGTGTGGTTCGGACAAAGGATCACCGCTTTGAGAGTGTCAGTCACCTGATCAG 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1382 CCCTGAAGGTGTGGTTCGGACAAAGGATCACCGCTTTGAGAGTGTCAGTCACCTGATCAG 1441 Query 1441 CTACCACATGGACAATCACTTGCCCATCATCTCTGCGGGCAGCGAACTGTGCCTACAGCA 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1442 CTACCACATGGACAATCACTTGCCCATCATCTCTGCGGGCAGCGAACTGTGCCTACAGCA 1501 Query 1501 ACCCGTGGATCGGAAAGTGTGATCCTTCTCAGCTTCTCCAACAGGATGCTCTCCATTTCC 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1502 ACCCGTGGATCGGAAAGTGTGATCCTTCTCAGCTTCTCCAACAGGATGCTCTCCATTTCC 1561 Query 1561 GTCTCCCGTATTCTCTAACTTGTGGGACCTCTGTTTTGTGGGTCTGGCCTTGGGTGGGAA 1620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1562 GTCTCCCGTATTCTCTAACTTGTGGGACCTCTGTTTTGTGGGTCTGGCCTTGGGTGGGAA 1621 Query 1621 CTGGGAGCAACGAGGACATGGGTTTAGTGCCCACTTGAGAGAGAGAAAAAGAGGGTTTCA 1680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1622 CTGGGAGCAACGAGGACATGGGTTTAGTGCCCACTTGAGAGAGAGAAAAAGAGGGTTTCA 1681 Query 1681 GTAAGGAGCCTGGGGTAGCATCCTGCCTCTGGCCAAACTTCACCAAAGTATTAATGTGCA 1740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1682 GTAAGGAGCCTGGGGTAGCATCCTGCCTCTGGCCAAACTTCACCAAAGTATTAATGTGCA 1741 Query 1741 GAGTGGTCCCTTGTCTGGGCCTTGCCTGTGCCAACCTGATGCCCTTcccccccAAAGGGT 1800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1742 GAGTGGTCCCTTGTCTGGGCCTTGCCTGTGCCAACCTGATGCCCTTCCCCCCCAAAGGGT 1801 Query 1801 GGGTTCTTATAATGGAAAATGCCCTGTGATGATAGGCCCAGTGGAGCAACTGCCCTTTGG 1860 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1802 GGGTTCTTATAATGGAAAATGCCCTGTGATGATAGGCCCAGTGGAGCAACTGCCCTTTGG 1861 Query 1861 GGGAAGGGAAATAATTATACCTCTGGTTTACTCCTGGGTCTTCAGGGTACCCCAGATCCC 1920 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1862 GGGAAGGGAAATAATTATACCTCTGGTTTACTCCTGGGTCTTCAGGGTACCCCAGATCCC 1921 Query 1921 GCATAACATATCCCACTCCCTCTGCTTCCCCTTAAACTTTGTGCCTTTGACTATCATAGG 1980 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1922 GCATAACATATCCCACTCCCTCTGCTTCCCCTTAAACTTTGTGCCTTTGACTATCATAGG 1981 Query 1981 TCTGCAGATACTTAATGCAGAGTTCTCAGGCCCTTCACGTGTGGACAGGGGTTACTGCCA 2040 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1982 TCTGCAGATACTTAATGCAGAGTTCTCAGGCCCTTCACGTGTGGACAGGGGTTACTGCCA 2041 Query 2041 CCTTGGCTTCTGGAGCCCTGTCCTATTCAGCACCCCTTCCTGTGTCTAGGGAGAATAGGG 2100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2042 CCTTGGCTTCTGGAGCCCTGTCCTATTCAGCACCCCTTCCTGTGTCTAGGGAGAATAGGG 2101 Query 2101 ACAGGAGTGGCCGCTATCTGCTCTGCCTTTCGGATGTGCAGCCCTTAAGAGATTGCCCCA 2160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2102 ACAGGAGTGGCCGCTATCTGCTCTGCCTTTCGGATGTGCAGCCCTTAAGAGATTGCCCCA 2161 Query 2161 AGCCTGAATATGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA 2220 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2162 AGCCTGAATATGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA 2221 Query 2221 ATTGTGAGGCCATCCGATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAG 2280 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2222 ATTGTGAGGCCATCCGATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAG 2281 Query 2281 AGAACCTGTCTCCAAAAACCAAAAAGAGCGATTACCCCAGAGCCTTCTTCCTGATGGTAG 2340 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2282 AGAACCTGTCTCCAAAAACCAAAAAGAGCGATTACCCCAGAGCCTTCTTCCTGATGGTAG 2341 Query 2341 CGGGGAGGGGCAGGACTGGACCCATCTTGCTCAGTGCCTCCTGACCTCAATGCCTTTCCT 2400 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2342 CGGGGAGGGGCAGGACTGGACCCATCTTGCTCAGTGCCTCCTGACCTCAATGCCTTTCCT 2401 Query 2401 CCAAGGGGTCTGTATACATTTCTCAAGCCTGCTCCTCCCATGTTTGCATGTGTGTTATAG 2460 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2402 CCAAGGGGTCTGTATACATTTCTCAAGCCTGCTCCTCCCATGTTTGCATGTGTGTTATAG 2461 Query 2461 TCTACAGCCAAAGTATAGCCCTCACTGTAACCCCATCCTGCCTCCCTCCTTTGGGATAGG 2520 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2462 TCTACAGCCAAAGTATAGCCCTCACTGTAACCCCATCCTGCCTCCCTCCTTTGGGATAGG 2521 Query 2521 TGTGTGCGTCTGACTTGGGCCTCCAGGGTGTGTACAGTCAGTGTGGGTTTTGTGGAGGCA 2580 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2522 TGTGTGCGTCTGACTTGGGCCTCCAGGGTGTGTACAGTCAGTGTGGGTTTTGTGGAGGCA 2581 Query 2581 ATAAGACTGAAGCAGTAGACAATCCCCAATACCATTTGCAGGTCTGGAACTGCACTCTCT 2640 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2582 ATAAGACTGAAGCAGTAGACAATCCCCAATACCATTTGCAGGTCTGGAACTGCACTCTCT 2641 Query 2641 TTTTTAAAAAACATGTATACATTTTAGGGCTGTAGATTTATTTTCCTGGTTTTGTTTTTC 2700 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2642 TTTTTAAAAAACATGTATACATTTTAGGGCTGTAGATTTATTTTCCTGGTTTTGTTTTTC 2701 Query 2701 ATTGCTGACTTTTGAGCACAGAATTATGATAATCAATTACATTTATACATCACCTCGATG 2760 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2702 ATTGCTGACTTTTGAGCACAGAATTATGATAATCAATTACATTTATACATCACCTCGATG 2761 Query 2761 ACTTTTCCAAACTTTTAtttttttttttAAACAACTGTTGGGATTTTACTCCCTGGCCTT 2820 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2762 ACTTTTCCAAACTTTTATTTTTTTTTTTAAACAACTGTTGGGATTTTACTCCCTGGCCTT 2821 Query 2821 AACTAGGACAGGATTGTACCCCACTCCTccccccccccTTTTTCTTTTTCGCCAAGACAA 2880 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2822 AACTAGGACAGGATTGTACCCCACTCCTCCCCCCCCCCTTTTTCTTTTTCGCCAAGACAA 2881 Query 2881 CTGAGCAGAAATTTGGCTGAGCAGTGTTGTGGGACTATGATGTGATAGTTTTAGATCCTA 2940 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2882 CTGAGCAGAAATTTGGCTGAGCAGTGTTGTGGGACTATGATGTGATAGTTTTAGATCCTA 2941 Query 2941 CCTTCTGCTTTCGGGCAGCTGCAGCCAGCACAGAAACCTTGCAAGCTCACTCTGTGTGTA 3000 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2942 CCTTCTGCTTTCGGGCAGCTGCAGCCAGCACAGAAACCTTGCAAGCTCACTCTGTGTGTA 3001 Query 3001 GGCTTTCTGGACAAGGAATGGTCGCCAAATTTTTGGTTTGGATGTCTTATACCAAAGGGA 3060 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3002 GGCTTTCTGGACAAGGAATGGTCGCCAAATTTTTGGTTTGGATGTCTTATACCAAAGGGA 3061 Query 3061 AATAGTCTTCATTAAAGTTCGTATTTCTTTTaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 3120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3062 AATAGTCTTCATTAAAGTTCGTATTTCTTTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 3121 Query 3121 aaaaaaaaaaaaaaaaaaaaaaa 3143 ||||||||||||||||||||||| Sbjct 3122 AAAAAAAAAAAAAAAAAAAAAAA 3144 >dbj|AK049357.1| GeoGene info Mus musculus ES cells cDNA, RIKEN full-length enriched library, clone:C330027D01 product:src homology 2 domain-containing transforming protein C1, full insert sequence Length=3114 Score = 5674 bits (3072), Expect = 0.0 Identities = 3077/3079 (99%), Gaps = 2/3079 (0%) Strand=Plus/Plus Query 14 CTGGGGTGAAAGTTGGGGCGGTGACTTAAGCAGACAGTTGCGTGATCCGGAACCAGATCG 73 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 37 CTGGGGTGAAAGTTGGGGCGGTGACTTAAGCAGACAGTTGCGTGATCCGGAACCAGATCG 96 Query 74 GCCCGCGGTGCGGTGCGGAGACTCCATGAGACCCTGGACATGAACAAGCTGAGTGGAGGC 133 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 97 GCCCGCGGTGCGGTGCGGAGACTCCATGAGACCCTGGACATGAACAAGCTGAGTGGAGGC 156 Query 134 GGCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCTGGGGGGCGAGGAGTGGACCAGACAC 193 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 157 GGCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCTGGGGGGCGAGGAGTGGACCAGACAC 216 Query 194 GGGAGCTTTGTCAATAAGCCCACACGAGGCTGGCTGCATCCCAACGACAAAGTCATGGGA 253 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 217 GGGAGCTTTGTCAATAAGCCCACACGAGGCTGGCTGCATCCCAACGACAAAGTCATGGGA 276 Query 254 CCTGGGGTTTCCTACTTGGTTCGGTACATGGGCTGTGTGGAGGTCTTACAGTCAATGCGA 313 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 277 CCTGGGGTTTCCTACTTGGTTCGGTACATGGGCTGTGTGGAGGTCTTACAGTCAATGCGA 336 Query 314 GCCCTTGACTTCAATACCCGGACTCAGGTCACCAGGGAGGCCATCAGTTTGGTGTGTGAA 373 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 337 GCCCTTGACTTCAATACCCGGACTCAGGTCACCAGGGAGGCCATCAGTTTGGTGTGTGAA 396 Query 374 GCTGTGCCTGGTGCCAAAGGGGCGACAAGGAGGAGAAAGCCTTGTAGCCGCCCACTCAGC 433 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 397 GCTGTGCCTGGTGCCAAAGGGGCGACAAGGAGGAGAAAGCCTTGTAGCCGCCCACTCAGC 456 Query 434 TCCATCCTGGGGAGGAGTAACCTGAAGTTTGCTGGAATGCCAATCACTCTCACTGTGTCT 493 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 457 TCCATCCTGGGGAGGAGTAACCTGAAGTTTGCTGGAATGCCAATCACTCTCACTGTGTCT 516 Query 494 ACCAGCAGCCTTAACCTCATGGCAGCCGACTGCAAACAGATCATTGCCAACCATCACATG 553 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 517 ACCAGCAGCCTTAACCTCATGGCAGCCGACTGCAAACAGATCATTGCCAACCATCACATG 576 Query 554 CAATCTATCTCTTTCGCGTCCGGTGGGGATCCGGACACAGCTGAGTATGTTGCCTATGTT 613 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 577 CAATCTATCTCTTTCGCGTCCGGTGGGGATCCGGACACAGCTGAGTATGTTGCCTATGTT 636 Query 614 GCCAAAGACCCTGTGAATCAGAGAGCCTGCCATATCCTGGAGTGTCCTGAAGGGCTTGCT 673 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 637 GCCAAAGACCCTGTGAATCAGAGAGCCTGCCATATCCTGGAGTGTCCTGAAGGGCTTGCT 696 Query 674 CAGGATGTCATCAGCACCATCGGGCAGGCCTTTGAGTTGCGCTTCAAACAGTATCTCAGG 733 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 697 CAGGATGTCATCAGCACCATCGGGCAGGCCTTTGAGTTGCGCTTCAAACAGTATCTCAGG 756 Query 734 AATCCACCGAAGCTGGTCACCCCCCATGACAGGATGGCTGGCTTTGATGGCTCAGCTTGG 793 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 757 AATCCACCGAAGCTGGTCACCCCCCATGACAGGATGGCTGGCTTTGATGGCTCAGCTTGG 816 Query 794 GATGAGGAGGAAGAAGAGCCCCCTGACCATCAGTACTACAATGACTTTCCAGGGAAGGAA 853 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 817 GATGAGGAGGAAGAAGAGCCCCCTGACCATCAGTACTACAATGACTTTCCAGGGAAGGAA 876 Query 854 CCCCCTCTTGGTGGGGTGGTAGATATGAGGCTTCGGGAAGGGGCTGCTCGACCCACTCTG 913 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 877 CCCCCTCTTGGTGGGGTGGTAGATATGAGGCTTCGGGAAGGGGCTGCTCGACCCACTCTG 936 Query 914 CCTAGTGCCCAGATGTCCAGCCACTTGGGAGCTACACTGCCTATAGGGCAGCATGCTGCA 973 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 937 CCTAGTGCCCAGATGTCCAGCCACTTGGGAGCTACACTGCCTATAGGGCAGCATGCTGCA 996 Query 974 GGAGACCATGAAGTCCGTAAACAGATGTTGCCTCCGCCGCCTTGCCCAGGCAGAGAACTC 1033 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 997 GGAGACCATGAAGTCCGTAAACAGATGTTGCCTCCGCCGCCTTGCCCAGGCAGAGAACTC 1056 Query 1034 TTCGATGACCCCTCCTATGTCAACATCCAGAATCTAGACAAGGCCCGGCAGGCTGGGGGT 1093 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1057 TTCGATGACCCCTCCTATGTCAACATCCAGAATCTAGACAAGGCCCGGCAGGCTGGGGGT 1116 Query 1094 GGGGCTGGGCCCCCAAATCCTTCTCTTAATGGCAGTGCACCCCGAGACCTTTTTGACATG 1153 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1117 GGGGCTGGGCCCCCAAATCCTTCTCTTAATGGCAGTGCACCCCGAGACCTTTTTGACATG 1176 Query 1154 AAGCCCTTTGAAGATGCACTTCGGGTGCCACCCCCACCGCAGTCCATGTCCATGGCTGAG 1213 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1177 AAGCCCTTTGAAGATGCACTTCGGGTGCCACCCCCACCGCAGTCCATGTCCATGGCTGAG 1236 Query 1214 CAGCTGCAAGGGGAGCCCTGGTTCCACGGGAAGCTGAGCCGGAGGGAGGCCGAGGCGCTG 1273 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1237 CAGCTGCAAGGGGAGCCCTGGTTCCACGGGAAGCTGAGCCGGAGGGAGGCCGAGGCGCTG 1296 Query 1274 CTGCAGCTCAATGGTGACTTCTTGGTGCGAGAGAGCACGACCACGCCTGGCCAGTATGTG 1333 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1297 CTGCAGCTCAATGGTGACTTCTTGGTGCGAGAGAGCACGACCACGCCTGGCCAGTATGTG 1356 Query 1334 CTCACTGGCCTGCAGAGTGGGCAGCCCAAGCACTTGCTGCTGGTGGACCCTGAAGGTGTG 1393 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1357 CTCACTGGCCTGCAGAGTGGGCAGCCCAAGCACTTGCTGCTGGTGGACCCTGAAGGTGTG 1416 Query 1394 GTTCGGACAAAGGATCACCGCTTTGAGAGTGTCAGTCACCTGATCAGCTACCACATGGAC 1453 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1417 GTTCGGACAAAGGATCACCGCTTTGAGAGTGTCAGTCACCTGATCAGCTACCACATGGAC 1476 Query 1454 AATCACTTGCCCATCATCTCTGCGGGCAGCGAACTGTGCCTACAGCAACCCGTGGATCGG 1513 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1477 AATCACTTGCCCATCATCTCTGCGGGCAGCGAACTGTGCCTACAGCAACCCGTGGATCGG 1536 Query 1514 AAAGTGTGATCCTTCTCAGCTTCTCCAACAGGATGCTCTCCATTTCCGTCTCCCGTATTC 1573 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1537 AAAGTGTGATCCTTCTCAGCTTCTCCAACAGGATGCTCTCCATTTCCGTCTCCCGTATTC 1596 Query 1574 TCTAACTTGTGGGACCTCTGTTTTGTGGGTCTGGCCTTGGGTGGGAACTGGGAGCAACGA 1633 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1597 TCTAACTTGTGGGACCTCTGTTTTGTGGGTCTGGCCTTGGGTGGGAACTGGGAGCAACGA 1656 Query 1634 GGACATGGGTTTAGTGCCCACTTGAGAGAGAGAAAAAGAGGGTTTCAGTAAGGAGCCTGG 1693 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1657 GGACATGGGTTTAGTGCCCACTTGAGAGAGAGAAAAAGAGGGTTTCAGTAAGGAGCCTGG 1716 Query 1694 GGTAGCATCCTGCCTCTGGCCAAACTTCACCAAAGTATTAATGTGCAGAGTGGTCCCTTG 1753 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1717 GGTAGCATCCTGCCTCTGGCCAAACTTCACCAAAGTATTAATGTGCAGAGTGGTCCCTTG 1776 Query 1754 TCTGGGCCTTGCCTGTGCCAACCTGATGCCCTTcccccccAAAGGGTGGGTTCTTATAAT 1813 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1777 TCTGGGCCTTGCCTGTGCCAACCTGATGCCCTTCCCCCCCAAAGGGTGGGTTCTTATAAT 1836 Query 1814 GGAAAATGCCCTGTGATGATAGGCCCAGTGGAGCAACTGCCCTTTGGGGGAAGGGAAATA 1873 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1837 GGAAAATGCCCTGTGATGATAGGCCCAGTGGAGCAACTGCCCTTTGGGGGAAGGGAAATA 1896 Query 1874 ATTATACCTCTGGTTTACTCCTGGGTCTTCAGGGTACCCCAGATCCCGCATAACATATCC 1933 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1897 ATTATACCTCTGGTTTACTCCTGGGTCTTCAGGGTACCCCAGATCCCGCATAACATATCC 1956 Query 1934 CACTCCCTCTGCTTCCCCTTAAACTTTGTGCCTTTGACTATCATAGGTCTGCAGATACTT 1993 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1957 CACTCCCTCTGCTTCCCCTTAAACTTTGTGCCTTTGACTATCATAGGTCTGCAGATACTT 2016 Query 1994 AATGCAGAGTTCTCAGGCCCTTCACGTGTGGACAGGGGTTACTGCCACCTTGGCTTCTGG 2053 |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2017 AATGCAGAGTTCTC-GGCCCTTCACGTGTGGACAGGGGTTACTGCCACCTTGGCTTCTGG 2075 Query 2054 AGCCCTGTCCTATTCAGCACCCCTTCCTGTGTCTAGGGAGAATAGGGACAGGAGTGGCCG 2113 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2076 AGCCCTGTCCTATTCAGCACCCCTTCCTGTGTCTAGGGAGAATAGGGACAGGAGTGGCCG 2135 Query 2114 CTATCTGCTCTGCCTTTCGGATGTGCAGCCCTTAAGAGATTGCCCCAAGCCTGAATATGG 2173 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2136 CTATCTGCTCTGCCTTTCGGATGTGCAGCCCTTAAGAGATTGCCCCAAGCCTGAATATGG 2195 Query 2174 TGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGAATTGTGAGGCCAT 2233 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2196 TGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGAATTGTGAGGCCAT 2255 Query 2234 CCGATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAACCTGTCTCC 2293 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2256 CCGATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAACCTGTCTCC 2315 Query 2294 AAAAACCAAAAAGAGCGATTACCCCAGAGCCTTCTTCCTGATGGTAGCGGGGAGGGGCAG 2353 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2316 AAAAACCAAAAAGAGCGATTACCCCAGAGCCTTCTTCCTGATGGTAGCGGGGAGGGGCAG 2375 Query 2354 GACTGGACCCATCTTGCTCAGTGCCTCCTGACCTCAATGCCTTTCCTCCAAGGGGTCTGT 2413 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2376 GACTGGACCCATCTTGCTCAGTGCCTCCTGACCTCAATGCCTTTCCTCCAAGGGGTCTGT 2435 Query 2414 ATACATTTCTCAAGCCTGCTCCTCCCATGTTTGCATGTGTGTTATAGTCTACAGCCAAAG 2473 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2436 ATACATTTCTCAAGCCTGCTCCTCCCATGTTTGCATGTGTGTTATAGTCTACAGCCAAAG 2495 Query 2474 TATAGCCCTCACTGTAACCCCATCCTGCCTCCCTCCTTTGGGATAGGTGTGTGCGTCTGA 2533 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2496 TATAGCCCTCACTGTAACCCCATCCTGCCTCCCTCCTTTGGGATAGGTGTGTGCGTCTGA 2555 Query 2534 CTTGGGCCTCCAGGGTGTGTACAGTCAGTGTGGGTTTTGTGGAGGCAATAAGACTGAAGC 2593 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2556 CTTGGGCCTCCAGGGTGTGTACAGTCAGTGTGGGTTTTGTGGAGGCAATAAGACTGAAGC 2615 Query 2594 AGTAGACAATCCCCAATACCATTTGCAGGTCTGGAACTGCACTCTCTTTTTTAAAAAACA 2653 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2616 AGTAGACAATCCCCAATACCATTTGCAGGTCTGGAACTGCACTCTCTTTTTTAAAAAACA 2675 Query 2654 TGTATACATTTTAGGGCTGTAGATTTATTTTCCTGGTTTTGTTTTTCATTGCTGACTTTT 2713 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2676 TGTATACATTTTAGGGCTGTAGATTTATTTTCCTGGTTTTGTTTTTCATTGCTGACTTTT 2735 Query 2714 GAGCACAGAATTATGATAATCAATTACATTTATACATCACCTCGATGACTTTTCCAAACT 2773 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2736 GAGCACAGAATTATGATAATCAATTACATTTATACATCACCTCGATGACTTTTCCAAACT 2795 Query 2774 TTTAtttttttttttAAACAACTGTTGGGATTTTACTCCCTGGCCTTAACTAGGACAGGA 2833 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2796 TTTATTTTTTTTTTTAAACAACTGTTGGGATTTTACTCCCTGGCCTTAACTAGGACAGGA 2855 Query 2834 TTGTACCCCACTCCTcccccccccc-TTTTTCTTTTTCGCCAAGACAACTGAGCAGAAAT 2892 ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| Sbjct 2856 TTGTACCCCACTCCTCCCCCCCCCCCTTTTTCTTTTTCGCCAAGACAACTGAGCAGAAAT 2915 Query 2893 TTGGCTGAGCAGTGTTGTGGGACTATGATGTGATAGTTTTAGATCCTACCTTCTGCTTTC 2952 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2916 TTGGCTGAGCAGTGTTGTGGGACTATGATGTGATAGTTTTAGATCCTACCTTCTGCTTTC 2975 Query 2953 GGGCAGCTGCAGCCAGCACAGAAACCTTGCAAGCTCACTCTGTGTGTAGGCTTTCTGGAC 3012 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2976 GGGCAGCTGCAGCCAGCACAGAAACCTTGCAAGCTCACTCTGTGTGTAGGCTTTCTGGAC 3035 Query 3013 AAGGAATGGTCGCCAAATTTTTGGTTTGGATGTCTTATACCAAAGGGAAATAGTCTTCAT 3072 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3036 AAGGAATGGTCGCCAAATTTTTGGTTTGGATGTCTTATACCAAAGGGAAATAGTCTTCAT 3095 Query 3073 TAAAGTTCGTATTTCTTTT 3091 ||||||||||||||||||| Sbjct 3096 TAAAGTTCGTATTTCTTTT 3114 >ref|XM_484699.4| Gene info PREDICTED: Mus musculus similar to src homology collagen protein 66 kDa isoform (LOC433158), mRNA Length=2560 Score = 4361 bits (2361), Expect = 0.0 Identities = 2463/2511 (98%), Gaps = 11/2511 (0%) Strand=Plus/Plus Query 599 TATGTTGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCATATCCTGGAGTGT 658 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 49 TATGTTGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCATATCCTGGAGTGT 108 Query 659 CCTGAAGGGCTTGCTCAGGATGTCATCAGCACCATCGGGCAGGCCTTTGAGTTGCGCTTC 718 ||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct 109 CCTGAAGGGTTTGCTCAGGATGTCATCAGCACCATCGGGCAGGCCTTTGAGTTGTGCTTC 168 Query 719 AAACAGTATCTCAGGAATCCACCGAAGCTGGTCACCCCCCATGACAGGATGGCTGGCTTT 778 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 169 AAACAGTATCTCAGGAATCCACCGAAGCTGGTCACCCCCCATGACAGGATGGCTGGCTTT 228 Query 779 GATGGCTCAGCTTGGGATGAGGAGGAAGAAGAGCCCCCTGACCATCAGTACTACAATGAC 838 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 229 GATGGCTCAGCTTGGGATGAGGAGGAAGAAGAGCCCCCTGACCATCAGTACTACAATGAC 288 Query 839 TTTCCAGGGAAGGAACCCCCTCTTGGTGGGGTGGTAGATATGAGGCTTCGGGAAGGGGCT 898 |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct 289 TTTCCAGGGAAGGAACCCCCTCTTGGTGGGGTGGTAGATATGAGGCCTCGGGAAGGGGCT 348 Query 899 GCTCGACCCACTCTGCCTAGTGCCCAGATGTCCAGCCACTTGGGAGCTACACTGCCTATA 958 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 349 GCTCGACCCACTCTGCCTAGTGCCCAGATGTCCAGCCACTTGGGAGCTACACTGCCTATA 408 Query 959 GGGCAGCATGCTGCAGGAGACCATGAAGTCCGTAAACAGATGTTGCCTCCGCCGCCTTGC 1018 ||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||| Sbjct 409 GGGCAGCATGCTGCAGGAGACCATGAAGTCCGTAAACAGATGTTGCCTCCGCCACGTTGC 468 Query 1019 CCAGGCAGAGAACTCTTCGATGACCCCTCCTATGTCAACATCCAGAATCTAGACAAGGCC 1078 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 469 CCAGGCAGAGAACTCTTCGATGACCCCTCCTATGTCAACATCCAGAATCTAGACAAGGCC 528 Query 1079 CGGCAGGCTGGGGGTGGGGCTGGGCCCCCAAATCCTTCTCTTAATGGCAGTGCACCCCGA 1138 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 529 CGGCAGGCTGGGGGTGGGGCTGGGCCCCCAAATCCTTCTCTTAATGGCAGTGCACCCCGA 588 Query 1139 GACCTTTTTGACATGAAGCCCTTTGAAGATGCACTTCGGGTGCCACCCCCACCGCAGTCC 1198 |||||||||||||||||||||||||||||| |||||||||||||| |||||| ||||||| Sbjct 589 GACCTTTTTGACATGAAGCCCTTTGAAGATACACTTCGGGTGCCATCCCCACTGCAGTCC 648 Query 1199 ATGTCCATGGCTGAGCAGCTGCAAGGGGAGCCCTGGTTCCACGGGAAGCTGAGCCGGAGG 1258 |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 649 ATGTTCATGGCTGAGCAGCTGCAAGGGGAGCCCTGGTTCCACGGGAAGCTGAGCCGGAGG 708 Query 1259 GAGGCCGAGGCGCTGCTGCAGCTCAATGGTGACTTCTTGGTGCGAGAGAGCACGACCACG 1318 |||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 709 GAGGCCAAGGCACTGCTGCAGCTCAATGGTGACTTCTTGGTGCGAGAGAGCACGACCACA 768 Query 1319 CCTGGCCAGTATGTGCTCACTGGCCTGCAGAGTGGGCAGCCCAAGCACTTGCTGCTGGTG 1378 |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct 769 CCTGGCCAGTATGTGCTCACTGACCTGCAGAGTGGGCAGCCCAAGCACTTGCTGCTGGTG 828 Query 1379 GACCCTGAAGGTGTGGTTCGGACAAAGGATCACCGCTTTGAGAGTGTCAGTCACCTGATC 1438 ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| Sbjct 829 GACCCTGAAGGTGTGGTTCGGACAAAGGATCACTGCTTTGAGAGTGTCAGTCACCTGATC 888 Query 1439 AGCTACCACATGGACAATCACTTGCCCATCATCTCTGCGGGCAGCGAACTGTGCCTACAG 1498 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 889 AGCTACCACATGGACAATCACTTGCCCATCATCTCTGCGGGCAGCGAACTGTGCCTACAG 948 Query 1499 CAACCCGTGGATCGGAAAGTGTGATCCTTCTCAGCTTCTCCAACAGGATGCTCTCCATTT 1558 ||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||| Sbjct 949 CAACCCGTGGATCGGAAAGTGTGATCCTTCTCAGCTTCTCCAACAAGATGCTCTTCATTC 1008 Query 1559 CCGTCTCCCGTATTCTCTAACTTGTGGGACCTCTGTTTTGTGGGTCTGGCCTTGGGTGGG 1618 |||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1009 CCGTTTCCCATATTCTCTAACTTGTGGGACCTCTGTTTTGTGGGTCTGGCCTTGGGTGGG 1068 Query 1619 AACTGGGAGCAACGAGGACATGGGTTTAGTGCCCACTTGAGAGAGAGAAAAAGAGGGTTT 1678 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1069 AACTGGGAGCAACGAGGACATGGGTTTAGTGCCCACTTGAGAGAGAGAAAAAGAGGGTTT 1128 Query 1679 CAGTAAGGAGCCTGGGGTAGCATCCTGCCTCTGGCCAAACTTCACCAAAGTATTAATGTG 1738 ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || Sbjct 1129 CAGTAAGGAGCCTGGGGTAGCATCCTGCCTCTGCCCAAACTTCACCAAAGTATTAATATG 1188 Query 1739 CAGAGTGGTCCCTTGTCTGGGCCTTGCCTGTGCCAACCTGATGCCCTTcccccccAAAGG 1798 |||||||||||||||||||||||| |||||||||||||||||||| |||||||| ||||| Sbjct 1189 CAGAGTGGTCCCTTGTCTGGGCCT-GCCTGTGCCAACCTGATGCCGTTCCCCCC-AAAGG 1246 Query 1799 GTGGGTTCTTATAATGGAAAATGCCCTGTGATGATAGGCCCAGTGGAGCAACTGCCCTTT 1858 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1247 GTGGGTTCTTATAATGGAAAATGCCCTGTGATGATAGGCCCAGTGGAGCAACTGCCCTTT 1306 Query 1859 GGGGGAAGGGAAATAATTATACCTCTGGTTTACTCCTGGGTCTTCAGGGTACCCCAGATC 1918 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1307 GGGGGAAGGGAAATAATTATACCTCTGGTTTACTCCTGGGTCTTCAGGGTACCCCAGATC 1366 Query 1919 CCGC-ATAACATATCCCACTCCCTCTGCTTCCCCTTAAACTTTGTGCCTTTGACTATCAT 1977 |||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1367 CCGCGA-AACATATCCCACTCCCTCTGCTTCCCCTTAAACTTTGTGCCTTTGACTATCAT 1425 Query 1978 AGGTCTGCAGATACTTAATGCAGAGTTCTCAGGCCCTTCACGTGTGGACAGGGGTTACTG 2037 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct 1426 AGGTCTGCAGATACTTAATGCAGAGTTCTCAGGCTCTTCACGTGTGGACAGGGGTTACTG 1485 Query 2038 CCACCTTGGCTTCTGGAGCCCTGTCCTATTCAGCACCCCTTCCTGTGTCTAGGGAGAATA 2097 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1486 CCACCTTGGCTTCTGGAGCCCTGTCCTATTCAGCACCCCTTCCTGTGTCTAGGGAGAATA 1545 Query 2098 GGGACAGGAGTGGCCGCTATCTGCTCTGCCTTTCGGATGTGCAGCCCTTAAGAGATTGCC 2157 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1546 GGGACAGGAGTGGCCGCTATCTGCTCTGCCTTTCGGATGTGCAGCCCTTAAGAGATTGCC 1605 Query 2158 CCAAGCCTGAATATGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGA 2217 ||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| Sbjct 1606 CCAAGCCAGAATATGGTGGCACACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGA 1665 Query 2218 GGAATTGTGAGGCCATCCGATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGA 2277 ||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||| Sbjct 1666 GGATTTGTGAGGCCATCCCATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGA 1725 Query 2278 GAGAGAACCTGTCTCCAAAAACCAAAAAGAGCGATTACCCCAGAGCCTTCTTCCTGATGG 2337 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1726 GAGAGAACCTGTCTCCAAAAACCAAAAAGAGCGATTACCCCAGAGCCTTCTTCCTGATGG 1785 Query 2338 TAGCGGGGAGGGGCAGGACTGGACCCATCTTGCTCAGTGCCTCCTGACCTCAATGCCTTT 2397 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1786 TAGCGGGGAGGGGCAGGACTGGACCCATCTTGCTCAGTGCCTCCTGACCTCAATGCCTTT 1845 Query 2398 CCTCCAAGGGGTCTGTATACATTTCTCAAGCCTGCTCCTCCCATGTTTGCATGTGTGTTA 2457 || ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1846 CC---AAGGGGTCTGTATACATTTCTCAAGCCTGCTCCTCCCATGTTTGCATGTGTGTTA 1902 Query 2458 TAGTCTACAGCCAAAGTATAGCCCTCACTGTAACCCCATCCTGCCTCCCTCCTTTGGGAT 2517 ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Sbjct 1903 TAGTCTACAGCCAAAGTATAGCCCTCACTGTAACCCCATCCAGCCTCCCTCCTTTGGGAT 1962 Query 2518 AGGTGTGTGCGTCTGACTTGGGCCTCCAGGGTGTGTACAGTCAGTGTGGGTTTTGTGGAG 2577 |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1963 AGGTGTATGCGTCTGACTTGGGCCTCCAGGGTGTGTACAGTCAGTGTGGGTTTTGTGGAG 2022 Query 2578 GCAATAAGACTGAAGCAGTAGACAATCCCCAATACCATTTGCAGGTCTGGAACTGCACTC 2637 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2023 GCAATAAGACTGAAGCAGTAGACAATCCCCAATACCATTTGCAGGTCTGGAACTGCACTC 2082 Query 2638 TCTTTTTTAAAAAACATGTATACATTTTAGGGCTGTAGATTTATTTTCCTGGTTTTGTTT 2697 |||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||| Sbjct 2083 TCTTTTTTAAAAAACATGTATACATTTTAGGGCTATAGATTTATTTTCCTGTTTTTGTTT 2142 Query 2698 TTCATTGCTGACTTTTGAGCACAGAATTATGATAATCAATTACATTTATACATCACCTCG 2757 |||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||| Sbjct 2143 TTCATTACTGACTTTTGAGCACAGAATTATGATAATCAACTACATTTATACATCACCTCG 2202 Query 2758 ATGACTTTTCCAAACTTTTAtttttttttttAAACAACTGTTGGGATTTTACTCCCTGGC 2817 ||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||| Sbjct 2203 ATGACTTTTCCAAACTTTT-TTTTTTTTTT-AAACAACTGTTGGGATTTTACTCCCTGGC 2260 Query 2818 CTTAACTAGGACAGGATTGTACCCCACTCCTccccccccccTTTTT-CTTTTTCGCCAAG 2876 ||||||||||||||| |||||||||||||||||| ||||||||||| ||||||||||||| Sbjct 2261 CTTAACTAGGACAGGGTTGTACCCCACTCCTCCCTCCCCCCTTTTTTCTTTTTCGCCAAG 2320 Query 2877 ACAACTGAGCAGAAATTTGGCTGAGCAGTGTTGTGGGACTATGATGTGATAGTTTTAGAT 2936 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2321 ACAACTGAGCAGAAATTTGGCTGAGCAGTGTTGTGGGACTATGATGTGATAGTTTTAGAT 2380 Query 2937 CCTACCTTCTGCTTTCGGGCAGCTGCAGCCAGCACAGAAACCTTGCAAGCTCACTCTGTG 2996 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2381 CCTACCTTCTGCTTTCGGGCAGCTGCAGCCAGCACAGAAACCTTGCAAGCTCACTCTGTA 2440 Query 2997 TGTAGGCTTTCTGGACAAGGAATGGTCGCCAAATTTTTGGTTTGGATGTCTTATACCAAA 3056 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2441 TGTAGGCTTTCTGGACAAGGAATGGTCGCCAAATTTTTGGTTTGGATGTCTTATACCAAA 2500 Query 3057 GGGAAATAGTCTTCATTAAAGTTCGTATTTCTTTTAAAAAAAAAAAAAAAA 3107 ||||||||| |||||||||||||||||||||||| |||||||||||||||| Sbjct 2501 GGGAAATAGCCTTCATTAAAGTTCGTATTTCTTT-AAAAAAAAAAAAAAAA 2550 >ref|XM_909974.2| Gene info PREDICTED: Mus musculus similar to src homology collagen protein 66 kDa isoform (LOC433158), mRNA Length=2560 Score = 4361 bits (2361), Expect = 0.0 Identities = 2463/2511 (98%), Gaps = 11/2511 (0%) Strand=Plus/Plus Query 599 TATGTTGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCATATCCTGGAGTGT 658 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 49 TATGTTGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCATATCCTGGAGTGT 108 Query 659 CCTGAAGGGCTTGCTCAGGATGTCATCAGCACCATCGGGCAGGCCTTTGAGTTGCGCTTC 718 ||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct 109 CCTGAAGGGTTTGCTCAGGATGTCATCAGCACCATCGGGCAGGCCTTTGAGTTGTGCTTC 168 Query 719 AAACAGTATCTCAGGAATCCACCGAAGCTGGTCACCCCCCATGACAGGATGGCTGGCTTT 778 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 169 AAACAGTATCTCAGGAATCCACCGAAGCTGGTCACCCCCCATGACAGGATGGCTGGCTTT 228 Query 779 GATGGCTCAGCTTGGGATGAGGAGGAAGAAGAGCCCCCTGACCATCAGTACTACAATGAC 838 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 229 GATGGCTCAGCTTGGGATGAGGAGGAAGAAGAGCCCCCTGACCATCAGTACTACAATGAC 288 Query 839 TTTCCAGGGAAGGAACCCCCTCTTGGTGGGGTGGTAGATATGAGGCTTCGGGAAGGGGCT 898 |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct 289 TTTCCAGGGAAGGAACCCCCTCTTGGTGGGGTGGTAGATATGAGGCCTCGGGAAGGGGCT 348 Query 899 GCTCGACCCACTCTGCCTAGTGCCCAGATGTCCAGCCACTTGGGAGCTACACTGCCTATA 958 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 349 GCTCGACCCACTCTGCCTAGTGCCCAGATGTCCAGCCACTTGGGAGCTACACTGCCTATA 408 Query 959 GGGCAGCATGCTGCAGGAGACCATGAAGTCCGTAAACAGATGTTGCCTCCGCCGCCTTGC 1018 ||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||| Sbjct 409 GGGCAGCATGCTGCAGGAGACCATGAAGTCCGTAAACAGATGTTGCCTCCGCCACGTTGC 468 Query 1019 CCAGGCAGAGAACTCTTCGATGACCCCTCCTATGTCAACATCCAGAATCTAGACAAGGCC 1078 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 469 CCAGGCAGAGAACTCTTCGATGACCCCTCCTATGTCAACATCCAGAATCTAGACAAGGCC 528 Query 1079 CGGCAGGCTGGGGGTGGGGCTGGGCCCCCAAATCCTTCTCTTAATGGCAGTGCACCCCGA 1138 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 529 CGGCAGGCTGGGGGTGGGGCTGGGCCCCCAAATCCTTCTCTTAATGGCAGTGCACCCCGA 588 Query 1139 GACCTTTTTGACATGAAGCCCTTTGAAGATGCACTTCGGGTGCCACCCCCACCGCAGTCC 1198 |||||||||||||||||||||||||||||| |||||||||||||| |||||| ||||||| Sbjct 589 GACCTTTTTGACATGAAGCCCTTTGAAGATACACTTCGGGTGCCATCCCCACTGCAGTCC 648 Query 1199 ATGTCCATGGCTGAGCAGCTGCAAGGGGAGCCCTGGTTCCACGGGAAGCTGAGCCGGAGG 1258 |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 649 ATGTTCATGGCTGAGCAGCTGCAAGGGGAGCCCTGGTTCCACGGGAAGCTGAGCCGGAGG 708 Query 1259 GAGGCCGAGGCGCTGCTGCAGCTCAATGGTGACTTCTTGGTGCGAGAGAGCACGACCACG 1318 |||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 709 GAGGCCAAGGCACTGCTGCAGCTCAATGGTGACTTCTTGGTGCGAGAGAGCACGACCACA 768 Query 1319 CCTGGCCAGTATGTGCTCACTGGCCTGCAGAGTGGGCAGCCCAAGCACTTGCTGCTGGTG 1378 |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct 769 CCTGGCCAGTATGTGCTCACTGACCTGCAGAGTGGGCAGCCCAAGCACTTGCTGCTGGTG 828 Query 1379 GACCCTGAAGGTGTGGTTCGGACAAAGGATCACCGCTTTGAGAGTGTCAGTCACCTGATC 1438 ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| Sbjct 829 GACCCTGAAGGTGTGGTTCGGACAAAGGATCACTGCTTTGAGAGTGTCAGTCACCTGATC 888 Query 1439 AGCTACCACATGGACAATCACTTGCCCATCATCTCTGCGGGCAGCGAACTGTGCCTACAG 1498 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 889 AGCTACCACATGGACAATCACTTGCCCATCATCTCTGCGGGCAGCGAACTGTGCCTACAG 948 Query 1499 CAACCCGTGGATCGGAAAGTGTGATCCTTCTCAGCTTCTCCAACAGGATGCTCTCCATTT 1558 ||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||| Sbjct 949 CAACCCGTGGATCGGAAAGTGTGATCCTTCTCAGCTTCTCCAACAAGATGCTCTTCATTC 1008 Query 1559 CCGTCTCCCGTATTCTCTAACTTGTGGGACCTCTGTTTTGTGGGTCTGGCCTTGGGTGGG 1618 |||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1009 CCGTTTCCCATATTCTCTAACTTGTGGGACCTCTGTTTTGTGGGTCTGGCCTTGGGTGGG 1068 Query 1619 AACTGGGAGCAACGAGGACATGGGTTTAGTGCCCACTTGAGAGAGAGAAAAAGAGGGTTT 1678 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1069 AACTGGGAGCAACGAGGACATGGGTTTAGTGCCCACTTGAGAGAGAGAAAAAGAGGGTTT 1128 Query 1679 CAGTAAGGAGCCTGGGGTAGCATCCTGCCTCTGGCCAAACTTCACCAAAGTATTAATGTG 1738 ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || Sbjct 1129 CAGTAAGGAGCCTGGGGTAGCATCCTGCCTCTGCCCAAACTTCACCAAAGTATTAATATG 1188 Query 1739 CAGAGTGGTCCCTTGTCTGGGCCTTGCCTGTGCCAACCTGATGCCCTTcccccccAAAGG 1798 |||||||||||||||||||||||| |||||||||||||||||||| |||||||| ||||| Sbjct 1189 CAGAGTGGTCCCTTGTCTGGGCCT-GCCTGTGCCAACCTGATGCCGTTCCCCCC-AAAGG 1246 Query 1799 GTGGGTTCTTATAATGGAAAATGCCCTGTGATGATAGGCCCAGTGGAGCAACTGCCCTTT 1858 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1247 GTGGGTTCTTATAATGGAAAATGCCCTGTGATGATAGGCCCAGTGGAGCAACTGCCCTTT 1306 Query 1859 GGGGGAAGGGAAATAATTATACCTCTGGTTTACTCCTGGGTCTTCAGGGTACCCCAGATC 1918 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1307 GGGGGAAGGGAAATAATTATACCTCTGGTTTACTCCTGGGTCTTCAGGGTACCCCAGATC 1366 Query 1919 CCGC-ATAACATATCCCACTCCCTCTGCTTCCCCTTAAACTTTGTGCCTTTGACTATCAT 1977 |||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1367 CCGCGA-AACATATCCCACTCCCTCTGCTTCCCCTTAAACTTTGTGCCTTTGACTATCAT 1425 Query 1978 AGGTCTGCAGATACTTAATGCAGAGTTCTCAGGCCCTTCACGTGTGGACAGGGGTTACTG 2037 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct 1426 AGGTCTGCAGATACTTAATGCAGAGTTCTCAGGCTCTTCACGTGTGGACAGGGGTTACTG 1485 Query 2038 CCACCTTGGCTTCTGGAGCCCTGTCCTATTCAGCACCCCTTCCTGTGTCTAGGGAGAATA 2097 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1486 CCACCTTGGCTTCTGGAGCCCTGTCCTATTCAGCACCCCTTCCTGTGTCTAGGGAGAATA 1545 Query 2098 GGGACAGGAGTGGCCGCTATCTGCTCTGCCTTTCGGATGTGCAGCCCTTAAGAGATTGCC 2157 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1546 GGGACAGGAGTGGCCGCTATCTGCTCTGCCTTTCGGATGTGCAGCCCTTAAGAGATTGCC 1605 Query 2158 CCAAGCCTGAATATGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGA 2217 ||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| Sbjct 1606 CCAAGCCAGAATATGGTGGCACACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGA 1665 Query 2218 GGAATTGTGAGGCCATCCGATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGA 2277 ||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||| Sbjct 1666 GGATTTGTGAGGCCATCCCATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGA 1725 Query 2278 GAGAGAACCTGTCTCCAAAAACCAAAAAGAGCGATTACCCCAGAGCCTTCTTCCTGATGG 2337 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1726 GAGAGAACCTGTCTCCAAAAACCAAAAAGAGCGATTACCCCAGAGCCTTCTTCCTGATGG 1785 Query 2338 TAGCGGGGAGGGGCAGGACTGGACCCATCTTGCTCAGTGCCTCCTGACCTCAATGCCTTT 2397 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1786 TAGCGGGGAGGGGCAGGACTGGACCCATCTTGCTCAGTGCCTCCTGACCTCAATGCCTTT 1845 Query 2398 CCTCCAAGGGGTCTGTATACATTTCTCAAGCCTGCTCCTCCCATGTTTGCATGTGTGTTA 2457 || ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1846 CC---AAGGGGTCTGTATACATTTCTCAAGCCTGCTCCTCCCATGTTTGCATGTGTGTTA 1902 Query 2458 TAGTCTACAGCCAAAGTATAGCCCTCACTGTAACCCCATCCTGCCTCCCTCCTTTGGGAT 2517 ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Sbjct 1903 TAGTCTACAGCCAAAGTATAGCCCTCACTGTAACCCCATCCAGCCTCCCTCCTTTGGGAT 1962 Query 2518 AGGTGTGTGCGTCTGACTTGGGCCTCCAGGGTGTGTACAGTCAGTGTGGGTTTTGTGGAG 2577 |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1963 AGGTGTATGCGTCTGACTTGGGCCTCCAGGGTGTGTACAGTCAGTGTGGGTTTTGTGGAG 2022 Query 2578 GCAATAAGACTGAAGCAGTAGACAATCCCCAATACCATTTGCAGGTCTGGAACTGCACTC 2637 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2023 GCAATAAGACTGAAGCAGTAGACAATCCCCAATACCATTTGCAGGTCTGGAACTGCACTC 2082 Query 2638 TCTTTTTTAAAAAACATGTATACATTTTAGGGCTGTAGATTTATTTTCCTGGTTTTGTTT 2697 |||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||| Sbjct 2083 TCTTTTTTAAAAAACATGTATACATTTTAGGGCTATAGATTTATTTTCCTGTTTTTGTTT 2142 Query 2698 TTCATTGCTGACTTTTGAGCACAGAATTATGATAATCAATTACATTTATACATCACCTCG 2757 |||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||| Sbjct 2143 TTCATTACTGACTTTTGAGCACAGAATTATGATAATCAACTACATTTATACATCACCTCG 2202 Query 2758 ATGACTTTTCCAAACTTTTAtttttttttttAAACAACTGTTGGGATTTTACTCCCTGGC 2817 ||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||| Sbjct 2203 ATGACTTTTCCAAACTTTT-TTTTTTTTTT-AAACAACTGTTGGGATTTTACTCCCTGGC 2260 Query 2818 CTTAACTAGGACAGGATTGTACCCCACTCCTccccccccccTTTTT-CTTTTTCGCCAAG 2876 ||||||||||||||| |||||||||||||||||| ||||||||||| ||||||||||||| Sbjct 2261 CTTAACTAGGACAGGGTTGTACCCCACTCCTCCCTCCCCCCTTTTTTCTTTTTCGCCAAG 2320 Query 2877 ACAACTGAGCAGAAATTTGGCTGAGCAGTGTTGTGGGACTATGATGTGATAGTTTTAGAT 2936 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2321 ACAACTGAGCAGAAATTTGGCTGAGCAGTGTTGTGGGACTATGATGTGATAGTTTTAGAT 2380 Query 2937 CCTACCTTCTGCTTTCGGGCAGCTGCAGCCAGCACAGAAACCTTGCAAGCTCACTCTGTG 2996 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2381 CCTACCTTCTGCTTTCGGGCAGCTGCAGCCAGCACAGAAACCTTGCAAGCTCACTCTGTA 2440 Query 2997 TGTAGGCTTTCTGGACAAGGAATGGTCGCCAAATTTTTGGTTTGGATGTCTTATACCAAA 3056 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2441 TGTAGGCTTTCTGGACAAGGAATGGTCGCCAAATTTTTGGTTTGGATGTCTTATACCAAA 2500 Query 3057 GGGAAATAGTCTTCATTAAAGTTCGTATTTCTTTTAAAAAAAAAAAAAAAA 3107 ||||||||| |||||||||||||||||||||||| |||||||||||||||| Sbjct 2501 GGGAAATAGCCTTCATTAAAGTTCGTATTTCTTT-AAAAAAAAAAAAAAAA 2550 >gb|AC123951.3| Download subject sequence spanning the HSP Mus musculus BAC clone RP23-166M23 from 18, complete sequence Length=220088 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 4361 bits (2361), Expect = 0.0 Identities = 2463/2511 (98%), Gaps = 11/2511 (0%) Strand=Plus/Plus Query 599 TATGTTGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCATATCCTGGAGTGT 658 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 119473 TATGTTGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCATATCCTGGAGTGT 119532 Query 659 CCTGAAGGGCTTGCTCAGGATGTCATCAGCACCATCGGGCAGGCCTTTGAGTTGCGCTTC 718 ||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct 119533 CCTGAAGGGTTTGCTCAGGATGTCATCAGCACCATCGGGCAGGCCTTTGAGTTGTGCTTC 119592 Query 719 AAACAGTATCTCAGGAATCCACCGAAGCTGGTCACCCCCCATGACAGGATGGCTGGCTTT 778 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 119593 AAACAGTATCTCAGGAATCCACCGAAGCTGGTCACCCCCCATGACAGGATGGCTGGCTTT 119652 Query 779 GATGGCTCAGCTTGGGATGAGGAGGAAGAAGAGCCCCCTGACCATCAGTACTACAATGAC 838 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 119653 GATGGCTCAGCTTGGGATGAGGAGGAAGAAGAGCCCCCTGACCATCAGTACTACAATGAC 119712 Query 839 TTTCCAGGGAAGGAACCCCCTCTTGGTGGGGTGGTAGATATGAGGCTTCGGGAAGGGGCT 898 |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct 119713 TTTCCAGGGAAGGAACCCCCTCTTGGTGGGGTGGTAGATATGAGGCCTCGGGAAGGGGCT 119772 Query 899 GCTCGACCCACTCTGCCTAGTGCCCAGATGTCCAGCCACTTGGGAGCTACACTGCCTATA 958 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 119773 GCTCGACCCACTCTGCCTAGTGCCCAGATGTCCAGCCACTTGGGAGCTACACTGCCTATA 119832 Query 959 GGGCAGCATGCTGCAGGAGACCATGAAGTCCGTAAACAGATGTTGCCTCCGCCGCCTTGC 1018 ||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||| Sbjct 119833 GGGCAGCATGCTGCAGGAGACCATGAAGTCCGTAAACAGATGTTGCCTCCGCCACGTTGC 119892 Query 1019 CCAGGCAGAGAACTCTTCGATGACCCCTCCTATGTCAACATCCAGAATCTAGACAAGGCC 1078 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 119893 CCAGGCAGAGAACTCTTCGATGACCCCTCCTATGTCAACATCCAGAATCTAGACAAGGCC 119952 Query 1079 CGGCAGGCTGGGGGTGGGGCTGGGCCCCCAAATCCTTCTCTTAATGGCAGTGCACCCCGA 1138 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 119953 CGGCAGGCTGGGGGTGGGGCTGGGCCCCCAAATCCTTCTCTTAATGGCAGTGCACCCCGA 120012 Query 1139 GACCTTTTTGACATGAAGCCCTTTGAAGATGCACTTCGGGTGCCACCCCCACCGCAGTCC 1198 |||||||||||||||||||||||||||||| |||||||||||||| |||||| ||||||| Sbjct 120013 GACCTTTTTGACATGAAGCCCTTTGAAGATACACTTCGGGTGCCATCCCCACTGCAGTCC 120072 Query 1199 ATGTCCATGGCTGAGCAGCTGCAAGGGGAGCCCTGGTTCCACGGGAAGCTGAGCCGGAGG 1258 |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 120073 ATGTTCATGGCTGAGCAGCTGCAAGGGGAGCCCTGGTTCCACGGGAAGCTGAGCCGGAGG 120132 Query 1259 GAGGCCGAGGCGCTGCTGCAGCTCAATGGTGACTTCTTGGTGCGAGAGAGCACGACCACG 1318 |||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 120133 GAGGCCAAGGCACTGCTGCAGCTCAATGGTGACTTCTTGGTGCGAGAGAGCACGACCACA 120192 Query 1319 CCTGGCCAGTATGTGCTCACTGGCCTGCAGAGTGGGCAGCCCAAGCACTTGCTGCTGGTG 1378 |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct 120193 CCTGGCCAGTATGTGCTCACTGACCTGCAGAGTGGGCAGCCCAAGCACTTGCTGCTGGTG 120252 Query 1379 GACCCTGAAGGTGTGGTTCGGACAAAGGATCACCGCTTTGAGAGTGTCAGTCACCTGATC 1438 ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| Sbjct 120253 GACCCTGAAGGTGTGGTTCGGACAAAGGATCACTGCTTTGAGAGTGTCAGTCACCTGATC 120312 Query 1439 AGCTACCACATGGACAATCACTTGCCCATCATCTCTGCGGGCAGCGAACTGTGCCTACAG 1498 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 120313 AGCTACCACATGGACAATCACTTGCCCATCATCTCTGCGGGCAGCGAACTGTGCCTACAG 120372 Query 1499 CAACCCGTGGATCGGAAAGTGTGATCCTTCTCAGCTTCTCCAACAGGATGCTCTCCATTT 1558 ||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||| Sbjct 120373 CAACCCGTGGATCGGAAAGTGTGATCCTTCTCAGCTTCTCCAACAAGATGCTCTTCATTC 120432 Query 1559 CCGTCTCCCGTATTCTCTAACTTGTGGGACCTCTGTTTTGTGGGTCTGGCCTTGGGTGGG 1618 |||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 120433 CCGTTTCCCATATTCTCTAACTTGTGGGACCTCTGTTTTGTGGGTCTGGCCTTGGGTGGG 120492 Query 1619 AACTGGGAGCAACGAGGACATGGGTTTAGTGCCCACTTGAGAGAGAGAAAAAGAGGGTTT 1678 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 120493 AACTGGGAGCAACGAGGACATGGGTTTAGTGCCCACTTGAGAGAGAGAAAAAGAGGGTTT 120552 Query 1679 CAGTAAGGAGCCTGGGGTAGCATCCTGCCTCTGGCCAAACTTCACCAAAGTATTAATGTG 1738 ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || Sbjct 120553 CAGTAAGGAGCCTGGGGTAGCATCCTGCCTCTGCCCAAACTTCACCAAAGTATTAATATG 120612 Query 1739 CAGAGTGGTCCCTTGTCTGGGCCTTGCCTGTGCCAACCTGATGCCCTTcccccccAAAGG 1798 |||||||||||||||||||||||| |||||||||||||||||||| |||||||| ||||| Sbjct 120613 CAGAGTGGTCCCTTGTCTGGGCCT-GCCTGTGCCAACCTGATGCCGTTCCCCCC-AAAGG 120670 Query 1799 GTGGGTTCTTATAATGGAAAATGCCCTGTGATGATAGGCCCAGTGGAGCAACTGCCCTTT 1858 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 120671 GTGGGTTCTTATAATGGAAAATGCCCTGTGATGATAGGCCCAGTGGAGCAACTGCCCTTT 120730 Query 1859 GGGGGAAGGGAAATAATTATACCTCTGGTTTACTCCTGGGTCTTCAGGGTACCCCAGATC 1918 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 120731 GGGGGAAGGGAAATAATTATACCTCTGGTTTACTCCTGGGTCTTCAGGGTACCCCAGATC 120790 Query 1919 CCGC-ATAACATATCCCACTCCCTCTGCTTCCCCTTAAACTTTGTGCCTTTGACTATCAT 1977 |||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 120791 CCGCGA-AACATATCCCACTCCCTCTGCTTCCCCTTAAACTTTGTGCCTTTGACTATCAT 120849 Query 1978 AGGTCTGCAGATACTTAATGCAGAGTTCTCAGGCCCTTCACGTGTGGACAGGGGTTACTG 2037 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct 120850 AGGTCTGCAGATACTTAATGCAGAGTTCTCAGGCTCTTCACGTGTGGACAGGGGTTACTG 120909 Query 2038 CCACCTTGGCTTCTGGAGCCCTGTCCTATTCAGCACCCCTTCCTGTGTCTAGGGAGAATA 2097 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 120910 CCACCTTGGCTTCTGGAGCCCTGTCCTATTCAGCACCCCTTCCTGTGTCTAGGGAGAATA 120969 Query 2098 GGGACAGGAGTGGCCGCTATCTGCTCTGCCTTTCGGATGTGCAGCCCTTAAGAGATTGCC 2157 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 120970 GGGACAGGAGTGGCCGCTATCTGCTCTGCCTTTCGGATGTGCAGCCCTTAAGAGATTGCC 121029 Query 2158 CCAAGCCTGAATATGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGA 2217 ||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| Sbjct 121030 CCAAGCCAGAATATGGTGGCACACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGA 121089 Query 2218 GGAATTGTGAGGCCATCCGATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGA 2277 ||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||| Sbjct 121090 GGATTTGTGAGGCCATCCCATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGA 121149 Query 2278 GAGAGAACCTGTCTCCAAAAACCAAAAAGAGCGATTACCCCAGAGCCTTCTTCCTGATGG 2337 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 121150 GAGAGAACCTGTCTCCAAAAACCAAAAAGAGCGATTACCCCAGAGCCTTCTTCCTGATGG 121209 Query 2338 TAGCGGGGAGGGGCAGGACTGGACCCATCTTGCTCAGTGCCTCCTGACCTCAATGCCTTT 2397 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 121210 TAGCGGGGAGGGGCAGGACTGGACCCATCTTGCTCAGTGCCTCCTGACCTCAATGCCTTT 121269 Query 2398 CCTCCAAGGGGTCTGTATACATTTCTCAAGCCTGCTCCTCCCATGTTTGCATGTGTGTTA 2457 || ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 121270 CC---AAGGGGTCTGTATACATTTCTCAAGCCTGCTCCTCCCATGTTTGCATGTGTGTTA 121326 Query 2458 TAGTCTACAGCCAAAGTATAGCCCTCACTGTAACCCCATCCTGCCTCCCTCCTTTGGGAT 2517 ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Sbjct 121327 TAGTCTACAGCCAAAGTATAGCCCTCACTGTAACCCCATCCAGCCTCCCTCCTTTGGGAT 121386 Query 2518 AGGTGTGTGCGTCTGACTTGGGCCTCCAGGGTGTGTACAGTCAGTGTGGGTTTTGTGGAG 2577 |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 121387 AGGTGTATGCGTCTGACTTGGGCCTCCAGGGTGTGTACAGTCAGTGTGGGTTTTGTGGAG 121446 Query 2578 GCAATAAGACTGAAGCAGTAGACAATCCCCAATACCATTTGCAGGTCTGGAACTGCACTC 2637 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 121447 GCAATAAGACTGAAGCAGTAGACAATCCCCAATACCATTTGCAGGTCTGGAACTGCACTC 121506 Query 2638 TCTTTTTTAAAAAACATGTATACATTTTAGGGCTGTAGATTTATTTTCCTGGTTTTGTTT 2697 |||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||| Sbjct 121507 TCTTTTTTAAAAAACATGTATACATTTTAGGGCTATAGATTTATTTTCCTGTTTTTGTTT 121566 Query 2698 TTCATTGCTGACTTTTGAGCACAGAATTATGATAATCAATTACATTTATACATCACCTCG 2757 |||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||| Sbjct 121567 TTCATTACTGACTTTTGAGCACAGAATTATGATAATCAACTACATTTATACATCACCTCG 121626 Query 2758 ATGACTTTTCCAAACTTTTAtttttttttttAAACAACTGTTGGGATTTTACTCCCTGGC 2817 ||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||| Sbjct 121627 ATGACTTTTCCAAACTTTT-TTTTTTTTTT-AAACAACTGTTGGGATTTTACTCCCTGGC 121684 Query 2818 CTTAACTAGGACAGGATTGTACCCCACTCCTccccccccccTTTTT-CTTTTTCGCCAAG 2876 ||||||||||||||| |||||||||||||||||| ||||||||||| ||||||||||||| Sbjct 121685 CTTAACTAGGACAGGGTTGTACCCCACTCCTCCCTCCCCCCTTTTTTCTTTTTCGCCAAG 121744 Query 2877 ACAACTGAGCAGAAATTTGGCTGAGCAGTGTTGTGGGACTATGATGTGATAGTTTTAGAT 2936 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 121745 ACAACTGAGCAGAAATTTGGCTGAGCAGTGTTGTGGGACTATGATGTGATAGTTTTAGAT 121804 Query 2937 CCTACCTTCTGCTTTCGGGCAGCTGCAGCCAGCACAGAAACCTTGCAAGCTCACTCTGTG 2996 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 121805 CCTACCTTCTGCTTTCGGGCAGCTGCAGCCAGCACAGAAACCTTGCAAGCTCACTCTGTA 121864 Query 2997 TGTAGGCTTTCTGGACAAGGAATGGTCGCCAAATTTTTGGTTTGGATGTCTTATACCAAA 3056 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 121865 TGTAGGCTTTCTGGACAAGGAATGGTCGCCAAATTTTTGGTTTGGATGTCTTATACCAAA 121924 Query 3057 GGGAAATAGTCTTCATTAAAGTTCGTATTTCTTTTAAAAAAAAAAAAAAAA 3107 ||||||||| |||||||||||||||||||||||| |||||||||||||||| Sbjct 121925 GGGAAATAGCCTTCATTAAAGTTCGTATTTCTTT-AAAAAAAAAAAAAAAA 121974 Score = 58.4 bits (31), Expect = 2e-04 Identities = 31/31 (100%), Gaps = 0/31 (0%) Strand=Plus/Plus Query 14 CTGGGGTGAAAGTTGGGGCGGTGACTTAAGC 44 ||||||||||||||||||||||||||||||| Sbjct 119429 CTGGGGTGAAAGTTGGGGCGGTGACTTAAGC 119459 >ref|XR_002567.1| Gene info PREDICTED: Mus musculus similar to src homology 2 domain-containing transforming protein C (LOC669542), mRNA Length=2709 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 4338 bits (2349), Expect = 0.0 Identities = 2463/2516 (97%), Gaps = 16/2516 (0%) Strand=Plus/Plus Query 599 TATGTTGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCATATCCTGGAGTGT 658 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 193 TATGTTGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCATATCCTGGAGTGT 252 Query 659 CCTGAAGGGCTTGCTCAGGATGTCATCAGCACCATCGGGCAGGCCTTTGAGTTGCGCTTC 718 ||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct 253 CCTGAAGGGTTTGCTCAGGATGTCATCAGCACCATCGGGCAGGCCTTTGAGTTGTGCTTC 312 Query 719 AAACAGTATCTCAGGAATCCACCGAAGCTGGTCACCCCCCATGACAGGATGGCTGGCTTT 778 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 313 AAACAGTATCTCAGGAATCCACCGAAGCTGGTCACCCCCCATGACAGGATGGCTGGCTTT 372 Query 779 GATGGCTCAGCTTGGGATGAGGAGGAAGAAGAGCCCCCTGACCATCAGTACTACAATGAC 838 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 373 GATGGCTCAGCTTGGGATGAGGAGGAAGAAGAGCCCCCTGACCATCAGTACTACAATGAC 432 Query 839 TTTCCAGGGAAGGAACCCCCTC-TTGGTGGGGTGGTAGATATGAGGCTTCGGGAAGGGGC 897 |||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||| Sbjct 433 TTTCCAGGGAAGGAACCCCCTCTTTGGTGGGGTGGTAGATATGAGGCCTCGGGAAGGGGC 492 Query 898 TGCTCGACCCACTCTGC-CTAGTGCCCAGATGTCCAG-CCACTTGGGAGCTACACTGCCT 955 ||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||| Sbjct 493 TGCTCGACCCACTCTGCTCTAGTGCCCAGATGTCCAGCCCACTTGGGAGCTACACTGCCT 552 Query 956 ATAGGGCAGCATGCTGCAGGAGACCATGAAGTCCGTAAACAGATGTTGCCTCCGCCGCCT 1015 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | Sbjct 553 ATAGGGCAGCATGCTGCAGGAGACCATGAAGTCCGTAAACAGATGTTGCCTCCGCCACGT 612 Query 1016 TGCCCAGGCAGAGAACTCTTCGATGACCCCTCCTATGTCAACATCCAGAATCTAGACAAG 1075 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 613 TGCCCAGGCAGAGAACTCTTCGATGACCCCTCCTATGTCAACATCCAGAATCTAGACAAG 672 Query 1076 GCCCGGCAGGCTGGGGGTGGGGCTGGGCCCCCAAATCCTTCTCTTAATGGCAGTGCACCC 1135 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 673 GCCCGGCAGGCTGGGGGTGGGGCTGGGCCCCCAAATCCTTCTCTTAATGGCAGTGCACCC 732 Query 1136 CGAGACCTTTTTGACATGAAGCCCTTTGAAGATGCACTTCGGGTGCCACCCCCACCGCAG 1195 ||||||||||||||||||||||||||||||||| |||||||||||||| |||||| |||| Sbjct 733 CGAGACCTTTTTGACATGAAGCCCTTTGAAGATACACTTCGGGTGCCATCCCCACTGCAG 792 Query 1196 TCCATGTCCATGGCTGAGCAGCTGCAAGGGGAGCCCTGGTTCCACGGGAAGCTGAGCCGG 1255 ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 793 TCCATGTTCATGGCTGAGCAGCTGCAAGGGGAGCCCTGGTTCCACGGGAAGCTGAGCCGG 852 Query 1256 AGGGAGGCCGAG-GCGCTGCTGCAGCTCAATGGTGACTTCTTGGTGCGAGAGAGCACGAC 1314 ||||||||| || || |||||||||||||||||||||||||||||||||||||||||||| Sbjct 853 AGGGAGGCCAAGCGCACTGCTGCAGCTCAATGGTGACTTCTTGGTGCGAGAGAGCACGAC 912 Query 1315 CACGCCTGGCCAGTATGTGCTCACTGGCCTGCAGAGTGGGCAGCCCAAGCACTTGCTGCT 1374 ||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||| Sbjct 913 CACACCTGGCCAGTATGTGCTCACTGACCTGCAGAGTGGGCAGCCCAAGCACTTGCTGCT 972 Query 1375 GGTGGACCCTGAAGGTGTGGTTCGGACAAAGGATCACCGCTTTGAGAGTGTCAGTCACCT 1434 ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| Sbjct 973 GGTGGACCCTGAAGGTGTGGTTCGGACAAAGGATCACTGCTTTGAGAGTGTCAGTCACCT 1032 Query 1435 GATCAGCTACCACATGGACAATCACTTGCCCATCATCTCTGCGGGCAGCGAACTGTGCCT 1494 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1033 GATCAGCTACCACATGGACAATCACTTGCCCATCATCTCTGCGGGCAGCGAACTGTGCCT 1092 Query 1495 ACAGCAACCCGTGGATCGGAAAGTGTGATCCTTCTCAGCTTCTCCAACAGGATGCTCTCC 1554 ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| | Sbjct 1093 ACAGCAACCCGTGGATCGGAAAGTGTGATCCTTCTCAGCTTCTCCAACAAGATGCTCTTC 1152 Query 1555 ATTTCCGTCTCCCGTATTCTCTAACTTGTGGGACCTCTGTTTTGTGGGTCTGGCCTTGGG 1614 ||| |||| |||| |||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1153 ATTCCCGTTTCCCATATTCTCTAACTTGTGGGACCTCTGTTTTGTGGGTCTGGCCTTGGG 1212 Query 1615 TGGGAACTGGGAGCAACGAGGACATGGGTTTAGTGCCCACTTGAGAGAGAGAAAAAGAGG 1674 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1213 TGGGAACTGGGAGCAACGAGGACATGGGTTTAGTGCCCACTTGAGAGAGAGAAAAAGAGG 1272 Query 1675 GTTTCAGTAAGGAGCCTGGGGTAGCATCCTGCCTCTGGCCAAACTTCACCAAAGTATTAA 1734 ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| Sbjct 1273 GTTTCAGTAAGGAGCCTGGGGTAGCATCCTGCCTCTGCCCAAACTTCACCAAAGTATTAA 1332 Query 1735 TGTGCAGAGTGGTCCCTTGTCTGGGCCTTGCCTGTGCCAACCTGATGCCCTTcccccccA 1794 | |||||||||||||||||||||||||| |||||||||||||||||||| |||||||| | Sbjct 1333 TATGCAGAGTGGTCCCTTGTCTGGGCCT-GCCTGTGCCAACCTGATGCCGTTCCCCCC-A 1390 Query 1795 AAGGGTGGGTTCTTATAATGGAAAATGCCCTGTGATGATAGGCCCAGTGGAGCAACTGCC 1854 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1391 AAGGGTGGGTTCTTATAATGGAAAATGCCCTGTGATGATAGGCCCAGTGGAGCAACTGCC 1450 Query 1855 CTTTGGGGGAAGGGAAATAATTATACCTCTGGTTTACTCCTGGGTCTTCAGGGTACCCCA 1914 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1451 CTTTGGGGGAAGGGAAATAATTATACCTCTGGTTTACTCCTGGGTCTTCAGGGTACCCCA 1510 Query 1915 GATCCCGC-ATAACATATCCCACTCCCTCTGCTTCCCCTTAAACTTTGTGCCTTTGACTA 1973 |||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1511 GATCCCGCGA-AACATATCCCACTCCCTCTGCTTCCCCTTAAACTTTGTGCCTTTGACTA 1569 Query 1974 TCATAGGTCTGCAGATACTTAATGCAGAGTTCTCAGGCCCTTCACGTGTGGACAGGGGTT 2033 |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| Sbjct 1570 TCATAGGTCTGCAGATACTTAATGCAGAGTTCTCAGGCTCTTCACGTGTGGACAGGGGTT 1629 Query 2034 ACTGCCACCTTGGCTTCTGGAGCCCTGTCCTATTCAGCACCCCTTCCTGTGTCTAGGGAG 2093 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1630 ACTGCCACCTTGGCTTCTGGAGCCCTGTCCTATTCAGCACCCCTTCCTGTGTCTAGGGAG 1689 Query 2094 AATAGGGACAGGAGTGGCCGCTATCTGCTCTGCCTTTCGGATGTGCAGCCCTTAAGAGAT 2153 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1690 AATAGGGACAGGAGTGGCCGCTATCTGCTCTGCCTTTCGGATGTGCAGCCCTTAAGAGAT 1749 Query 2154 TGCCCCAAGCCTGAATATGGTGGCGCACGCC-TTTAATCACAGCACTCAGGAGGCAGAGA 2212 ||||||||||| |||||||||||| |||||| |||||||||||||||||||||||||||| Sbjct 1750 TGCCCCAAGCCAGAATATGGTGGCACACGCCCTTTAATCACAGCACTCAGGAGGCAGAGA 1809 Query 2213 CAGGAGGAATTGTGAGGCCATCCGATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCT 2272 |||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| Sbjct 1810 CAGGAGGATTTGTGAGGCCATCCCATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCT 1869 Query 2273 ATGGAGAGAGAACCTGTCTCCAAAAACCAAAAAGAGCGATTACCCCAGAGCCTTCTTCCT 2332 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1870 ATGGAGAGAGAACCTGTCTCCAAAAACCAAAAAGAGCGATTACCCCAGAGCCTTCTTCCT 1929 Query 2333 GATGGTAGCGGGGAGGGGCAGGACTGGACCCATCTTGCTCAGTGCCTCCTGACCTCAATG 2392 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1930 GATGGTAGCGGGGAGGGGCAGGACTGGACCCATCTTGCTCAGTGCCTCCTGACCTCAATG 1989 Query 2393 CCTTTCCTCCAAGGGGTCTGTATACATTTCTCAAGCCTGCTCCTCCCATGTTTGCATGTG 2452 ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1990 CCTTTCC---AAGGGGTCTGTATACATTTCTCAAGCCTGCTCCTCCCATGTTTGCATGTG 2046 Query 2453 TGTTATAGTCTACAGCCAAAGTATAGCCCTCACTGTAACCCCATCCTGCCTCCCTCCTTT 2512 |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct 2047 TGTTATAGTCTACAGCCAAAGTATAGCCCTCACTGTAACCCCATCCAGCCTCCCTCCTTT 2106 Query 2513 GGGATAGGTGTGTGCGTCTGACTTGGGCCTCCAGGGTGTGTACAGTCAGTGTGGGTTTTG 2572 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2107 GGGATAGGTGTATGCGTCTGACTTGGGCCTCCAGGGTGTGTACAGTCAGTGTGGGTTTTG 2166 Query 2573 TGGAGGCAATAAGACTGAAGCAGTAGACAATCCCCAATACCATTTGCAGGTCTGGAACTG 2632 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2167 TGGAGGCAATAAGACTGAAGCAGTAGACAATCCCCAATACCATTTGCAGGTCTGGAACTG 2226 Query 2633 CACTCTCTTTTTTAAAAAACATGTATACATTTTAGGGCTGTAGATTTATTTTCCTGGTTT 2692 ||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||| Sbjct 2227 CACTCTCTTTTTTAAAAAACATGTATACATTTTAGGGCTATAGATTTATTTTCCTGTTTT 2286 Query 2693 TGTTTTTCATTGCTGACTTTTGAGCACAGAATTATGATAATCAATTACATTTATACATCA 2752 ||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct 2287 TGTTTTTCATTACTGACTTTTGAGCACAGAATTATGATAATCAACTACATTTATACATCA 2346 Query 2753 CCTCGATGACTTTTCCAAACTTTTAtttttttttttAAACAACTGTTGGGATTTTACTCC 2812 |||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||| Sbjct 2347 CCTCGATGACTTTTCCAAACTTTT-TTTTTTTTTT-AAACAACTGTTGGGATTTTACTCC 2404 Query 2813 CTGGCCTTAACTAGGACAGGATTGTACCCCACTCCTccccccccccTTTTT-CTTTTTCG 2871 |||||||||||||||||||| |||||||||||||||||| ||||||||||| |||||||| Sbjct 2405 CTGGCCTTAACTAGGACAGGGTTGTACCCCACTCCTCCCTCCCCCCTTTTTTCTTTTTCG 2464 Query 2872 CCAAGACAACTGAGCAGAAATTTGGCTGAGCAGTGTTGTGGGACTATGATGTGATAGTTT 2931 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2465 CCAAGACAACTGAGCAGAAATTTGGCTGAGCAGTGTTGTGGGACTATGATGTGATAGTTT 2524 Query 2932 TAGATCCTACCTTCTGCTTTCGGGCAGCTGCAGCCAGCACAGAAACCTTGCAAGCTCACT 2991 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2525 TAGATCCTACCTTCTGCTTTCGGGCAGCTGCAGCCAGCACAGAAACCTTGCAAGCTCACT 2584 Query 2992 CTGTGTGTAGGCTTTCTGGACAAGGAATGGTCGCCAAATTTTTGGTTTGGATGTCTTATA 3051 |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2585 CTGTATGTAGGCTTTCTGGACAAGGAATGGTCGCCAAATTTTTGGTTTGGATGTCTTATA 2644 Query 3052 CCAAAGGGAAATAGTCTTCATTAAAGTTCGTATTTCTTTTAAAAAAAAAAAAAAAA 3107 |||||||||||||| |||||||||||||||||||||||| |||||||||||||||| Sbjct 2645 CCAAAGGGAAATAGCCTTCATTAAAGTTCGTATTTCTTT-AAAAAAAAAAAAAAAA 2699 Score = 318 bits (172), Expect = 7e-83 Identities = 176/178 (98%), Gaps = 0/178 (0%) Strand=Plus/Plus Query 1995 ATGCAGAGTTCTCAGGCCCTTCACGTGTGGACAGGGGTTACTGCCACCTTGGCTTCTGGA 2054 ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Sbjct 1 ATGCAGAGTTCTCAGGCTCTTCACGTGTGGACAGGGGTTACTGCCACCTTGGCTTCTGGA 60 Query 2055 GCCCTGTCCTATTCAGCACCCCTTCCTGTGTCTAGGGAGAATAGGGACAGGAGTGGCCGC 2114 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 61 GCCCTGTCCTATTCAGCACCCCTTCCTGTGTCTAGGGAGAATAGGGACAGGAGTGGCCGC 120 Query 2115 TATCTGCTCTGCCTTTCGGATGTGCAGCCCTTAAGAGATTGCCCCAAGCCTGAATATG 2172 |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| Sbjct 121 TATCTGCTCTGCCTTTCGGATGTGCAGCCCTTAAGAGATTGCCCCAAGCCAGAATATG 178 >dbj|AK155158.1| UniGene infoGene info Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN full-length enriched library, clone:F630204K04 product:src homology 2 domain-containing transforming protein C1, full insert sequence Length=2619 Score = 3814 bits (2065), Expect = 0.0 Identities = 2067/2068 (99%), Gaps = 0/2068 (0%) Strand=Plus/Plus Query 109 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCT 168 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 552 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCT 611 Query 169 GGGGGGCGAGGAGTGGACCAGACACGGGAGCTTTGTCAATAAGCCCACACGAGGCTGGCT 228 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 612 GGGGGGCGAGGAGTGGACCAGACACGGGAGCTTTGTCAATAAGCCCACACGAGGCTGGCT 671 Query 229 GCATCCCAACGACAAAGTCATGGGACCTGGGGTTTCCTACTTGGTTCGGTACATGGGCTG 288 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 672 GCATCCCAACGACAAAGTCATGGGACCTGGGGTTTCCTACTTGGTTCGGTACATGGGCTG 731 Query 289 TGTGGAGGTCTTACAGTCAATGCGAGCCCTTGACTTCAATACCCGGACTCAGGTCACCAG 348 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 732 TGTGGAGGTCTTACAGTCAATGCGAGCCCTTGACTTCAATACCCGGACTCAGGTCACCAG 791 Query 349 GGAGGCCATCAGTTTGGTGTGTGAAGCTGTGCCTGGTGCCAAAGGGGCGACAAGGAGGAG 408 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 792 GGAGGCCATCAGTTTGGTGTGTGAAGCTGTGCCTGGTGCCAAAGGGGCGACAAGGAGGAG 851 Query 409 AAAGCCTTGTAGCCGCCCACTCAGCTCCATCCTGGGGAGGAGTAACCTGAAGTTTGCTGG 468 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 852 AAAGCCTTGTAGCCGCCCACTCAGCTCCATCCTGGGGAGGAGTAACCTGAAGTTTGCTGG 911 Query 469 AATGCCAATCACTCTCACTGTGTCTACCAGCAGCCTTAACCTCATGGCAGCCGACTGCAA 528 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 912 AATGCCAATCACTCTCACTGTGTCTACCAGCAGCCTTAACCTCATGGCAGCCGACTGCAA 971 Query 529 ACAGATCATTGCCAACCATCACATGCAATCTATCTCTTTCGCGTCCGGTGGGGATCCGGA 588 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 972 ACAGATCATTGCCAACCATCACATGCAATCTATCTCTTTCGCGTCCGGTGGGGATCCGGA 1031 Query 589 CACAGCTGAGTATGTTGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCATAT 648 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1032 CACAGCTGAGTATGTTGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCATAT 1091 Query 649 CCTGGAGTGTCCTGAAGGGCTTGCTCAGGATGTCATCAGCACCATCGGGCAGGCCTTTGA 708 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1092 CCTGGAGTGTCCTGAAGGGCTTGCTCAGGATGTCATCAGCACCATCGGGCAGGCCTTTGA 1151 Query 709 GTTGCGCTTCAAACAGTATCTCAGGAATCCACCGAAGCTGGTCACCCCCCATGACAGGAT 768 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1152 GTTGCGCTTCAAACAGTATCTCAGGAATCCACCGAAGCTGGTCACCCCCCATGACAGGAT 1211 Query 769 GGCTGGCTTTGATGGCTCAGCTTGGGATGAGGAGGAAGAAGAGCCCCCTGACCATCAGTA 828 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1212 GGCTGGCTTTGATGGCTCAGCTTGGGATGAGGAGGAAGAAGAGCCCCCTGACCATCAGTA 1271 Query 829 CTACAATGACTTTCCAGGGAAGGAACCCCCTCTTGGTGGGGTGGTAGATATGAGGCTTCG 888 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1272 CTACAATGACTTTCCAGGGAAGGAACCCCCTCTTGGTGGGGTGGTAGATATGAGGCTTCG 1331 Query 889 GGAAGGGGCTGCTCGACCCACTCTGCCTAGTGCCCAGATGTCCAGCCACTTGGGAGCTAC 948 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1332 GGAAGGGGCTGCTCGACCCACTCTGCCTAGTGCCCAGATGTCCAGCCACTTGGGAGCTAC 1391 Query 949 ACTGCCTATAGGGCAGCATGCTGCAGGAGACCATGAAGTCCGTAAACAGATGTTGCCTCC 1008 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1392 ACTGCCTATAGGGCAGCATGCTGCAGGAGACCATGAAGTCCGTAAACAGATGTTGCCTCC 1451 Query 1009 GCCGCCTTGCCCAGGCAGAGAACTCTTCGATGACCCCTCCTATGTCAACATCCAGAATCT 1068 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1452 GCCGCCTTGCCCAGGCAGAGAACTCTTCGATGACCCCTCCTATGTCAACATCCAGAATCT 1511 Query 1069 AGACAAGGCCCGGCAGGCTGGGGGTGGGGCTGGGCCCCCAAATCCTTCTCTTAATGGCAG 1128 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1512 AGACAAGGCCCGGCAGGCTGGGGGTGGGGCTGGGCCCCCAAATCCTTCTCTTAATGGCAG 1571 Query 1129 TGCACCCCGAGACCTTTTTGACATGAAGCCCTTTGAAGATGCACTTCGGGTGCCACCCCC 1188 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1572 TGCACCCCGAGACCTTTTTGACATGAAGCCCTTTGAAGATGCACTTCGGGTGCCACCCCC 1631 Query 1189 ACCGCAGTCCATGTCCATGGCTGAGCAGCTGCAAGGGGAGCCCTGGTTCCACGGGAAGCT 1248 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1632 ACCGCAGTCCATGTCCATGGCTGAGCAGCTGCAAGGGGAGCCCTGGTTCCACGGGAAGCT 1691 Query 1249 GAGCCGGAGGGAGGCCGAGGCGCTGCTGCAGCTCAATGGTGACTTCTTGGTGCGAGAGAG 1308 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1692 GAGCCGGAGGGAGGCCGAGGCGCTGCTGCAGCTCAATGGTGACTTCTTGGTGCGAGAGAG 1751 Query 1309 CACGACCACGCCTGGCCAGTATGTGCTCACTGGCCTGCAGAGTGGGCAGCCCAAGCACTT 1368 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1752 CACGACCACGCCTGGCCAGTATGTGCTCACTGGCCTGCAGAGTGGGCAGCCCAAGCACTT 1811 Query 1369 GCTGCTGGTGGACCCTGAAGGTGTGGTTCGGACAAAGGATCACCGCTTTGAGAGTGTCAG 1428 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1812 GCTGCTGGTGGACCCTGAAGGTGTGGTTCGGACAAAGGATCACCGCTTTGAGAGTGTCAG 1871 Query 1429 TCACCTGATCAGCTACCACATGGACAATCACTTGCCCATCATCTCTGCGGGCAGCGAACT 1488 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1872 TCACCTGATCAGCTACCACATGGACAATCACTTGCCCATCATCTCTGCGGGCAGCGAACT 1931 Query 1489 GTGCCTACAGCAACCCGTGGATCGGAAAGTGTGATCCTTCTCAGCTTCTCCAACAGGATG 1548 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1932 GTGCCTACAGCAACCCGTGGATCGGAAAGTGTGATCCTTCTCAGCTTCTCCAACAGGATG 1991 Query 1549 CTCTCCATTTCCGTCTCCCGTATTCTCTAACTTGTGGGACCTCTGTTTTGTGGGTCTGGC 1608 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1992 CTCTCCATTTCCGTCTCCCGTATTCTCTAACTTGTGGGACCTCTGTTTTGTGGGTCTGGC 2051 Query 1609 CTTGGGTGGGAACTGGGAGCAACGAGGACATGGGTTTAGTGCCCACTTGAGAGAGAGAAA 1668 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2052 CTTGGGTGGGAACTGGGAGCAACGAGGACATGGGTTTAGTGCCCACTTGAGAGAGAGAAA 2111 Query 1669 AAGAGGGTTTCAGTAAGGAGCCTGGGGTAGCATCCTGCCTCTGGCCAAACTTCACCAAAG 1728 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2112 AAGAGGGTTTCAGTAAGGAGCCTGGGGTAGCATCCTGCCTCTGGCCAAACTTCACCAAAG 2171 Query 1729 TATTAATGTGCAGAGTGGTCCCTTGTCTGGGCCTTGCCTGTGCCAACCTGATGCCCTTcc 1788 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2172 TATTAATGTGCAGAGTGGTCCCTTGTCTGGGCCTTGCCTGTGCCAACCTGATGCCCTTCC 2231 Query 1789 cccccAAAGGGTGGGTTCTTATAATGGAAAATGCCCTGTGATGATAGGCCCAGTGGAGCA 1848 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2232 CCCCCAAAGGGTGGGTTCTTATAATGGAAAATGCCCTGTGATGATAGGCCCAGTGGAGCA 2291 Query 1849 ACTGCCCTTTGGGGGAAGGGAAATAATTATACCTCTGGTTTACTCCTGGGTCTTCAGGGT 1908 |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| Sbjct 2292 ACTGCCCTTTGGGGGAAGAGAAATAATTATACCTCTGGTTTACTCCTGGGTCTTCAGGGT 2351 Query 1909 ACCCCAGATCCCGCATAACATATCCCACTCCCTCTGCTTCCCCTTAAACTTTGTGCCTTT 1968 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2352 ACCCCAGATCCCGCATAACATATCCCACTCCCTCTGCTTCCCCTTAAACTTTGTGCCTTT 2411 Query 1969 GACTATCATAGGTCTGCAGATACTTAATGCAGAGTTCTCAGGCCCTTCACGTGTGGACAG 2028 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2412 GACTATCATAGGTCTGCAGATACTTAATGCAGAGTTCTCAGGCCCTTCACGTGTGGACAG 2471 Query 2029 GGGTTACTGCCACCTTGGCTTCTGGAGCCCTGTCCTATTCAGCACCCCTTCCTGTGTCTA 2088 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2472 GGGTTACTGCCACCTTGGCTTCTGGAGCCCTGTCCTATTCAGCACCCCTTCCTGTGTCTA 2531 Query 2089 GGGAGAATAGGGACAGGAGTGGCCGCTATCTGCTCTGCCTTTCGGATGTGCAGCCCTTAA 2148 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2532 GGGAGAATAGGGACAGGAGTGGCCGCTATCTGCTCTGCCTTTCGGATGTGCAGCCCTTAA 2591 Query 2149 GAGATTGCCCCAAGCCTGAATATGGTGG 2176 |||||||||||||||||||||||||||| Sbjct 2592 GAGATTGCCCCAAGCCTGAATATGGTGG 2619 >gb|AC121079.20| GeoDownload subject sequence spanning the HSP Mus musculus chromosome 3, clone RP24-178P12, complete sequence Length=177802 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 3140 bits (1700), Expect = 0.0 Identities = 1700/1700 (100%), Gaps = 0/1700 (0%) Strand=Plus/Plus Query 1393 GGTTCGGACAAAGGATCACCGCTTTGAGAGTGTCAGTCACCTGATCAGCTACCACATGGA 1452 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 82400 GGTTCGGACAAAGGATCACCGCTTTGAGAGTGTCAGTCACCTGATCAGCTACCACATGGA 82459 Query 1453 CAATCACTTGCCCATCATCTCTGCGGGCAGCGAACTGTGCCTACAGCAACCCGTGGATCG 1512 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 82460 CAATCACTTGCCCATCATCTCTGCGGGCAGCGAACTGTGCCTACAGCAACCCGTGGATCG 82519 Query 1513 GAAAGTGTGATCCTTCTCAGCTTCTCCAACAGGATGCTCTCCATTTCCGTCTCCCGTATT 1572 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 82520 GAAAGTGTGATCCTTCTCAGCTTCTCCAACAGGATGCTCTCCATTTCCGTCTCCCGTATT 82579 Query 1573 CTCTAACTTGTGGGACCTCTGTTTTGTGGGTCTGGCCTTGGGTGGGAACTGGGAGCAACG 1632 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 82580 CTCTAACTTGTGGGACCTCTGTTTTGTGGGTCTGGCCTTGGGTGGGAACTGGGAGCAACG 82639 Query 1633 AGGACATGGGTTTAGTGCCCACTTGAGAGAGAGAAAAAGAGGGTTTCAGTAAGGAGCCTG 1692 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 82640 AGGACATGGGTTTAGTGCCCACTTGAGAGAGAGAAAAAGAGGGTTTCAGTAAGGAGCCTG 82699 Query 1693 GGGTAGCATCCTGCCTCTGGCCAAACTTCACCAAAGTATTAATGTGCAGAGTGGTCCCTT 1752 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 82700 GGGTAGCATCCTGCCTCTGGCCAAACTTCACCAAAGTATTAATGTGCAGAGTGGTCCCTT 82759 Query 1753 GTCTGGGCCTTGCCTGTGCCAACCTGATGCCCTTcccccccAAAGGGTGGGTTCTTATAA 1812 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 82760 GTCTGGGCCTTGCCTGTGCCAACCTGATGCCCTTCCCCCCCAAAGGGTGGGTTCTTATAA 82819 Query 1813 TGGAAAATGCCCTGTGATGATAGGCCCAGTGGAGCAACTGCCCTTTGGGGGAAGGGAAAT 1872 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 82820 TGGAAAATGCCCTGTGATGATAGGCCCAGTGGAGCAACTGCCCTTTGGGGGAAGGGAAAT 82879 Query 1873 AATTATACCTCTGGTTTACTCCTGGGTCTTCAGGGTACCCCAGATCCCGCATAACATATC 1932 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 82880 AATTATACCTCTGGTTTACTCCTGGGTCTTCAGGGTACCCCAGATCCCGCATAACATATC 82939 Query 1933 CCACTCCCTCTGCTTCCCCTTAAACTTTGTGCCTTTGACTATCATAGGTCTGCAGATACT 1992 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 82940 CCACTCCCTCTGCTTCCCCTTAAACTTTGTGCCTTTGACTATCATAGGTCTGCAGATACT 82999 Query 1993 TAATGCAGAGTTCTCAGGCCCTTCACGTGTGGACAGGGGTTACTGCCACCTTGGCTTCTG 2052 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 83000 TAATGCAGAGTTCTCAGGCCCTTCACGTGTGGACAGGGGTTACTGCCACCTTGGCTTCTG 83059 Query 2053 GAGCCCTGTCCTATTCAGCACCCCTTCCTGTGTCTAGGGAGAATAGGGACAGGAGTGGCC 2112 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 83060 GAGCCCTGTCCTATTCAGCACCCCTTCCTGTGTCTAGGGAGAATAGGGACAGGAGTGGCC 83119 Query 2113 GCTATCTGCTCTGCCTTTCGGATGTGCAGCCCTTAAGAGATTGCCCCAAGCCTGAATATG 2172 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 83120 GCTATCTGCTCTGCCTTTCGGATGTGCAGCCCTTAAGAGATTGCCCCAAGCCTGAATATG 83179 Query 2173 GTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGAATTGTGAGGCCA 2232 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 83180 GTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGAATTGTGAGGCCA 83239 Query 2233 TCCGATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAACCTGTCTC 2292 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 83240 TCCGATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAACCTGTCTC 83299 Query 2293 CAAAAACCAAAAAGAGCGATTACCCCAGAGCCTTCTTCCTGATGGTAGCGGGGAGGGGCA 2352 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 83300 CAAAAACCAAAAAGAGCGATTACCCCAGAGCCTTCTTCCTGATGGTAGCGGGGAGGGGCA 83359 Query 2353 GGACTGGACCCATCTTGCTCAGTGCCTCCTGACCTCAATGCCTTTCCTCCAAGGGGTCTG 2412 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 83360 GGACTGGACCCATCTTGCTCAGTGCCTCCTGACCTCAATGCCTTTCCTCCAAGGGGTCTG 83419 Query 2413 TATACATTTCTCAAGCCTGCTCCTCCCATGTTTGCATGTGTGTTATAGTCTACAGCCAAA 2472 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 83420 TATACATTTCTCAAGCCTGCTCCTCCCATGTTTGCATGTGTGTTATAGTCTACAGCCAAA 83479 Query 2473 GTATAGCCCTCACTGTAACCCCATCCTGCCTCCCTCCTTTGGGATAGGTGTGTGCGTCTG 2532 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 83480 GTATAGCCCTCACTGTAACCCCATCCTGCCTCCCTCCTTTGGGATAGGTGTGTGCGTCTG 83539 Query 2533 ACTTGGGCCTCCAGGGTGTGTACAGTCAGTGTGGGTTTTGTGGAGGCAATAAGACTGAAG 2592 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 83540 ACTTGGGCCTCCAGGGTGTGTACAGTCAGTGTGGGTTTTGTGGAGGCAATAAGACTGAAG 83599 Query 2593 CAGTAGACAATCCCCAATACCATTTGCAGGTCTGGAACTGCACTCTCTTTTTTAAAAAAC 2652 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 83600 CAGTAGACAATCCCCAATACCATTTGCAGGTCTGGAACTGCACTCTCTTTTTTAAAAAAC 83659 Query 2653 ATGTATACATTTTAGGGCTGTAGATTTATTTTCCTGGTTTTGTTTTTCATTGCTGACTTT 2712 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 83660 ATGTATACATTTTAGGGCTGTAGATTTATTTTCCTGGTTTTGTTTTTCATTGCTGACTTT 83719 Query 2713 TGAGCACAGAATTATGATAATCAATTACATTTATACATCACCTCGATGACTTTTCCAAAC 2772 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 83720 TGAGCACAGAATTATGATAATCAATTACATTTATACATCACCTCGATGACTTTTCCAAAC 83779 Query 2773 TTTTAtttttttttttAAACAACTGTTGGGATTTTACTCCCTGGCCTTAACTAGGACAGG 2832 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 83780 TTTTATTTTTTTTTTTAAACAACTGTTGGGATTTTACTCCCTGGCCTTAACTAGGACAGG 83839 Query 2833 ATTGTACCCCACTCCTccccccccccTTTTTCTTTTTCGCCAAGACAACTGAGCAGAAAT 2892 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 83840 ATTGTACCCCACTCCTCCCCCCCCCCTTTTTCTTTTTCGCCAAGACAACTGAGCAGAAAT 83899 Query 2893 TTGGCTGAGCAGTGTTGTGGGACTATGATGTGATAGTTTTAGATCCTACCTTCTGCTTTC 2952 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 83900 TTGGCTGAGCAGTGTTGTGGGACTATGATGTGATAGTTTTAGATCCTACCTTCTGCTTTC 83959 Query 2953 GGGCAGCTGCAGCCAGCACAGAAACCTTGCAAGCTCACTCTGTGTGTAGGCTTTCTGGAC 3012 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 83960 GGGCAGCTGCAGCCAGCACAGAAACCTTGCAAGCTCACTCTGTGTGTAGGCTTTCTGGAC 84019 Query 3013 AAGGAATGGTCGCCAAATTTTTGGTTTGGATGTCTTATACCAAAGGGAAATAGTCTTCAT 3072 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 84020 AAGGAATGGTCGCCAAATTTTTGGTTTGGATGTCTTATACCAAAGGGAAATAGTCTTCAT 84079 Query 3073 TAAAGTTCGTATTTCTTTTA 3092 |||||||||||||||||||| Sbjct 84080 TAAAGTTCGTATTTCTTTTA 84099 Score = 446 bits (241), Expect = 3e-121 Identities = 241/241 (100%), Gaps = 0/241 (0%) Strand=Plus/Plus Query 1155 AGCCCTTTGAAGATGCACTTCGGGTGCCACCCCCACCGCAGTCCATGTCCATGGCTGAGC 1214 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 81292 AGCCCTTTGAAGATGCACTTCGGGTGCCACCCCCACCGCAGTCCATGTCCATGGCTGAGC 81351 Query 1215 AGCTGCAAGGGGAGCCCTGGTTCCACGGGAAGCTGAGCCGGAGGGAGGCCGAGGCGCTGC 1274 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 81352 AGCTGCAAGGGGAGCCCTGGTTCCACGGGAAGCTGAGCCGGAGGGAGGCCGAGGCGCTGC 81411 Query 1275 TGCAGCTCAATGGTGACTTCTTGGTGCGAGAGAGCACGACCACGCCTGGCCAGTATGTGC 1334 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 81412 TGCAGCTCAATGGTGACTTCTTGGTGCGAGAGAGCACGACCACGCCTGGCCAGTATGTGC 81471 Query 1335 TCACTGGCCTGCAGAGTGGGCAGCCCAAGCACTTGCTGCTGGTGGACCCTGAAGGTGTGG 1394 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 81472 TCACTGGCCTGCAGAGTGGGCAGCCCAAGCACTTGCTGCTGGTGGACCCTGAAGGTGTGG 81531 Query 1395 T 1395 | Sbjct 81532 T 81532 Score = 351 bits (190), Expect = 7e-93 Identities = 190/190 (100%), Gaps = 0/190 (0%) Strand=Plus/Plus Query 763 CAGGATGGCTGGCTTTGATGGCTCAGCTTGGGATGAGGAGGAAGAAGAGCCCCCTGACCA 822 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 80596 CAGGATGGCTGGCTTTGATGGCTCAGCTTGGGATGAGGAGGAAGAAGAGCCCCCTGACCA 80655 Query 823 TCAGTACTACAATGACTTTCCAGGGAAGGAACCCCCTCTTGGTGGGGTGGTAGATATGAG 882 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 80656 TCAGTACTACAATGACTTTCCAGGGAAGGAACCCCCTCTTGGTGGGGTGGTAGATATGAG 80715 Query 883 GCTTCGGGAAGGGGCTGCTCGACCCACTCTGCCTAGTGCCCAGATGTCCAGCCACTTGGG 942 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 80716 GCTTCGGGAAGGGGCTGCTCGACCCACTCTGCCTAGTGCCCAGATGTCCAGCCACTTGGG 80775 Query 943 AGCTACACTG 952 |||||||||| Sbjct 80776 AGCTACACTG 80785 Score = 313 bits (169), Expect = 3e-81 Identities = 169/169 (100%), Gaps = 0/169 (0%) Strand=Plus/Plus Query 109 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCT 168 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 76261 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCT 76320 Query 169 GGGGGGCGAGGAGTGGACCAGACACGGGAGCTTTGTCAATAAGCCCACACGAGGCTGGCT 228 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 76321 GGGGGGCGAGGAGTGGACCAGACACGGGAGCTTTGTCAATAAGCCCACACGAGGCTGGCT 76380 Query 229 GCATCCCAACGACAAAGTCATGGGACCTGGGGTTTCCTACTTGGTTCGG 277 ||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 76381 GCATCCCAACGACAAAGTCATGGGACCTGGGGTTTCCTACTTGGTTCGG 76429 Score = 250 bits (135), Expect = 3e-62 Identities = 135/135 (100%), Gaps = 0/135 (0%) Strand=Plus/Plus Query 1020 CAGGCAGAGAACTCTTCGATGACCCCTCCTATGTCAACATCCAGAATCTAGACAAGGCCC 1079 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 81020 CAGGCAGAGAACTCTTCGATGACCCCTCCTATGTCAACATCCAGAATCTAGACAAGGCCC 81079 Query 1080 GGCAGGCTGGGGGTGGGGCTGGGCCCCCAAATCCTTCTCTTAATGGCAGTGCACCCCGAG 1139 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 81080 GGCAGGCTGGGGGTGGGGCTGGGCCCCCAAATCCTTCTCTTAATGGCAGTGCACCCCGAG 81139 Query 1140 ACCTTTTTGACATGA 1154 ||||||||||||||| Sbjct 81140 ACCTTTTTGACATGA 81154 Score = 244 bits (132), Expect = 1e-60 Identities = 137/139 (98%), Gaps = 2/139 (1%) Strand=Plus/Plus Query 637 AGCCTGCCATATCCTGGAGTGTCCTGAAGGGCTTGCTCAGGATGTCATCAGCACCATCGG 696 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 78848 AGCCTGCCATATCCTGGAGTGTCCTGAAGGGCTTGCTCAGGATGTCATCAGCACCATCGG 78907 Query 697 GCAGGCCTTTGAGTTGCGCTTCAAACAGTATCTCAGGAATCCACCGAAGCTGGTCACCCC 756 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 78908 GCAGGCCTTTGAGTTGCGCTTCAAACAGTATCTCAGGAATCCACCGAAGCTGGTCACCCC 78967 Query 757 CCATGACAGGATG-GCTGG 774 |||||||||| || ||||| Sbjct 78968 CCATGACAGG-TGAGCTGG 78985 Score = 226 bits (122), Expect = 4e-55 Identities = 122/122 (100%), Gaps = 0/122 (0%) Strand=Plus/Plus Query 411 AGCCTTGTAGCCGCCCACTCAGCTCCATCCTGGGGAGGAGTAACCTGAAGTTTGCTGGAA 470 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 77779 AGCCTTGTAGCCGCCCACTCAGCTCCATCCTGGGGAGGAGTAACCTGAAGTTTGCTGGAA 77838 Query 471 TGCCAATCACTCTCACTGTGTCTACCAGCAGCCTTAACCTCATGGCAGCCGACTGCAAAC 530 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 77839 TGCCAATCACTCTCACTGTGTCTACCAGCAGCCTTAACCTCATGGCAGCCGACTGCAAAC 77898 Query 531 AG 532 || Sbjct 77899 AG 77900 Score = 180 bits (97), Expect = 4e-41 Identities = 97/97 (100%), Gaps = 0/97 (0%) Strand=Plus/Plus Query 14 CTGGGGTGAAAGTTGGGGCGGTGACTTAAGCAGACAGTTGCGTGATCCGGAACCAGATCG 73 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 72698 CTGGGGTGAAAGTTGGGGCGGTGACTTAAGCAGACAGTTGCGTGATCCGGAACCAGATCG 72757 Query 74 GCCCGCGGTGCGGTGCGGAGACTCCATGAGACCCTGG 110 ||||||||||||||||||||||||||||||||||||| Sbjct 72758 GCCCGCGGTGCGGTGCGGAGACTCCATGAGACCCTGG 72794 Score = 135 bits (73), Expect = 8e-28 Identities = 73/73 (100%), Gaps = 0/73 (0%) Strand=Plus/Plus Query 277 GTACATGGGCTGTGTGGAGGTCTTACAGTCAATGCGAGCCCTTGACTTCAATACCCGGAC 336 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 77009 GTACATGGGCTGTGTGGAGGTCTTACAGTCAATGCGAGCCCTTGACTTCAATACCCGGAC 77068 Query 337 TCAGGTCACCAGG 349 ||||||||||||| Sbjct 77069 TCAGGTCACCAGG 77081 Score = 134 bits (72), Expect = 3e-27 Identities = 72/72 (100%), Gaps = 0/72 (0%) Strand=Plus/Plus Query 952 GCCTATAGGGCAGCATGCTGCAGGAGACCATGAAGTCCGTAAACAGATGTTGCCTCCGCC 1011 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 80871 GCCTATAGGGCAGCATGCTGCAGGAGACCATGAAGTCCGTAAACAGATGTTGCCTCCGCC 80930 Query 1012 GCCTTGCCCAGG 1023 |||||||||||| Sbjct 80931 GCCTTGCCCAGG 80942 Score = 126 bits (68), Expect = 5e-25 Identities = 68/68 (100%), Gaps = 0/68 (0%) Strand=Plus/Plus Query 345 CCAGGGAGGCCATCAGTTTGGTGTGTGAAGCTGTGCCTGGTGCCAAAGGGGCGACAAGGA 404 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 77588 CCAGGGAGGCCATCAGTTTGGTGTGTGAAGCTGTGCCTGGTGCCAAAGGGGCGACAAGGA 77647 Query 405 GGAGAAAG 412 |||||||| Sbjct 77648 GGAGAAAG 77655 Score = 108 bits (58), Expect = 2e-19 Identities = 58/58 (100%), Gaps = 0/58 (0%) Strand=Plus/Plus Query 530 CAGATCATTGCCAACCATCACATGCAATCTATCTCTTTCGCGTCCGGTGGGGATCCGG 587 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 78271 CAGATCATTGCCAACCATCACATGCAATCTATCTCTTTCGCGTCCGGTGGGGATCCGG 78328 Score = 104 bits (56), Expect = 2e-18 Identities = 115/141 (81%), Gaps = 13/141 (9%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G-T 2225 ||||||| ||| ||||||||| ||||||| |||||||||| ||| |||| | | | | Sbjct 30342 TGGTGGCACACACCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGAAGGATTTCTGAGTT 30283 Query 2226 -GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 ||||||| || | ||| ||||||||||||||||||||||||||||||| ||||| | Sbjct 30282 CGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGA-A 30227 Query 2284 ACC-TGTCTCCAAAAACCAAA 2303 ||| |||||| |||||| ||| Sbjct 30226 ACCCTGTCTCAAAAAAC-AAA 30207 Score = 99.0 bits (53), Expect = 1e-16 Identities = 113/141 (80%), Gaps = 8/141 (5%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGAATTGTGAG-G 2229 |||| | ||| |||||||||| ||||||| |||||||||| |||| ||| || |||| Sbjct 67765 TGGTAGTGCATGCCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGTGGATTTCTGAGTT 67824 Query 2230 CCA-TCCGA-TCT--ACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAAC 2285 ||| || | || | |||||||||||||||||||||||||||||| | ||| ||| Sbjct 67825 CCAGGCC-AGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTACACACAGA-AAC 67882 Query 2286 C-TGTCTCCAAAAACCAAAAA 2305 | |||||| |||||||||||| Sbjct 67883 CCTGTCTCGAAAAACCAAAAA 67903 Score = 99.0 bits (53), Expect = 1e-16 Identities = 56/57 (98%), Gaps = 1/57 (1%) Strand=Plus/Plus Query 583 TCC-GGACACAGCTGAGTATGTTGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAG 638 ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 78634 TCCAGGACACAGCTGAGTATGTTGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAG 78690 Score = 97.1 bits (52), Expect = 4e-16 Identities = 112/139 (80%), Gaps = 12/139 (8%) Strand=Plus/Minus Query 2174 TGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G-T-GA 2227 |||| ||| | ||||||| ||||||||||||||||||| |||| ||| | | | | || Sbjct 137575 TGGCCCACACTTTTAATCCCAGCACTCAGGAGGCAGAGGCAGGTGGATTTCTGAGTTCGA 137516 Query 2228 GGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAACC 2286 ||||| || | ||| |||||||||||||||||||||||||||||| ||||| |||| Sbjct 137515 GGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA-AACC 137460 Query 2287 -TGTCTCCAAAAACCAAAA 2304 ||||| ||||| ||||| Sbjct 137459 CTGTCTTGAAAAAACAAAA 137441 Score = 95.3 bits (51), Expect = 1e-15 Identities = 114/142 (80%), Gaps = 13/142 (9%) Strand=Plus/Plus Query 2170 ATGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G- 2224 |||||||| |||| |||||| | |||||||| |||||||||| | || ||| | | | Sbjct 54919 ATGGTGGCACACGACTTTAA-CCCAGCACTCGGGAGGCAGAGGCGGGCGGATTTCTGAGT 54977 Query 2225 -TGAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAG 2282 |||||||| || | ||| ||||||||||||||||||||||||||||||| ||||| Sbjct 54978 TTGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGA- 55033 Query 2283 AACC-TGTCTCCAAAAACCAAA 2303 |||| ||||| ||||| |||| Sbjct 55034 AACCCTGTCTTGAAAAAACAAA 55055 Score = 93.5 bits (50), Expect = 5e-15 Identities = 113/141 (80%), Gaps = 13/141 (9%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G-- 2224 |||||| |||| ||||||||| ||| ||| |||||||||| |||| ||| | | | Sbjct 5163 TGGTGGTGCACACCTTTAATCCCAGTACTTGGGAGGCAGAGGCAGGTGGATTTCTGAGTT 5222 Query 2225 TGAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 |||||||| || | ||| |||||||||||||||||||||||||||||| ||||| | Sbjct 5223 TGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA-A 5278 Query 2284 ACC-TGTCTCCAAAAACCAAA 2303 ||| |||||| |||||| ||| Sbjct 5279 ACCCTGTCTCGAAAAAC-AAA 5298 Score = 93.5 bits (50), Expect = 5e-15 Identities = 116/145 (80%), Gaps = 16/145 (11%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGG-AGGCAGAGACAGG-AGGA-AT-T--G 2224 |||||| |||| ||||||||| ||||||| || |||||||| |||| | || | | | Sbjct 127938 TGGTGGTGCACACCTTTAATCCCAGCACT-TGGAAGGCAGAGGCAGGCA-GATTTCTGAG 127881 Query 2225 --TGAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGA 2281 |||||||| || | ||| ||||||||||||||||||||||||||||||| ||||| Sbjct 127880 TTTGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGA 127824 Query 2282 GAACC-TGTCTCCAAAAACCAAAAA 2305 |||| |||||| ||||| ||||| Sbjct 127823 -AACCCTGTCTCAAAAAAAAAAAAA 127800 Score = 73.1 bits (39), Expect = 6e-09 Identities = 55/62 (88%), Gaps = 3/62 (4%) Strand=Plus/Plus Query 2244 ACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAACC-TGTCTCCAAAAACCAA 2302 |||||||||||||||||||||||||||||| ||||| |||| |||||| |||||| || Sbjct 58831 ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA-AACCCTGTCTCGAAAAAC-AA 58888 Query 2303 AA 2304 || Sbjct 58889 AA 58890 Score = 58.4 bits (31), Expect = 2e-04 Identities = 48/56 (85%), Gaps = 2/56 (3%) Strand=Plus/Plus Query 2244 ACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAACC-TGTCTCCAAAAA 2298 |||||||||||||||||||||||||||| | ||||| |||| ||||| ||||| Sbjct 139829 ACAGAGTGAGTTCCAGGACAGCCAGGGCAACACAGAGA-AACCCTGTCTTGAAAAA 139883 >gb|AC104329.22| Download subject sequence spanning the HSP Mus musculus strain C57BL/6J clone rp23-418c12 map 3, complete sequence Length=197096 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 3140 bits (1700), Expect = 0.0 Identities = 1700/1700 (100%), Gaps = 0/1700 (0%) Strand=Plus/Minus Query 1393 GGTTCGGACAAAGGATCACCGCTTTGAGAGTGTCAGTCACCTGATCAGCTACCACATGGA 1452 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 143399 GGTTCGGACAAAGGATCACCGCTTTGAGAGTGTCAGTCACCTGATCAGCTACCACATGGA 143340 Query 1453 CAATCACTTGCCCATCATCTCTGCGGGCAGCGAACTGTGCCTACAGCAACCCGTGGATCG 1512 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 143339 CAATCACTTGCCCATCATCTCTGCGGGCAGCGAACTGTGCCTACAGCAACCCGTGGATCG 143280 Query 1513 GAAAGTGTGATCCTTCTCAGCTTCTCCAACAGGATGCTCTCCATTTCCGTCTCCCGTATT 1572 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 143279 GAAAGTGTGATCCTTCTCAGCTTCTCCAACAGGATGCTCTCCATTTCCGTCTCCCGTATT 143220 Query 1573 CTCTAACTTGTGGGACCTCTGTTTTGTGGGTCTGGCCTTGGGTGGGAACTGGGAGCAACG 1632 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 143219 CTCTAACTTGTGGGACCTCTGTTTTGTGGGTCTGGCCTTGGGTGGGAACTGGGAGCAACG 143160 Query 1633 AGGACATGGGTTTAGTGCCCACTTGAGAGAGAGAAAAAGAGGGTTTCAGTAAGGAGCCTG 1692 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 143159 AGGACATGGGTTTAGTGCCCACTTGAGAGAGAGAAAAAGAGGGTTTCAGTAAGGAGCCTG 143100 Query 1693 GGGTAGCATCCTGCCTCTGGCCAAACTTCACCAAAGTATTAATGTGCAGAGTGGTCCCTT 1752 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 143099 GGGTAGCATCCTGCCTCTGGCCAAACTTCACCAAAGTATTAATGTGCAGAGTGGTCCCTT 143040 Query 1753 GTCTGGGCCTTGCCTGTGCCAACCTGATGCCCTTcccccccAAAGGGTGGGTTCTTATAA 1812 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 143039 GTCTGGGCCTTGCCTGTGCCAACCTGATGCCCTTCCCCCCCAAAGGGTGGGTTCTTATAA 142980 Query 1813 TGGAAAATGCCCTGTGATGATAGGCCCAGTGGAGCAACTGCCCTTTGGGGGAAGGGAAAT 1872 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 142979 TGGAAAATGCCCTGTGATGATAGGCCCAGTGGAGCAACTGCCCTTTGGGGGAAGGGAAAT 142920 Query 1873 AATTATACCTCTGGTTTACTCCTGGGTCTTCAGGGTACCCCAGATCCCGCATAACATATC 1932 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 142919 AATTATACCTCTGGTTTACTCCTGGGTCTTCAGGGTACCCCAGATCCCGCATAACATATC 142860 Query 1933 CCACTCCCTCTGCTTCCCCTTAAACTTTGTGCCTTTGACTATCATAGGTCTGCAGATACT 1992 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 142859 CCACTCCCTCTGCTTCCCCTTAAACTTTGTGCCTTTGACTATCATAGGTCTGCAGATACT 142800 Query 1993 TAATGCAGAGTTCTCAGGCCCTTCACGTGTGGACAGGGGTTACTGCCACCTTGGCTTCTG 2052 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 142799 TAATGCAGAGTTCTCAGGCCCTTCACGTGTGGACAGGGGTTACTGCCACCTTGGCTTCTG 142740 Query 2053 GAGCCCTGTCCTATTCAGCACCCCTTCCTGTGTCTAGGGAGAATAGGGACAGGAGTGGCC 2112 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 142739 GAGCCCTGTCCTATTCAGCACCCCTTCCTGTGTCTAGGGAGAATAGGGACAGGAGTGGCC 142680 Query 2113 GCTATCTGCTCTGCCTTTCGGATGTGCAGCCCTTAAGAGATTGCCCCAAGCCTGAATATG 2172 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 142679 GCTATCTGCTCTGCCTTTCGGATGTGCAGCCCTTAAGAGATTGCCCCAAGCCTGAATATG 142620 Query 2173 GTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGAATTGTGAGGCCA 2232 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 142619 GTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGAATTGTGAGGCCA 142560 Query 2233 TCCGATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAACCTGTCTC 2292 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 142559 TCCGATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAACCTGTCTC 142500 Query 2293 CAAAAACCAAAAAGAGCGATTACCCCAGAGCCTTCTTCCTGATGGTAGCGGGGAGGGGCA 2352 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 142499 CAAAAACCAAAAAGAGCGATTACCCCAGAGCCTTCTTCCTGATGGTAGCGGGGAGGGGCA 142440 Query 2353 GGACTGGACCCATCTTGCTCAGTGCCTCCTGACCTCAATGCCTTTCCTCCAAGGGGTCTG 2412 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 142439 GGACTGGACCCATCTTGCTCAGTGCCTCCTGACCTCAATGCCTTTCCTCCAAGGGGTCTG 142380 Query 2413 TATACATTTCTCAAGCCTGCTCCTCCCATGTTTGCATGTGTGTTATAGTCTACAGCCAAA 2472 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 142379 TATACATTTCTCAAGCCTGCTCCTCCCATGTTTGCATGTGTGTTATAGTCTACAGCCAAA 142320 Query 2473 GTATAGCCCTCACTGTAACCCCATCCTGCCTCCCTCCTTTGGGATAGGTGTGTGCGTCTG 2532 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 142319 GTATAGCCCTCACTGTAACCCCATCCTGCCTCCCTCCTTTGGGATAGGTGTGTGCGTCTG 142260 Query 2533 ACTTGGGCCTCCAGGGTGTGTACAGTCAGTGTGGGTTTTGTGGAGGCAATAAGACTGAAG 2592 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 142259 ACTTGGGCCTCCAGGGTGTGTACAGTCAGTGTGGGTTTTGTGGAGGCAATAAGACTGAAG 142200 Query 2593 CAGTAGACAATCCCCAATACCATTTGCAGGTCTGGAACTGCACTCTCTTTTTTAAAAAAC 2652 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 142199 CAGTAGACAATCCCCAATACCATTTGCAGGTCTGGAACTGCACTCTCTTTTTTAAAAAAC 142140 Query 2653 ATGTATACATTTTAGGGCTGTAGATTTATTTTCCTGGTTTTGTTTTTCATTGCTGACTTT 2712 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 142139 ATGTATACATTTTAGGGCTGTAGATTTATTTTCCTGGTTTTGTTTTTCATTGCTGACTTT 142080 Query 2713 TGAGCACAGAATTATGATAATCAATTACATTTATACATCACCTCGATGACTTTTCCAAAC 2772 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 142079 TGAGCACAGAATTATGATAATCAATTACATTTATACATCACCTCGATGACTTTTCCAAAC 142020 Query 2773 TTTTAtttttttttttAAACAACTGTTGGGATTTTACTCCCTGGCCTTAACTAGGACAGG 2832 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 142019 TTTTATTTTTTTTTTTAAACAACTGTTGGGATTTTACTCCCTGGCCTTAACTAGGACAGG 141960 Query 2833 ATTGTACCCCACTCCTccccccccccTTTTTCTTTTTCGCCAAGACAACTGAGCAGAAAT 2892 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 141959 ATTGTACCCCACTCCTCCCCCCCCCCTTTTTCTTTTTCGCCAAGACAACTGAGCAGAAAT 141900 Query 2893 TTGGCTGAGCAGTGTTGTGGGACTATGATGTGATAGTTTTAGATCCTACCTTCTGCTTTC 2952 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 141899 TTGGCTGAGCAGTGTTGTGGGACTATGATGTGATAGTTTTAGATCCTACCTTCTGCTTTC 141840 Query 2953 GGGCAGCTGCAGCCAGCACAGAAACCTTGCAAGCTCACTCTGTGTGTAGGCTTTCTGGAC 3012 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 141839 GGGCAGCTGCAGCCAGCACAGAAACCTTGCAAGCTCACTCTGTGTGTAGGCTTTCTGGAC 141780 Query 3013 AAGGAATGGTCGCCAAATTTTTGGTTTGGATGTCTTATACCAAAGGGAAATAGTCTTCAT 3072 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 141779 AAGGAATGGTCGCCAAATTTTTGGTTTGGATGTCTTATACCAAAGGGAAATAGTCTTCAT 141720 Query 3073 TAAAGTTCGTATTTCTTTTA 3092 |||||||||||||||||||| Sbjct 141719 TAAAGTTCGTATTTCTTTTA 141700 Score = 446 bits (241), Expect = 3e-121 Identities = 241/241 (100%), Gaps = 0/241 (0%) Strand=Plus/Minus Query 1155 AGCCCTTTGAAGATGCACTTCGGGTGCCACCCCCACCGCAGTCCATGTCCATGGCTGAGC 1214 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 144507 AGCCCTTTGAAGATGCACTTCGGGTGCCACCCCCACCGCAGTCCATGTCCATGGCTGAGC 144448 Query 1215 AGCTGCAAGGGGAGCCCTGGTTCCACGGGAAGCTGAGCCGGAGGGAGGCCGAGGCGCTGC 1274 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 144447 AGCTGCAAGGGGAGCCCTGGTTCCACGGGAAGCTGAGCCGGAGGGAGGCCGAGGCGCTGC 144388 Query 1275 TGCAGCTCAATGGTGACTTCTTGGTGCGAGAGAGCACGACCACGCCTGGCCAGTATGTGC 1334 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 144387 TGCAGCTCAATGGTGACTTCTTGGTGCGAGAGAGCACGACCACGCCTGGCCAGTATGTGC 144328 Query 1335 TCACTGGCCTGCAGAGTGGGCAGCCCAAGCACTTGCTGCTGGTGGACCCTGAAGGTGTGG 1394 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 144327 TCACTGGCCTGCAGAGTGGGCAGCCCAAGCACTTGCTGCTGGTGGACCCTGAAGGTGTGG 144268 Query 1395 T 1395 | Sbjct 144267 T 144267 Score = 351 bits (190), Expect = 7e-93 Identities = 190/190 (100%), Gaps = 0/190 (0%) Strand=Plus/Minus Query 763 CAGGATGGCTGGCTTTGATGGCTCAGCTTGGGATGAGGAGGAAGAAGAGCCCCCTGACCA 822 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 145203 CAGGATGGCTGGCTTTGATGGCTCAGCTTGGGATGAGGAGGAAGAAGAGCCCCCTGACCA 145144 Query 823 TCAGTACTACAATGACTTTCCAGGGAAGGAACCCCCTCTTGGTGGGGTGGTAGATATGAG 882 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 145143 TCAGTACTACAATGACTTTCCAGGGAAGGAACCCCCTCTTGGTGGGGTGGTAGATATGAG 145084 Query 883 GCTTCGGGAAGGGGCTGCTCGACCCACTCTGCCTAGTGCCCAGATGTCCAGCCACTTGGG 942 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 145083 GCTTCGGGAAGGGGCTGCTCGACCCACTCTGCCTAGTGCCCAGATGTCCAGCCACTTGGG 145024 Query 943 AGCTACACTG 952 |||||||||| Sbjct 145023 AGCTACACTG 145014 Score = 313 bits (169), Expect = 3e-81 Identities = 169/169 (100%), Gaps = 0/169 (0%) Strand=Plus/Minus Query 109 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCT 168 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 149538 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCT 149479 Query 169 GGGGGGCGAGGAGTGGACCAGACACGGGAGCTTTGTCAATAAGCCCACACGAGGCTGGCT 228 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 149478 GGGGGGCGAGGAGTGGACCAGACACGGGAGCTTTGTCAATAAGCCCACACGAGGCTGGCT 149419 Query 229 GCATCCCAACGACAAAGTCATGGGACCTGGGGTTTCCTACTTGGTTCGG 277 ||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 149418 GCATCCCAACGACAAAGTCATGGGACCTGGGGTTTCCTACTTGGTTCGG 149370 Score = 250 bits (135), Expect = 3e-62 Identities = 135/135 (100%), Gaps = 0/135 (0%) Strand=Plus/Minus Query 1020 CAGGCAGAGAACTCTTCGATGACCCCTCCTATGTCAACATCCAGAATCTAGACAAGGCCC 1079 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 144779 CAGGCAGAGAACTCTTCGATGACCCCTCCTATGTCAACATCCAGAATCTAGACAAGGCCC 144720 Query 1080 GGCAGGCTGGGGGTGGGGCTGGGCCCCCAAATCCTTCTCTTAATGGCAGTGCACCCCGAG 1139 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 144719 GGCAGGCTGGGGGTGGGGCTGGGCCCCCAAATCCTTCTCTTAATGGCAGTGCACCCCGAG 144660 Query 1140 ACCTTTTTGACATGA 1154 ||||||||||||||| Sbjct 144659 ACCTTTTTGACATGA 144645 Score = 244 bits (132), Expect = 1e-60 Identities = 137/139 (98%), Gaps = 2/139 (1%) Strand=Plus/Minus Query 637 AGCCTGCCATATCCTGGAGTGTCCTGAAGGGCTTGCTCAGGATGTCATCAGCACCATCGG 696 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 146951 AGCCTGCCATATCCTGGAGTGTCCTGAAGGGCTTGCTCAGGATGTCATCAGCACCATCGG 146892 Query 697 GCAGGCCTTTGAGTTGCGCTTCAAACAGTATCTCAGGAATCCACCGAAGCTGGTCACCCC 756 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 146891 GCAGGCCTTTGAGTTGCGCTTCAAACAGTATCTCAGGAATCCACCGAAGCTGGTCACCCC 146832 Query 757 CCATGACAGGATG-GCTGG 774 |||||||||| || ||||| Sbjct 146831 CCATGACAGG-TGAGCTGG 146814 Score = 226 bits (122), Expect = 4e-55 Identities = 122/122 (100%), Gaps = 0/122 (0%) Strand=Plus/Minus Query 411 AGCCTTGTAGCCGCCCACTCAGCTCCATCCTGGGGAGGAGTAACCTGAAGTTTGCTGGAA 470 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 148020 AGCCTTGTAGCCGCCCACTCAGCTCCATCCTGGGGAGGAGTAACCTGAAGTTTGCTGGAA 147961 Query 471 TGCCAATCACTCTCACTGTGTCTACCAGCAGCCTTAACCTCATGGCAGCCGACTGCAAAC 530 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 147960 TGCCAATCACTCTCACTGTGTCTACCAGCAGCCTTAACCTCATGGCAGCCGACTGCAAAC 147901 Query 531 AG 532 || Sbjct 147900 AG 147899 Score = 180 bits (97), Expect = 4e-41 Identities = 97/97 (100%), Gaps = 0/97 (0%) Strand=Plus/Minus Query 14 CTGGGGTGAAAGTTGGGGCGGTGACTTAAGCAGACAGTTGCGTGATCCGGAACCAGATCG 73 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 153101 CTGGGGTGAAAGTTGGGGCGGTGACTTAAGCAGACAGTTGCGTGATCCGGAACCAGATCG 153042 Query 74 GCCCGCGGTGCGGTGCGGAGACTCCATGAGACCCTGG 110 ||||||||||||||||||||||||||||||||||||| Sbjct 153041 GCCCGCGGTGCGGTGCGGAGACTCCATGAGACCCTGG 153005 Score = 135 bits (73), Expect = 8e-28 Identities = 73/73 (100%), Gaps = 0/73 (0%) Strand=Plus/Minus Query 277 GTACATGGGCTGTGTGGAGGTCTTACAGTCAATGCGAGCCCTTGACTTCAATACCCGGAC 336 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 148790 GTACATGGGCTGTGTGGAGGTCTTACAGTCAATGCGAGCCCTTGACTTCAATACCCGGAC 148731 Query 337 TCAGGTCACCAGG 349 ||||||||||||| Sbjct 148730 TCAGGTCACCAGG 148718 Score = 134 bits (72), Expect = 3e-27 Identities = 72/72 (100%), Gaps = 0/72 (0%) Strand=Plus/Minus Query 952 GCCTATAGGGCAGCATGCTGCAGGAGACCATGAAGTCCGTAAACAGATGTTGCCTCCGCC 1011 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 144928 GCCTATAGGGCAGCATGCTGCAGGAGACCATGAAGTCCGTAAACAGATGTTGCCTCCGCC 144869 Query 1012 GCCTTGCCCAGG 1023 |||||||||||| Sbjct 144868 GCCTTGCCCAGG 144857 Score = 126 bits (68), Expect = 5e-25 Identities = 68/68 (100%), Gaps = 0/68 (0%) Strand=Plus/Minus Query 345 CCAGGGAGGCCATCAGTTTGGTGTGTGAAGCTGTGCCTGGTGCCAAAGGGGCGACAAGGA 404 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 148211 CCAGGGAGGCCATCAGTTTGGTGTGTGAAGCTGTGCCTGGTGCCAAAGGGGCGACAAGGA 148152 Query 405 GGAGAAAG 412 |||||||| Sbjct 148151 GGAGAAAG 148144 Score = 108 bits (58), Expect = 2e-19 Identities = 58/58 (100%), Gaps = 0/58 (0%) Strand=Plus/Minus Query 530 CAGATCATTGCCAACCATCACATGCAATCTATCTCTTTCGCGTCCGGTGGGGATCCGG 587 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 147528 CAGATCATTGCCAACCATCACATGCAATCTATCTCTTTCGCGTCCGGTGGGGATCCGG 147471 Score = 104 bits (56), Expect = 2e-18 Identities = 115/141 (81%), Gaps = 13/141 (9%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G-T 2225 ||||||| ||| ||||||||| ||||||| |||||||||| ||| |||| | | | | Sbjct 195457 TGGTGGCACACACCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGAAGGATTTCTGAGTT 195516 Query 2226 -GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 ||||||| || | ||| ||||||||||||||||||||||||||||||| ||||| | Sbjct 195517 CGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGA-A 195572 Query 2284 ACC-TGTCTCCAAAAACCAAA 2303 ||| |||||| |||||| ||| Sbjct 195573 ACCCTGTCTCAAAAAAC-AAA 195592 Score = 99.0 bits (53), Expect = 1e-16 Identities = 56/57 (98%), Gaps = 1/57 (1%) Strand=Plus/Minus Query 583 TCC-GGACACAGCTGAGTATGTTGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAG 638 ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 147165 TCCAGGACACAGCTGAGTATGTTGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAG 147109 Score = 99.0 bits (53), Expect = 1e-16 Identities = 113/141 (80%), Gaps = 8/141 (5%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGAATTGTGAG-G 2229 |||| | ||| |||||||||| ||||||| |||||||||| |||| ||| || |||| Sbjct 158034 TGGTAGTGCATGCCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGTGGATTTCTGAGTT 157975 Query 2230 CCA-TCCGA-TCT--ACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAAC 2285 ||| || | || | |||||||||||||||||||||||||||||| | ||| ||| Sbjct 157974 CCAGGCC-AGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTACACACAGA-AAC 157917 Query 2286 C-TGTCTCCAAAAACCAAAAA 2305 | |||||| |||||||||||| Sbjct 157916 CCTGTCTCGAAAAACCAAAAA 157896 Score = 97.1 bits (52), Expect = 4e-16 Identities = 112/139 (80%), Gaps = 12/139 (8%) Strand=Plus/Plus Query 2174 TGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G-T-GA 2227 |||| ||| | ||||||| ||||||||||||||||||| |||| ||| | | | | || Sbjct 88212 TGGCCCACACTTTTAATCCCAGCACTCAGGAGGCAGAGGCAGGTGGATTTCTGAGTTCGA 88271 Query 2228 GGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAACC 2286 ||||| || | ||| |||||||||||||||||||||||||||||| ||||| |||| Sbjct 88272 GGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA-AACC 88327 Query 2287 -TGTCTCCAAAAACCAAAA 2304 ||||| ||||| ||||| Sbjct 88328 CTGTCTTGAAAAAACAAAA 88346 Score = 95.3 bits (51), Expect = 1e-15 Identities = 114/142 (80%), Gaps = 13/142 (9%) Strand=Plus/Minus Query 2170 ATGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G- 2224 |||||||| |||| |||||| | |||||||| |||||||||| | || ||| | | | Sbjct 170879 ATGGTGGCACACGACTTTAA-CCCAGCACTCGGGAGGCAGAGGCGGGCGGATTTCTGAGT 170821 Query 2225 -TGAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAG 2282 |||||||| || | ||| ||||||||||||||||||||||||||||||| ||||| Sbjct 170820 TTGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGA- 170765 Query 2283 AACC-TGTCTCCAAAAACCAAA 2303 |||| ||||| ||||| |||| Sbjct 170764 AACCCTGTCTTGAAAAAACAAA 170743 Score = 93.5 bits (50), Expect = 5e-15 Identities = 116/145 (80%), Gaps = 16/145 (11%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGG-AGGCAGAGACAGG-AGGA-AT-T--G 2224 |||||| |||| ||||||||| ||||||| || |||||||| |||| | || | | | Sbjct 97856 TGGTGGTGCACACCTTTAATCCCAGCACT-TGGAAGGCAGAGGCAGGCA-GATTTCTGAG 97913 Query 2225 --TGAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGA 2281 |||||||| || | ||| ||||||||||||||||||||||||||||||| ||||| Sbjct 97914 TTTGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGA 97970 Query 2282 GAACC-TGTCTCCAAAAACCAAAAA 2305 |||| |||||| ||||| ||||| Sbjct 97971 -AACCCTGTCTCAAAAAAAAAAAAA 97994 Score = 73.1 bits (39), Expect = 6e-09 Identities = 55/62 (88%), Gaps = 3/62 (4%) Strand=Plus/Minus Query 2244 ACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAACC-TGTCTCCAAAAACCAA 2302 |||||||||||||||||||||||||||||| ||||| |||| |||||| |||||| || Sbjct 166967 ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA-AACCCTGTCTCGAAAAAC-AA 166910 Query 2303 AA 2304 || Sbjct 166909 AA 166908 Score = 58.4 bits (31), Expect = 2e-04 Identities = 48/56 (85%), Gaps = 2/56 (3%) Strand=Plus/Minus Query 2244 ACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAACC-TGTCTCCAAAAA 2298 |||||||||||||||||||||||||||| | ||||| |||| ||||| ||||| Sbjct 85958 ACAGAGTGAGTTCCAGGACAGCCAGGGCAACACAGAGA-AACCCTGTCTTGAAAAA 85904 >gb|AC171273.1| Download subject sequence spanning the HSP Mus musculus BAC clone RP23-137J12 from chromosome 3, complete sequence Length=234363 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 3140 bits (1700), Expect = 0.0 Identities = 1700/1700 (100%), Gaps = 0/1700 (0%) Strand=Plus/Minus Query 1393 GGTTCGGACAAAGGATCACCGCTTTGAGAGTGTCAGTCACCTGATCAGCTACCACATGGA 1452 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 113857 GGTTCGGACAAAGGATCACCGCTTTGAGAGTGTCAGTCACCTGATCAGCTACCACATGGA 113798 Query 1453 CAATCACTTGCCCATCATCTCTGCGGGCAGCGAACTGTGCCTACAGCAACCCGTGGATCG 1512 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 113797 CAATCACTTGCCCATCATCTCTGCGGGCAGCGAACTGTGCCTACAGCAACCCGTGGATCG 113738 Query 1513 GAAAGTGTGATCCTTCTCAGCTTCTCCAACAGGATGCTCTCCATTTCCGTCTCCCGTATT 1572 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 113737 GAAAGTGTGATCCTTCTCAGCTTCTCCAACAGGATGCTCTCCATTTCCGTCTCCCGTATT 113678 Query 1573 CTCTAACTTGTGGGACCTCTGTTTTGTGGGTCTGGCCTTGGGTGGGAACTGGGAGCAACG 1632 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 113677 CTCTAACTTGTGGGACCTCTGTTTTGTGGGTCTGGCCTTGGGTGGGAACTGGGAGCAACG 113618 Query 1633 AGGACATGGGTTTAGTGCCCACTTGAGAGAGAGAAAAAGAGGGTTTCAGTAAGGAGCCTG 1692 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 113617 AGGACATGGGTTTAGTGCCCACTTGAGAGAGAGAAAAAGAGGGTTTCAGTAAGGAGCCTG 113558 Query 1693 GGGTAGCATCCTGCCTCTGGCCAAACTTCACCAAAGTATTAATGTGCAGAGTGGTCCCTT 1752 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 113557 GGGTAGCATCCTGCCTCTGGCCAAACTTCACCAAAGTATTAATGTGCAGAGTGGTCCCTT 113498 Query 1753 GTCTGGGCCTTGCCTGTGCCAACCTGATGCCCTTcccccccAAAGGGTGGGTTCTTATAA 1812 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 113497 GTCTGGGCCTTGCCTGTGCCAACCTGATGCCCTTCCCCCCCAAAGGGTGGGTTCTTATAA 113438 Query 1813 TGGAAAATGCCCTGTGATGATAGGCCCAGTGGAGCAACTGCCCTTTGGGGGAAGGGAAAT 1872 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 113437 TGGAAAATGCCCTGTGATGATAGGCCCAGTGGAGCAACTGCCCTTTGGGGGAAGGGAAAT 113378 Query 1873 AATTATACCTCTGGTTTACTCCTGGGTCTTCAGGGTACCCCAGATCCCGCATAACATATC 1932 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 113377 AATTATACCTCTGGTTTACTCCTGGGTCTTCAGGGTACCCCAGATCCCGCATAACATATC 113318 Query 1933 CCACTCCCTCTGCTTCCCCTTAAACTTTGTGCCTTTGACTATCATAGGTCTGCAGATACT 1992 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 113317 CCACTCCCTCTGCTTCCCCTTAAACTTTGTGCCTTTGACTATCATAGGTCTGCAGATACT 113258 Query 1993 TAATGCAGAGTTCTCAGGCCCTTCACGTGTGGACAGGGGTTACTGCCACCTTGGCTTCTG 2052 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 113257 TAATGCAGAGTTCTCAGGCCCTTCACGTGTGGACAGGGGTTACTGCCACCTTGGCTTCTG 113198 Query 2053 GAGCCCTGTCCTATTCAGCACCCCTTCCTGTGTCTAGGGAGAATAGGGACAGGAGTGGCC 2112 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 113197 GAGCCCTGTCCTATTCAGCACCCCTTCCTGTGTCTAGGGAGAATAGGGACAGGAGTGGCC 113138 Query 2113 GCTATCTGCTCTGCCTTTCGGATGTGCAGCCCTTAAGAGATTGCCCCAAGCCTGAATATG 2172 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 113137 GCTATCTGCTCTGCCTTTCGGATGTGCAGCCCTTAAGAGATTGCCCCAAGCCTGAATATG 113078 Query 2173 GTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGAATTGTGAGGCCA 2232 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 113077 GTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGAATTGTGAGGCCA 113018 Query 2233 TCCGATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAACCTGTCTC 2292 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 113017 TCCGATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAACCTGTCTC 112958 Query 2293 CAAAAACCAAAAAGAGCGATTACCCCAGAGCCTTCTTCCTGATGGTAGCGGGGAGGGGCA 2352 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 112957 CAAAAACCAAAAAGAGCGATTACCCCAGAGCCTTCTTCCTGATGGTAGCGGGGAGGGGCA 112898 Query 2353 GGACTGGACCCATCTTGCTCAGTGCCTCCTGACCTCAATGCCTTTCCTCCAAGGGGTCTG 2412 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 112897 GGACTGGACCCATCTTGCTCAGTGCCTCCTGACCTCAATGCCTTTCCTCCAAGGGGTCTG 112838 Query 2413 TATACATTTCTCAAGCCTGCTCCTCCCATGTTTGCATGTGTGTTATAGTCTACAGCCAAA 2472 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 112837 TATACATTTCTCAAGCCTGCTCCTCCCATGTTTGCATGTGTGTTATAGTCTACAGCCAAA 112778 Query 2473 GTATAGCCCTCACTGTAACCCCATCCTGCCTCCCTCCTTTGGGATAGGTGTGTGCGTCTG 2532 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 112777 GTATAGCCCTCACTGTAACCCCATCCTGCCTCCCTCCTTTGGGATAGGTGTGTGCGTCTG 112718 Query 2533 ACTTGGGCCTCCAGGGTGTGTACAGTCAGTGTGGGTTTTGTGGAGGCAATAAGACTGAAG 2592 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 112717 ACTTGGGCCTCCAGGGTGTGTACAGTCAGTGTGGGTTTTGTGGAGGCAATAAGACTGAAG 112658 Query 2593 CAGTAGACAATCCCCAATACCATTTGCAGGTCTGGAACTGCACTCTCTTTTTTAAAAAAC 2652 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 112657 CAGTAGACAATCCCCAATACCATTTGCAGGTCTGGAACTGCACTCTCTTTTTTAAAAAAC 112598 Query 2653 ATGTATACATTTTAGGGCTGTAGATTTATTTTCCTGGTTTTGTTTTTCATTGCTGACTTT 2712 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 112597 ATGTATACATTTTAGGGCTGTAGATTTATTTTCCTGGTTTTGTTTTTCATTGCTGACTTT 112538 Query 2713 TGAGCACAGAATTATGATAATCAATTACATTTATACATCACCTCGATGACTTTTCCAAAC 2772 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 112537 TGAGCACAGAATTATGATAATCAATTACATTTATACATCACCTCGATGACTTTTCCAAAC 112478 Query 2773 TTTTAtttttttttttAAACAACTGTTGGGATTTTACTCCCTGGCCTTAACTAGGACAGG 2832 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 112477 TTTTATTTTTTTTTTTAAACAACTGTTGGGATTTTACTCCCTGGCCTTAACTAGGACAGG 112418 Query 2833 ATTGTACCCCACTCCTccccccccccTTTTTCTTTTTCGCCAAGACAACTGAGCAGAAAT 2892 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 112417 ATTGTACCCCACTCCTCCCCCCCCCCTTTTTCTTTTTCGCCAAGACAACTGAGCAGAAAT 112358 Query 2893 TTGGCTGAGCAGTGTTGTGGGACTATGATGTGATAGTTTTAGATCCTACCTTCTGCTTTC 2952 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 112357 TTGGCTGAGCAGTGTTGTGGGACTATGATGTGATAGTTTTAGATCCTACCTTCTGCTTTC 112298 Query 2953 GGGCAGCTGCAGCCAGCACAGAAACCTTGCAAGCTCACTCTGTGTGTAGGCTTTCTGGAC 3012 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 112297 GGGCAGCTGCAGCCAGCACAGAAACCTTGCAAGCTCACTCTGTGTGTAGGCTTTCTGGAC 112238 Query 3013 AAGGAATGGTCGCCAAATTTTTGGTTTGGATGTCTTATACCAAAGGGAAATAGTCTTCAT 3072 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 112237 AAGGAATGGTCGCCAAATTTTTGGTTTGGATGTCTTATACCAAAGGGAAATAGTCTTCAT 112178 Query 3073 TAAAGTTCGTATTTCTTTTA 3092 |||||||||||||||||||| Sbjct 112177 TAAAGTTCGTATTTCTTTTA 112158 Score = 446 bits (241), Expect = 3e-121 Identities = 241/241 (100%), Gaps = 0/241 (0%) Strand=Plus/Minus Query 1155 AGCCCTTTGAAGATGCACTTCGGGTGCCACCCCCACCGCAGTCCATGTCCATGGCTGAGC 1214 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 114965 AGCCCTTTGAAGATGCACTTCGGGTGCCACCCCCACCGCAGTCCATGTCCATGGCTGAGC 114906 Query 1215 AGCTGCAAGGGGAGCCCTGGTTCCACGGGAAGCTGAGCCGGAGGGAGGCCGAGGCGCTGC 1274 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 114905 AGCTGCAAGGGGAGCCCTGGTTCCACGGGAAGCTGAGCCGGAGGGAGGCCGAGGCGCTGC 114846 Query 1275 TGCAGCTCAATGGTGACTTCTTGGTGCGAGAGAGCACGACCACGCCTGGCCAGTATGTGC 1334 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 114845 TGCAGCTCAATGGTGACTTCTTGGTGCGAGAGAGCACGACCACGCCTGGCCAGTATGTGC 114786 Query 1335 TCACTGGCCTGCAGAGTGGGCAGCCCAAGCACTTGCTGCTGGTGGACCCTGAAGGTGTGG 1394 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 114785 TCACTGGCCTGCAGAGTGGGCAGCCCAAGCACTTGCTGCTGGTGGACCCTGAAGGTGTGG 114726 Query 1395 T 1395 | Sbjct 114725 T 114725 Score = 351 bits (190), Expect = 7e-93 Identities = 190/190 (100%), Gaps = 0/190 (0%) Strand=Plus/Minus Query 763 CAGGATGGCTGGCTTTGATGGCTCAGCTTGGGATGAGGAGGAAGAAGAGCCCCCTGACCA 822 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 115661 CAGGATGGCTGGCTTTGATGGCTCAGCTTGGGATGAGGAGGAAGAAGAGCCCCCTGACCA 115602 Query 823 TCAGTACTACAATGACTTTCCAGGGAAGGAACCCCCTCTTGGTGGGGTGGTAGATATGAG 882 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 115601 TCAGTACTACAATGACTTTCCAGGGAAGGAACCCCCTCTTGGTGGGGTGGTAGATATGAG 115542 Query 883 GCTTCGGGAAGGGGCTGCTCGACCCACTCTGCCTAGTGCCCAGATGTCCAGCCACTTGGG 942 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 115541 GCTTCGGGAAGGGGCTGCTCGACCCACTCTGCCTAGTGCCCAGATGTCCAGCCACTTGGG 115482 Query 943 AGCTACACTG 952 |||||||||| Sbjct 115481 AGCTACACTG 115472 Score = 313 bits (169), Expect = 3e-81 Identities = 169/169 (100%), Gaps = 0/169 (0%) Strand=Plus/Minus Query 109 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCT 168 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 119996 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCT 119937 Query 169 GGGGGGCGAGGAGTGGACCAGACACGGGAGCTTTGTCAATAAGCCCACACGAGGCTGGCT 228 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 119936 GGGGGGCGAGGAGTGGACCAGACACGGGAGCTTTGTCAATAAGCCCACACGAGGCTGGCT 119877 Query 229 GCATCCCAACGACAAAGTCATGGGACCTGGGGTTTCCTACTTGGTTCGG 277 ||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 119876 GCATCCCAACGACAAAGTCATGGGACCTGGGGTTTCCTACTTGGTTCGG 119828 Score = 250 bits (135), Expect = 3e-62 Identities = 135/135 (100%), Gaps = 0/135 (0%) Strand=Plus/Minus Query 1020 CAGGCAGAGAACTCTTCGATGACCCCTCCTATGTCAACATCCAGAATCTAGACAAGGCCC 1079 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 115237 CAGGCAGAGAACTCTTCGATGACCCCTCCTATGTCAACATCCAGAATCTAGACAAGGCCC 115178 Query 1080 GGCAGGCTGGGGGTGGGGCTGGGCCCCCAAATCCTTCTCTTAATGGCAGTGCACCCCGAG 1139 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 115177 GGCAGGCTGGGGGTGGGGCTGGGCCCCCAAATCCTTCTCTTAATGGCAGTGCACCCCGAG 115118 Query 1140 ACCTTTTTGACATGA 1154 ||||||||||||||| Sbjct 115117 ACCTTTTTGACATGA 115103 Score = 244 bits (132), Expect = 1e-60 Identities = 137/139 (98%), Gaps = 2/139 (1%) Strand=Plus/Minus Query 637 AGCCTGCCATATCCTGGAGTGTCCTGAAGGGCTTGCTCAGGATGTCATCAGCACCATCGG 696 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 117409 AGCCTGCCATATCCTGGAGTGTCCTGAAGGGCTTGCTCAGGATGTCATCAGCACCATCGG 117350 Query 697 GCAGGCCTTTGAGTTGCGCTTCAAACAGTATCTCAGGAATCCACCGAAGCTGGTCACCCC 756 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 117349 GCAGGCCTTTGAGTTGCGCTTCAAACAGTATCTCAGGAATCCACCGAAGCTGGTCACCCC 117290 Query 757 CCATGACAGGATG-GCTGG 774 |||||||||| || ||||| Sbjct 117289 CCATGACAGG-TGAGCTGG 117272 Score = 226 bits (122), Expect = 4e-55 Identities = 122/122 (100%), Gaps = 0/122 (0%) Strand=Plus/Minus Query 411 AGCCTTGTAGCCGCCCACTCAGCTCCATCCTGGGGAGGAGTAACCTGAAGTTTGCTGGAA 470 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 118478 AGCCTTGTAGCCGCCCACTCAGCTCCATCCTGGGGAGGAGTAACCTGAAGTTTGCTGGAA 118419 Query 471 TGCCAATCACTCTCACTGTGTCTACCAGCAGCCTTAACCTCATGGCAGCCGACTGCAAAC 530 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 118418 TGCCAATCACTCTCACTGTGTCTACCAGCAGCCTTAACCTCATGGCAGCCGACTGCAAAC 118359 Query 531 AG 532 || Sbjct 118358 AG 118357 Score = 180 bits (97), Expect = 4e-41 Identities = 97/97 (100%), Gaps = 0/97 (0%) Strand=Plus/Minus Query 14 CTGGGGTGAAAGTTGGGGCGGTGACTTAAGCAGACAGTTGCGTGATCCGGAACCAGATCG 73 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 123559 CTGGGGTGAAAGTTGGGGCGGTGACTTAAGCAGACAGTTGCGTGATCCGGAACCAGATCG 123500 Query 74 GCCCGCGGTGCGGTGCGGAGACTCCATGAGACCCTGG 110 ||||||||||||||||||||||||||||||||||||| Sbjct 123499 GCCCGCGGTGCGGTGCGGAGACTCCATGAGACCCTGG 123463 Score = 135 bits (73), Expect = 8e-28 Identities = 73/73 (100%), Gaps = 0/73 (0%) Strand=Plus/Minus Query 277 GTACATGGGCTGTGTGGAGGTCTTACAGTCAATGCGAGCCCTTGACTTCAATACCCGGAC 336 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 119248 GTACATGGGCTGTGTGGAGGTCTTACAGTCAATGCGAGCCCTTGACTTCAATACCCGGAC 119189 Query 337 TCAGGTCACCAGG 349 ||||||||||||| Sbjct 119188 TCAGGTCACCAGG 119176 Score = 134 bits (72), Expect = 3e-27 Identities = 72/72 (100%), Gaps = 0/72 (0%) Strand=Plus/Minus Query 952 GCCTATAGGGCAGCATGCTGCAGGAGACCATGAAGTCCGTAAACAGATGTTGCCTCCGCC 1011 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 115386 GCCTATAGGGCAGCATGCTGCAGGAGACCATGAAGTCCGTAAACAGATGTTGCCTCCGCC 115327 Query 1012 GCCTTGCCCAGG 1023 |||||||||||| Sbjct 115326 GCCTTGCCCAGG 115315 Score = 126 bits (68), Expect = 5e-25 Identities = 68/68 (100%), Gaps = 0/68 (0%) Strand=Plus/Minus Query 345 CCAGGGAGGCCATCAGTTTGGTGTGTGAAGCTGTGCCTGGTGCCAAAGGGGCGACAAGGA 404 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 118669 CCAGGGAGGCCATCAGTTTGGTGTGTGAAGCTGTGCCTGGTGCCAAAGGGGCGACAAGGA 118610 Query 405 GGAGAAAG 412 |||||||| Sbjct 118609 GGAGAAAG 118602 Score = 108 bits (58), Expect = 2e-19 Identities = 58/58 (100%), Gaps = 0/58 (0%) Strand=Plus/Minus Query 530 CAGATCATTGCCAACCATCACATGCAATCTATCTCTTTCGCGTCCGGTGGGGATCCGG 587 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 117986 CAGATCATTGCCAACCATCACATGCAATCTATCTCTTTCGCGTCCGGTGGGGATCCGG 117929 Score = 104 bits (56), Expect = 2e-18 Identities = 115/141 (81%), Gaps = 13/141 (9%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G-T 2225 ||||||| ||| ||||||||| ||||||| |||||||||| ||| |||| | | | | Sbjct 165914 TGGTGGCACACACCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGAAGGATTTCTGAGTT 165973 Query 2226 -GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 ||||||| || | ||| ||||||||||||||||||||||||||||||| ||||| | Sbjct 165974 CGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGA-A 166029 Query 2284 ACC-TGTCTCCAAAAACCAAA 2303 ||| |||||| |||||| ||| Sbjct 166030 ACCCTGTCTCAAAAAAC-AAA 166049 Score = 99.0 bits (53), Expect = 1e-16 Identities = 56/57 (98%), Gaps = 1/57 (1%) Strand=Plus/Minus Query 583 TCC-GGACACAGCTGAGTATGTTGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAG 638 ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 117623 TCCAGGACACAGCTGAGTATGTTGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAG 117567 Score = 99.0 bits (53), Expect = 1e-16 Identities = 113/141 (80%), Gaps = 8/141 (5%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGAATTGTGAG-G 2229 |||| | ||| |||||||||| ||||||| |||||||||| |||| ||| || |||| Sbjct 128492 TGGTAGTGCATGCCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGTGGATTTCTGAGTT 128433 Query 2230 CCA-TCCGA-TCT--ACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAAC 2285 ||| || | || | |||||||||||||||||||||||||||||| | ||| ||| Sbjct 128432 CCAGGCC-AGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTACACACAGA-AAC 128375 Query 2286 C-TGTCTCCAAAAACCAAAAA 2305 | |||||| |||||||||||| Sbjct 128374 CCTGTCTCGAAAAACCAAAAA 128354 Score = 97.1 bits (52), Expect = 4e-16 Identities = 112/139 (80%), Gaps = 12/139 (8%) Strand=Plus/Plus Query 2174 TGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G-T-GA 2227 |||| ||| | ||||||| ||||||||||||||||||| |||| ||| | | | | || Sbjct 58675 TGGCCCACACTTTTAATCCCAGCACTCAGGAGGCAGAGGCAGGTGGATTTCTGAGTTCGA 58734 Query 2228 GGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAACC 2286 ||||| || | ||| |||||||||||||||||||||||||||||| ||||| |||| Sbjct 58735 GGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA-AACC 58790 Query 2287 -TGTCTCCAAAAACCAAAA 2304 ||||| ||||| ||||| Sbjct 58791 CTGTCTTGAAAAAACAAAA 58809 Score = 95.3 bits (51), Expect = 1e-15 Identities = 114/142 (80%), Gaps = 13/142 (9%) Strand=Plus/Minus Query 2170 ATGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G- 2224 |||||||| |||| |||||| | |||||||| |||||||||| | || ||| | | | Sbjct 141337 ATGGTGGCACACGACTTTAA-CCCAGCACTCGGGAGGCAGAGGCGGGCGGATTTCTGAGT 141279 Query 2225 -TGAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAG 2282 |||||||| || | ||| ||||||||||||||||||||||||||||||| ||||| Sbjct 141278 TTGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGA- 141223 Query 2283 AACC-TGTCTCCAAAAACCAAA 2303 |||| ||||| ||||| |||| Sbjct 141222 AACCCTGTCTTGAAAAAACAAA 141201 Score = 95.3 bits (51), Expect = 1e-15 Identities = 115/143 (80%), Gaps = 15/143 (10%) Strand=Plus/Plus Query 2172 GGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGG-AAT-T--G--T 2225 |||||| ||||||||||||| ||||||| ||||||||||||||| || | | | | Sbjct 199296 GGTGGCACACGCCTTTAATCCCAGCACTTGGGAGGCAGAGACAGGCGGCTCTCTGAGTTT 199355 Query 2226 GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAA 2284 ||||||| || | ||| |||||||||||||||||||||||||||||| ||||| || Sbjct 199356 GAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA-AA 199411 Query 2285 CC-TGTCTCCAAAA-ACCAAAAA 2305 || | |||| |||| || ||||| Sbjct 199412 CCCTATCTC-AAAAGAC-AAAAA 199432 Score = 93.5 bits (50), Expect = 5e-15 Identities = 116/145 (80%), Gaps = 16/145 (11%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGG-AGGCAGAGACAGG-AGGA-AT-T--G 2224 |||||| |||| ||||||||| ||||||| || |||||||| |||| | || | | | Sbjct 68316 TGGTGGTGCACACCTTTAATCCCAGCACT-TGGAAGGCAGAGGCAGGCA-GATTTCTGAG 68373 Query 2225 --TGAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGA 2281 |||||||| || | ||| ||||||||||||||||||||||||||||||| ||||| Sbjct 68374 TTTGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGA 68430 Query 2282 GAACC-TGTCTCCAAAAACCAAAAA 2305 |||| |||||| ||||| ||||| Sbjct 68431 -AACCCTGTCTCAAAAAAAAAAAAA 68454 Score = 93.5 bits (50), Expect = 5e-15 Identities = 113/141 (80%), Gaps = 13/141 (9%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G-- 2224 |||||| |||| ||||||||| ||| ||| |||||||||| |||| ||| | | | Sbjct 191093 TGGTGGTGCACACCTTTAATCCCAGTACTTGGGAGGCAGAGGCAGGTGGATTTCTGAGTT 191034 Query 2225 TGAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 |||||||| || | ||| |||||||||||||||||||||||||||||| ||||| | Sbjct 191033 TGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA-A 190978 Query 2284 ACC-TGTCTCCAAAAACCAAA 2303 ||| |||||| |||||| ||| Sbjct 190977 ACCCTGTCTCGAAAAAC-AAA 190958 Score = 73.1 bits (39), Expect = 6e-09 Identities = 55/62 (88%), Gaps = 3/62 (4%) Strand=Plus/Minus Query 2244 ACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAACC-TGTCTCCAAAAACCAA 2302 |||||||||||||||||||||||||||||| ||||| |||| |||||| |||||| || Sbjct 137425 ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA-AACCCTGTCTCGAAAAAC-AA 137368 Query 2303 AA 2304 || Sbjct 137367 AA 137366 Score = 58.4 bits (31), Expect = 2e-04 Identities = 48/56 (85%), Gaps = 2/56 (3%) Strand=Plus/Minus Query 2244 ACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAACC-TGTCTCCAAAAA 2298 |||||||||||||||||||||||||||| | ||||| |||| ||||| ||||| Sbjct 56420 ACAGAGTGAGTTCCAGGACAGCCAGGGCAACACAGAGA-AACCCTGTCTTGAAAAA 56366 >ref|NM_053517.1| UniGene infoGene info Rattus norvegicus src homology 2 domain-containing transforming protein C1 (Shc1), mRNA gb|BC088298.1| UniGene infoGene info Rattus norvegicus src homology 2 domain-containing transforming protein C1, mRNA (cDNA clone MGC:109497 IMAGE:7323045), complete cds Length=1955 Score = 2754 bits (1491), Expect = 0.0 Identities = 1814/1964 (92%), Gaps = 45/1964 (2%) Strand=Plus/Plus Query 16 GGGGTGAAAGTTGGGGCGGTGACTTAAGCAGACAGTTGCGTGATCCGGAACCAGATCGGC 75 |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct 9 GGGGTGAAAGTTGGGGCGGTGACTTAAGCAGACAGTTGCGTGGTCCGGAACCAGATCGGC 68 Query 76 CCGCGGTGCGGTGCGGAGACTCCATGAGACCCTGGACATGAACAAGCTGAGTGGAGGCGG 135 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 69 CCGCGGTGCGGTGCGGAGACTCCATGAGACCCTGGACATGAACAAGCTGAGTGGAGGCGG 128 Query 136 CGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCTGGGGGGCGAGGAGTGGACCAGACACGG 195 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 129 CGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCTGGGGGGCGAGGAGTGGACCAGACACGG 188 Query 196 GAGCTTTGTCAATAAGCCCACACGAGGCTGGCTGCATCCCAACGACAAAGTCATGGGACC 255 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 189 GAGCTTTGTCAATAAGCCCACACGAGGCTGGCTGCATCCCAACGACAAAGTCATGGGACC 248 Query 256 TGGGGTTTCCTACTTGGTTCGGTACATGGGCTGTGTGGAGGTCTTACAGTCAATGCGAGC 315 |||||||||||||||||||||||||||||| || |||||||||||||||||||||||||| Sbjct 249 TGGGGTTTCCTACTTGGTTCGGTACATGGGTTGCGTGGAGGTCTTACAGTCAATGCGAGC 308 Query 316 CCTTGACTTCAATACCCGGACTCAGGTCACCAGGGAGGCCATCAGTTTGGTGTGTGAAGC 375 ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| Sbjct 309 CCTTGACTTCAATACCCGGACTCAGGTCACCAGGGAGGCTATCAGTTTGGTGTGTGAAGC 368 Query 376 TGTGCCTGGTGCCAAAGGGGCGACAAGGAGGAGAAAGCCTTGTAGCCGCCCACTCAGCTC 435 ||||||||||||||||||||||| |||||||||||||| || ||||||||||||||||| Sbjct 369 TGTGCCTGGTGCCAAAGGGGCGATGAGGAGGAGAAAGCCCTGCAGCCGCCCACTCAGCTC 428 Query 436 CATCCTGGGGAGGAGTAACCTGAAGTTTGCTGGAATGCCAATCACTCTCACTGTGTCTAC 495 |||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||| Sbjct 429 TATCCTGGGAAGGAGTAACCTGAAGTTTGCTGGAATGCCGATCACTCTCACTGTGTCTAC 488 Query 496 CAGCAGCCTTAACCTCATGGCAGCCGACTGCAAACAGATCATTGCCAACCATCACATGCA 555 |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct 489 CAGCAGCCTTAACCTCATGGCAGCAGACTGCAAACAGATCATTGCCAACCATCACATGCA 548 Query 556 ATCTATCTCTTTCGCGTCCGGTGGGGATCCGGACACAGCTGAGTATGTTGCCTATGTTGC 615 ||||||||| |||||||| |||||||||||||||||||||||||| |||||||||||||| Sbjct 549 ATCTATCTCATTCGCGTCTGGTGGGGATCCGGACACAGCTGAGTACGTTGCCTATGTTGC 608 Query 616 CAAAGACCCTGTGAATCAGAGAGCCTGCCATATCCTGGAGTGTCCTGAAGGGCTTGCTCA 675 ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| Sbjct 609 CAAAGACCCTGTGAATCAGAGAGCCTGCCATATCCTGGAGTGTCCTGAAGGACTTGCTCA 668 Query 676 GGATGTCATCAGCACCATCGGGCAGGCCTTTGAGTTGCGCTTCAAACAGTATCTCAGGAA 735 ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 669 GGACGTCATCAGCACCATCGGGCAGGCCTTTGAGTTGCGCTTCAAACAGTATCTCAGGAA 728 Query 736 TCCACCGAAGCTGGTCACCCCCCATGACAGGATGGCTGGCTTTGATGGCTCAGCTTGGGA 795 |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 729 TCCACCCAAGCTGGTCACCCCCCATGACAGGATGGCTGGCTTTGATGGCTCAGCTTGGGA 788 Query 796 TGAGGAGGAAGAAGAGCCCCCTGACCATCAGTACTACAATGACTTTCCAGGGAAGGAACC 855 ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||| Sbjct 789 TGAGGAGGAAGAAGAGCTCCCTGACCATCAGTACTACAATGACTTCCCAGGGAAGGAACC 848 Query 856 CCCTCTTGGTGGGGTGGTAGATATGAGGCTTCGGGAAGGGGCTGCTCGACCCACTCTGCC 915 |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 849 CCCTCTTGGTGGAGTGGTAGATATGAGGCTTCGGGAAGGGGCTGCTCGACCCACTCTGCC 908 Query 916 TAGTGCCCAGATGTCCAGCCACTTGGGAGCTACACTGCCTATAGGGCAGCATGCTGCAGG 975 ||| |||||||| ||||||||||||||||||||||||| ||||||||||||| | |||| Sbjct 909 CAGTACCCAGATGCCCAGCCACTTGGGAGCTACACTGCCAATAGGGCAGCATGTTACAGG 968 Query 976 AGACCATGAAGTCCGTAAACAGATGTTGCCTCCGCCGCCTTGCCCAGGCAGAGAACTCTT 1035 ||||||||||||||||||||||||| ||||||| || || |||||||||||||||||||| Sbjct 969 AGACCATGAAGTCCGTAAACAGATGCTGCCTCCACCACCGTGCCCAGGCAGAGAACTCTT 1028 Query 1036 CGATGACCCCTCCTATGTCAACATCCAGAATCTAGACAAGGCCCGGCAGGCTGGGGGTGG 1095 |||||| || |||||||||||||||||||||||||||||||||||||| ||||| ||||| Sbjct 1029 CGATGATCCTTCCTATGTCAACATCCAGAATCTAGACAAGGCCCGGCAAGCTGGTGGTGG 1088 Query 1096 GGCTGGGCCCCCAAATCCTTCTCTTAATGGCAGTGCACCCCGAGACCTTTTTGACATGAA 1155 |||||| ||||||||||||||| ||||||||||||||||||||||||| ||||||||||| Sbjct 1089 GGCTGGACCCCCAAATCCTTCTGTTAATGGCAGTGCACCCCGAGACCTCTTTGACATGAA 1148 Query 1156 GCCCTTTGAAGATGCACTTCGGGTGCCACCCCCACCGCAGTCCATGTCCATGGCTGAGCA 1215 |||||| ||||||||||| |||||||| || | || ||||||||||||||||||||||| Sbjct 1149 GCCCTTCGAAGATGCACTCCGGGTGCCGCCAGCTCCCCAGTCCATGTCCATGGCTGAGCA 1208 Query 1216 GCTGCAAGGGGAGCCCTGGTTCCACGGGAAGCTGAGCCGGAGGGAGGCCGAGGCGCTGCT 1275 ||| ||||||||| ||||||| || ||||| || |||||| ||||||| ||||||||||| Sbjct 1209 GCTCCAAGGGGAGTCCTGGTTTCATGGGAAACTCAGCCGGCGGGAGGCTGAGGCGCTGCT 1268 Query 1276 GCAGCTCAATGGTGACTTCTTGGTGCGAGAGAGCACGACCACGCCTGGCCAGTATGTGCT 1335 ||||||||| ||||||||||||||||||||||| || ||||| ||||||||||| ||||| Sbjct 1269 GCAGCTCAACGGTGACTTCTTGGTGCGAGAGAGTACAACCACACCTGGCCAGTACGTGCT 1328 Query 1336 CACTGGCCTGCAGAGTGGGCAGCCCAAGCACTTGCTGCTGGTGGACCCTGAAGGTGTGGT 1395 |||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||| Sbjct 1329 CACTGGTCTGCAGAGTGGGCAGCCCAAGCACTTGCTTCTGGTGGACCCTGAAGGTGTGGT 1388 Query 1396 TCGGACAAAGGATCACCGCTTTGAGAGTGTCAGTCACCTGATCAGCTACCACATGGACAA 1455 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1389 TCGGACAAAGGATCACCGCTTTGAGAGTGTCAGTCACCTGATCAGCTACCACATGGACAA 1448 Query 1456 TCACTTGCCCATCATCTCTGCGGGCAGCGAACTGTGCCTACAGCAACCCGTGGATCGGAA 1515 |||||| |||||||||||||| ||||| || ||||| ||||||||||| |||||||| || Sbjct 1449 TCACTTACCCATCATCTCTGCAGGCAGTGAGCTGTGTCTACAGCAACCTGTGGATCGAAA 1508 Query 1516 AGTGTGATCCTTCTCAGCTTCTCCAACAGGATGCTCTCCATTTCCGTCTCCCGTATTCTC 1575 |||||||||||||| ||| ||||| |||| |||||||| | || || | | || Sbjct 1509 AGTGTGATCCTTCTTAGCCTCTCCTGGAGGACGCTCTCCA---C--TC-CC--T-T-CT- 1557 Query 1576 TAACTTGTGGGACCTCTGTTTTGTGGGTC--TGGCCTTGGGTGGGAACTGGGAGCAACGA 1633 | | ||| || || || | ||| | || | |||| ||||||||| ||| | | Sbjct 1558 -ACCGTGT---AC-TC-GT---G-GGGCCGCTG-C-TTGG-TGGGAACTG--AGCGGCAA 1602 Query 1634 GGACATGGGTTTAGTGCCCACTTGAGAGAGAGAAAAAGAGGGTTTCAGTAAGGAGCCTGG 1693 ||||| || ||||||||||||||||||||| || ||| || ||||||||| Sbjct 1603 GGACACGGCTTTAGTGCCCACTTGAGAGAG-GAT--------TTT---TA-GGAGCCTGG 1649 Query 1694 GGTAGCATCCTGCCTCTGGCCAAACTTCACCAAAGTATTAATGTGCAGAGTGGTCCCTTG 1753 | |||||||| | |||| |||||| |||||||||||||||||||||||||||||||||| Sbjct 1650 GAAAGCATCCTTCTTCTGCCCAAACCTCACCAAAGTATTAATGTGCAGAGTGGTCCCTTG 1709 Query 1754 TCTGGGCCTTGCCTGTGCCAACCTGATGCCCTTcccccccAAAGGGTGGGTTCTTATAAT 1813 |||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||| Sbjct 1710 TCTGGGCCTTGCCTGTGCCAACCTGATGCCCTTCCCCCA-AAAGGGTGGGTT-TTATAAT 1767 Query 1814 GGAAAATGCCCTGTGATGATAGGCCCAGTGGAGCAACTGCCCTTTGGGGGAAGGGAAATA 1873 ||||||| ||||||| || ||| |||||||||| || ||||||||||||||||||||||| Sbjct 1768 GGAAAATACCCTGTGGTGTTAGACCCAGTGGAGTAATTGCCCTTTGGGGGAAGGGAAATA 1827 Query 1874 ATTATACCTCTGGTTTACTCCTGGGTCTTCAGGGTACCCCAGATCCCGCATAACATATCC 1933 || ||||||||||||||||||||| |||||||||||||||||| ||| |||||||||| Sbjct 1828 ATCATACCTCTGGTTTACTCCTGG-TCTTCAGGGTACCCCAGACCCCTTTTAACATATCC 1886 Query 1934 CACTCCCTCTGCTTCCCCTTAAA-CTTTGTGCCTTTGACTATCA 1976 ||||||| ||| || ||||||| ||||||||||| |||||||| Sbjct 1887 TACTCCCTATGCATCTCCTTAAAACTTTGTGCCTTCGACTATCA 1930 >gb|U15784.1|MMU15784 UniGene infoGeoGene info Mus musculus Shcp52 (Shc) mRNA, complete cds Length=1462 Score = 2700 bits (1462), Expect = 0.0 Identities = 1462/1462 (100%), Gaps = 0/1462 (0%) Strand=Plus/Plus Query 61 CGGAACCAGATCGGCCCGCGGTGCGGTGCGGAGACTCCATGAGACCCTGGACATGAACAA 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1 CGGAACCAGATCGGCCCGCGGTGCGGTGCGGAGACTCCATGAGACCCTGGACATGAACAA 60 Query 121 GCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCTGGGGGGCGAGGA 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 61 GCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCTGGGGGGCGAGGA 120 Query 181 GTGGACCAGACACGGGAGCTTTGTCAATAAGCCCACACGAGGCTGGCTGCATCCCAACGA 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 121 GTGGACCAGACACGGGAGCTTTGTCAATAAGCCCACACGAGGCTGGCTGCATCCCAACGA 180 Query 241 CAAAGTCATGGGACCTGGGGTTTCCTACTTGGTTCGGTACATGGGCTGTGTGGAGGTCTT 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 181 CAAAGTCATGGGACCTGGGGTTTCCTACTTGGTTCGGTACATGGGCTGTGTGGAGGTCTT 240 Query 301 ACAGTCAATGCGAGCCCTTGACTTCAATACCCGGACTCAGGTCACCAGGGAGGCCATCAG 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 241 ACAGTCAATGCGAGCCCTTGACTTCAATACCCGGACTCAGGTCACCAGGGAGGCCATCAG 300 Query 361 TTTGGTGTGTGAAGCTGTGCCTGGTGCCAAAGGGGCGACAAGGAGGAGAAAGCCTTGTAG 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 301 TTTGGTGTGTGAAGCTGTGCCTGGTGCCAAAGGGGCGACAAGGAGGAGAAAGCCTTGTAG 360 Query 421 CCGCCCACTCAGCTCCATCCTGGGGAGGAGTAACCTGAAGTTTGCTGGAATGCCAATCAC 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 361 CCGCCCACTCAGCTCCATCCTGGGGAGGAGTAACCTGAAGTTTGCTGGAATGCCAATCAC 420 Query 481 TCTCACTGTGTCTACCAGCAGCCTTAACCTCATGGCAGCCGACTGCAAACAGATCATTGC 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 421 TCTCACTGTGTCTACCAGCAGCCTTAACCTCATGGCAGCCGACTGCAAACAGATCATTGC 480 Query 541 CAACCATCACATGCAATCTATCTCTTTCGCGTCCGGTGGGGATCCGGACACAGCTGAGTA 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 481 CAACCATCACATGCAATCTATCTCTTTCGCGTCCGGTGGGGATCCGGACACAGCTGAGTA 540 Query 601 TGTTGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCATATCCTGGAGTGTCC 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 541 TGTTGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCATATCCTGGAGTGTCC 600 Query 661 TGAAGGGCTTGCTCAGGATGTCATCAGCACCATCGGGCAGGCCTTTGAGTTGCGCTTCAA 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 601 TGAAGGGCTTGCTCAGGATGTCATCAGCACCATCGGGCAGGCCTTTGAGTTGCGCTTCAA 660 Query 721 ACAGTATCTCAGGAATCCACCGAAGCTGGTCACCCCCCATGACAGGATGGCTGGCTTTGA 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 661 ACAGTATCTCAGGAATCCACCGAAGCTGGTCACCCCCCATGACAGGATGGCTGGCTTTGA 720 Query 781 TGGCTCAGCTTGGGATGAGGAGGAAGAAGAGCCCCCTGACCATCAGTACTACAATGACTT 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 721 TGGCTCAGCTTGGGATGAGGAGGAAGAAGAGCCCCCTGACCATCAGTACTACAATGACTT 780 Query 841 TCCAGGGAAGGAACCCCCTCTTGGTGGGGTGGTAGATATGAGGCTTCGGGAAGGGGCTGC 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 781 TCCAGGGAAGGAACCCCCTCTTGGTGGGGTGGTAGATATGAGGCTTCGGGAAGGGGCTGC 840 Query 901 TCGACCCACTCTGCCTAGTGCCCAGATGTCCAGCCACTTGGGAGCTACACTGCCTATAGG 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 841 TCGACCCACTCTGCCTAGTGCCCAGATGTCCAGCCACTTGGGAGCTACACTGCCTATAGG 900 Query 961 GCAGCATGCTGCAGGAGACCATGAAGTCCGTAAACAGATGTTGCCTCCGCCGCCTTGCCC 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 901 GCAGCATGCTGCAGGAGACCATGAAGTCCGTAAACAGATGTTGCCTCCGCCGCCTTGCCC 960 Query 1021 AGGCAGAGAACTCTTCGATGACCCCTCCTATGTCAACATCCAGAATCTAGACAAGGCCCG 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 961 AGGCAGAGAACTCTTCGATGACCCCTCCTATGTCAACATCCAGAATCTAGACAAGGCCCG 1020 Query 1081 GCAGGCTGGGGGTGGGGCTGGGCCCCCAAATCCTTCTCTTAATGGCAGTGCACCCCGAGA 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1021 GCAGGCTGGGGGTGGGGCTGGGCCCCCAAATCCTTCTCTTAATGGCAGTGCACCCCGAGA 1080 Query 1141 CCTTTTTGACATGAAGCCCTTTGAAGATGCACTTCGGGTGCCACCCCCACCGCAGTCCAT 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1081 CCTTTTTGACATGAAGCCCTTTGAAGATGCACTTCGGGTGCCACCCCCACCGCAGTCCAT 1140 Query 1201 GTCCATGGCTGAGCAGCTGCAAGGGGAGCCCTGGTTCCACGGGAAGCTGAGCCGGAGGGA 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1141 GTCCATGGCTGAGCAGCTGCAAGGGGAGCCCTGGTTCCACGGGAAGCTGAGCCGGAGGGA 1200 Query 1261 GGCCGAGGCGCTGCTGCAGCTCAATGGTGACTTCTTGGTGCGAGAGAGCACGACCACGCC 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1201 GGCCGAGGCGCTGCTGCAGCTCAATGGTGACTTCTTGGTGCGAGAGAGCACGACCACGCC 1260 Query 1321 TGGCCAGTATGTGCTCACTGGCCTGCAGAGTGGGCAGCCCAAGCACTTGCTGCTGGTGGA 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1261 TGGCCAGTATGTGCTCACTGGCCTGCAGAGTGGGCAGCCCAAGCACTTGCTGCTGGTGGA 1320 Query 1381 CCCTGAAGGTGTGGTTCGGACAAAGGATCACCGCTTTGAGAGTGTCAGTCACCTGATCAG 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1321 CCCTGAAGGTGTGGTTCGGACAAAGGATCACCGCTTTGAGAGTGTCAGTCACCTGATCAG 1380 Query 1441 CTACCACATGGACAATCACTTGCCCATCATCTCTGCGGGCAGCGAACTGTGCCTACAGCA 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1381 CTACCACATGGACAATCACTTGCCCATCATCTCTGCGGGCAGCGAACTGTGCCTACAGCA 1440 Query 1501 ACCCGTGGATCGGAAAGTGTGA 1522 |||||||||||||||||||||| Sbjct 1441 ACCCGTGGATCGGAAAGTGTGA 1462 >gb|U46956.2|MMU46956 GeoGene info Mus musculus src homology collagen protein 66 kDa isoform gene, partial cds Length=1739 Score = 2606 bits (1411), Expect = 0.0 Identities = 1411/1411 (100%), Gaps = 0/1411 (0%) Strand=Plus/Plus Query 109 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCT 168 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 327 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCT 386 Query 169 GGGGGGCGAGGAGTGGACCAGACACGGGAGCTTTGTCAATAAGCCCACACGAGGCTGGCT 228 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 387 GGGGGGCGAGGAGTGGACCAGACACGGGAGCTTTGTCAATAAGCCCACACGAGGCTGGCT 446 Query 229 GCATCCCAACGACAAAGTCATGGGACCTGGGGTTTCCTACTTGGTTCGGTACATGGGCTG 288 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 447 GCATCCCAACGACAAAGTCATGGGACCTGGGGTTTCCTACTTGGTTCGGTACATGGGCTG 506 Query 289 TGTGGAGGTCTTACAGTCAATGCGAGCCCTTGACTTCAATACCCGGACTCAGGTCACCAG 348 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 507 TGTGGAGGTCTTACAGTCAATGCGAGCCCTTGACTTCAATACCCGGACTCAGGTCACCAG 566 Query 349 GGAGGCCATCAGTTTGGTGTGTGAAGCTGTGCCTGGTGCCAAAGGGGCGACAAGGAGGAG 408 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 567 GGAGGCCATCAGTTTGGTGTGTGAAGCTGTGCCTGGTGCCAAAGGGGCGACAAGGAGGAG 626 Query 409 AAAGCCTTGTAGCCGCCCACTCAGCTCCATCCTGGGGAGGAGTAACCTGAAGTTTGCTGG 468 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 627 AAAGCCTTGTAGCCGCCCACTCAGCTCCATCCTGGGGAGGAGTAACCTGAAGTTTGCTGG 686 Query 469 AATGCCAATCACTCTCACTGTGTCTACCAGCAGCCTTAACCTCATGGCAGCCGACTGCAA 528 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 687 AATGCCAATCACTCTCACTGTGTCTACCAGCAGCCTTAACCTCATGGCAGCCGACTGCAA 746 Query 529 ACAGATCATTGCCAACCATCACATGCAATCTATCTCTTTCGCGTCCGGTGGGGATCCGGA 588 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 747 ACAGATCATTGCCAACCATCACATGCAATCTATCTCTTTCGCGTCCGGTGGGGATCCGGA 806 Query 589 CACAGCTGAGTATGTTGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCATAT 648 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 807 CACAGCTGAGTATGTTGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCATAT 866 Query 649 CCTGGAGTGTCCTGAAGGGCTTGCTCAGGATGTCATCAGCACCATCGGGCAGGCCTTTGA 708 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 867 CCTGGAGTGTCCTGAAGGGCTTGCTCAGGATGTCATCAGCACCATCGGGCAGGCCTTTGA 926 Query 709 GTTGCGCTTCAAACAGTATCTCAGGAATCCACCGAAGCTGGTCACCCCCCATGACAGGAT 768 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 927 GTTGCGCTTCAAACAGTATCTCAGGAATCCACCGAAGCTGGTCACCCCCCATGACAGGAT 986 Query 769 GGCTGGCTTTGATGGCTCAGCTTGGGATGAGGAGGAAGAAGAGCCCCCTGACCATCAGTA 828 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 987 GGCTGGCTTTGATGGCTCAGCTTGGGATGAGGAGGAAGAAGAGCCCCCTGACCATCAGTA 1046 Query 829 CTACAATGACTTTCCAGGGAAGGAACCCCCTCTTGGTGGGGTGGTAGATATGAGGCTTCG 888 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1047 CTACAATGACTTTCCAGGGAAGGAACCCCCTCTTGGTGGGGTGGTAGATATGAGGCTTCG 1106 Query 889 GGAAGGGGCTGCTCGACCCACTCTGCCTAGTGCCCAGATGTCCAGCCACTTGGGAGCTAC 948 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1107 GGAAGGGGCTGCTCGACCCACTCTGCCTAGTGCCCAGATGTCCAGCCACTTGGGAGCTAC 1166 Query 949 ACTGCCTATAGGGCAGCATGCTGCAGGAGACCATGAAGTCCGTAAACAGATGTTGCCTCC 1008 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1167 ACTGCCTATAGGGCAGCATGCTGCAGGAGACCATGAAGTCCGTAAACAGATGTTGCCTCC 1226 Query 1009 GCCGCCTTGCCCAGGCAGAGAACTCTTCGATGACCCCTCCTATGTCAACATCCAGAATCT 1068 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1227 GCCGCCTTGCCCAGGCAGAGAACTCTTCGATGACCCCTCCTATGTCAACATCCAGAATCT 1286 Query 1069 AGACAAGGCCCGGCAGGCTGGGGGTGGGGCTGGGCCCCCAAATCCTTCTCTTAATGGCAG 1128 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1287 AGACAAGGCCCGGCAGGCTGGGGGTGGGGCTGGGCCCCCAAATCCTTCTCTTAATGGCAG 1346 Query 1129 TGCACCCCGAGACCTTTTTGACATGAAGCCCTTTGAAGATGCACTTCGGGTGCCACCCCC 1188 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1347 TGCACCCCGAGACCTTTTTGACATGAAGCCCTTTGAAGATGCACTTCGGGTGCCACCCCC 1406 Query 1189 ACCGCAGTCCATGTCCATGGCTGAGCAGCTGCAAGGGGAGCCCTGGTTCCACGGGAAGCT 1248 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1407 ACCGCAGTCCATGTCCATGGCTGAGCAGCTGCAAGGGGAGCCCTGGTTCCACGGGAAGCT 1466 Query 1249 GAGCCGGAGGGAGGCCGAGGCGCTGCTGCAGCTCAATGGTGACTTCTTGGTGCGAGAGAG 1308 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1467 GAGCCGGAGGGAGGCCGAGGCGCTGCTGCAGCTCAATGGTGACTTCTTGGTGCGAGAGAG 1526 Query 1309 CACGACCACGCCTGGCCAGTATGTGCTCACTGGCCTGCAGAGTGGGCAGCCCAAGCACTT 1368 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1527 CACGACCACGCCTGGCCAGTATGTGCTCACTGGCCTGCAGAGTGGGCAGCCCAAGCACTT 1586 Query 1369 GCTGCTGGTGGACCCTGAAGGTGTGGTTCGGACAAAGGATCACCGCTTTGAGAGTGTCAG 1428 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1587 GCTGCTGGTGGACCCTGAAGGTGTGGTTCGGACAAAGGATCACCGCTTTGAGAGTGTCAG 1646 Query 1429 TCACCTGATCAGCTACCACATGGACAATCACTTGCCCATCATCTCTGCGGGCAGCGAACT 1488 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1647 TCACCTGATCAGCTACCACATGGACAATCACTTGCCCATCATCTCTGCGGGCAGCGAACT 1706 Query 1489 GTGCCTACAGCAACCCGTGGATCGGAAAGTG 1519 ||||||||||||||||||||||||||||||| Sbjct 1707 GTGCCTACAGCAACCCGTGGATCGGAAAGTG 1737 >ref|XR_002563.1| UniGene infoGene info PREDICTED: Mus musculus similar to src homology 2 domain-containing transforming protein C1 (LOC669532), mRNA Length=1301 Score = 2220 bits (1202), Expect = 0.0 Identities = 1272/1305 (97%), Gaps = 7/1305 (0%) Strand=Plus/Plus Query 992 AAACAGATGTTGCCTCCGCCGCCTTGCCCAGGCAGAGAACTCTTCGATGACCCCTCCTAT 1051 ||||||||| |||||||||| | |||| |||||||||||||||||||||||||||||||| Sbjct 1 AAACAGATGGTGCCTCCGCCACGTTGCGCAGGCAGAGAACTCTTCGATGACCCCTCCTAT 60 Query 1052 GTCAACATCCAGAATCTAGACAAGGCCCGGCAGGCTGGGGGTGGGGCTGGGC-CCCCAAA 1110 |||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||| Sbjct 61 GTCAACATCCAGAATCTAGACAAGGCCCGGCAGGCTGGGGGTGGGGCT-GGCGCCCCAAA 119 Query 1111 T-CCTTCTCTTAATGGCAGTGCACCCCGAGACCTTTTTGACATGAAGCCCTTTGAAGATG 1169 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 120 TCCCTTCTCTTAATGGCAGTGCACCCCGAGACCTTTTTGACATGAAGCCCTTTGAAGATA 179 Query 1170 CACTTCGGGTGCCACCCCCACCGCAGTCCATGTCCATGGCTGAGCAGCTGCAAGGGGAGC 1229 |||||||||||||| |||||| ||||||||||| |||||||||||||||||||||||||| Sbjct 180 CACTTCGGGTGCCATCCCCACTGCAGTCCATGTTCATGGCTGAGCAGCTGCAAGGGGAGC 239 Query 1230 CCTGGTTCCACGGGAAGCTGAGCCGGAGGGAGGCCGAGGCGCTGCTGCAGCTCAATGGTG 1289 ||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||| Sbjct 240 CCTGGTTCCACGGGAAGCTGAGCCGGAGGGAGGCCAAGGCACTGCTGCAGCTCAATGGTG 299 Query 1290 ACTTCTTGGTGCGAGAGAGCACGACCACGCCTGGCCAGTATGTGCTCACTGGCCTGCAGA 1349 |||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||| Sbjct 300 ACTTCTTGGTGCGAGAGAGCACGACCACACCTGGCCAGTATGTGCTCACTGACCTGCAGA 359 Query 1350 GTGGGCAGCCCAAGCACTTGCTGCTGGTGGACCCTGAAGGTGTGGTTCGGACAAAGGATC 1409 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 360 GTGGGCAGCCCAAGCACTTGCTGCTGGTGGACCCTGAAGGTGTGGTTCGGACAAAGGATC 419 Query 1410 ACCGCTTTGAGAGTGTCAGTCACCTGATCAGCTACCACATGGACAATCACTTGCCCATCA 1469 || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 420 ACTGCTTTGAGAGTGTCAGTCACCTGATCAGCTACCACATGGACAATCACTTGCCCATCA 479 Query 1470 TCTCTGCGGGCAGCGAACTGTGCCTACAGCAACCCGTGGATCGGAAAGTGTGATCCTTCT 1529 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 480 TCTCTGCGGGCAGCGAACTGTGCCTACAGCAACCCGTGGATCGGAAAGTGTGATCCTTCT 539 Query 1530 CAGCTTCTCCAACAGGATGCTCTCCATTTCCGTCTCCCGTATTCTCTAACTTGTGGGACC 1589 |||||||||||||| |||||||| |||| |||| |||| ||||||||||||||||||||| Sbjct 540 CAGCTTCTCCAACAAGATGCTCTTCATTCCCGTTTCCCATATTCTCTAACTTGTGGGACC 599 Query 1590 TCTGTTTTGTGGGTCTGGCCTTGGGTGGGAACTGGGAGCAACGAGGACATGGGTTTAGTG 1649 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 600 TCTGTTTTGTGGGTCTGGCCTTGGGTGGGAACTGGGAGCAACGAGGACATGGGTTTAGTG 659 Query 1650 CCCACTTGAGAGAGAGAAAAAGAGGGTTTCAGTAAGGAGCCTGGGGTAGCATCCTGCCTC 1709 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 660 CCCACTTGAGAGAGAGAAAAAGAGGGTTTCAGTAAGGAGCCTGGGGTAGCATCCTGCCTC 719 Query 1710 TGGCCAAACTTCACCAAAGTATTAATGTGCAGAGTGGTCCCTTGTCTGGGCCTTGCCTGT 1769 || ||||||||||||||||||||||| |||||||||||||||||||||||||| |||||| Sbjct 720 TGCCCAAACTTCACCAAAGTATTAATATGCAGAGTGGTCCCTTGTCTGGGCCT-GCCTGT 778 Query 1770 GCCAACCTGATGCCCTTcccccccAAAGGGTGGGTTCTTATAATGGAAAATGCCCTGTGA 1829 |||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||| Sbjct 779 GCCAACCTGATGCCGTTCCCCCC-AAAGGGTGGGTTCTTATAATGGAAAATGCCCTGTGA 837 Query 1830 TGATAGGCCCAGTGGAGCAACTGCCCTTTGGGGGAAGGGAAATAATTATACCTCTGGTTT 1889 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 838 TGATAGGCCCAGTGGAGCAACTGCCCTTTGGGGGAAGGGAAATAATTATACCTCTGGTTT 897 Query 1890 ACTCCTGGGTCTTCAGGGTACCCCAGATCCCGC-ATAACATATCCCACTCCCTCTGCTTC 1948 ||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||| Sbjct 898 ACTCCTGGGTCTTCAGGGTACCCCAGATCCCGCGA-AACATATCCCACTCCCTCTGCTTC 956 Query 1949 CCCTTAAACTTTGTGCCTTTGACTATCATAGGTCTGCAGATACTTAATGCAGAGTTCTCA 2008 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 957 CCCTTAAACTTTGTGCCTTTGACTATCATAGGTCTGCAGATACTTAATGCAGAGTTCTCA 1016 Query 2009 GGCCCTTCACGTGTGGACAGGGGTTACTGCCACCTTGGCTTCTGGAGCCCTGTCCTATTC 2068 ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1017 GGCTCTTCACGTGTGGACAGGGGTTACTGCCACCTTGGCTTCTGGAGCCCTGTCCTATTC 1076 Query 2069 AGCACCCCTTCCTGTGTCTAGGGAGAATAGGGACAGGAGTGGCCGCTATCTGCTCTGCCT 2128 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1077 AGCACCCCTTCCTGTGTCTAGGGAGAATAGGGACAGGAGTGGCCGCTATCTGCTCTGCCT 1136 Query 2129 TTCGGATGTGCAGCCCTTAAGAGATTGCCCCAAGCCTGAATATGGTGGCGCACGCCTTTA 2188 |||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||| Sbjct 1137 TTCGGATGTGCAGCCCTTAAGAGATTGCCCCAAGCCAGAATATGGTGGCACACGCCTTTA 1196 Query 2189 ATCACAGCACTCAGGAGGCAGAGACAGGAGGAATTGTGAGGCCATCCGATCTACAACAGA 2248 |||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||| Sbjct 1197 ATCACAGCACTCAGGAGGCAGAGACAGGAGGATTTGTGAGGCCATCCCATCTACAACAGA 1256 Query 2249 GTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAACCTGTCTCC 2293 ||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1257 GTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAACCTGTCTCC 1301 >ref|NM_003029.3| UniGene infoGeoGene info Homo sapiens SHC (Src homology 2 domain containing) transforming protein 1 (SHC1), transcript variant 2, mRNA gb|BC014158.2| UniGene infoGeoGene info Homo sapiens SHC (Src homology 2 domain containing) transforming protein 1, mRNA (cDNA clone MGC:20839 IMAGE:4541216), complete cds Length=3076 Score = 2034 bits (1101), Expect = 0.0 Identities = 1637/1886 (86%), Gaps = 76/1886 (4%) Strand=Plus/Plus Query 9 GGGTCCTGGGGTGAAAGTTGGGGCGGTGACTTAAGCAGACAGTTGCGTGATCCGGAACCA 68 ||| || |||| ||||||||| ||||| || ||||| | |||| ||||||||||| |||| Sbjct 18 GGG-CCCGGGGAGAAAGTTGGAGCGGTAACCTAAGCTGGCAGTGGCGTGATCCGGCACCA 76 Query 69 GATCGGCCCGCGGTGCGGTGCGGAGACTCCATGAGACCCTGGACATGAACAAGCTGAGTG 128 |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| Sbjct 77 AATCGGCCCGCGGTGCGGTGCGGAGACTCCATGAGGCCCTGGACATGAACAAGCTGAGTG 136 Query 129 GAGGCGGCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCTGGGGGGCGAGGAGTGGACCA 188 ||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||| Sbjct 137 GAGGCGGCGGGCGCAGGACTCGGGTGGAAGGGGGCCAGCTTGGGGGCGAGGAGTGGACCC 196 Query 189 GACACGGGAGCTTTGTCAATAAGCCCACACGAGGCTGGCTGCATCCCAACGACAAAGTCA 248 | |||||||||||||||||||||||||| || |||||||||||||||||||||||||||| Sbjct 197 GCCACGGGAGCTTTGTCAATAAGCCCACGCGGGGCTGGCTGCATCCCAACGACAAAGTCA 256 Query 249 TGGGACCTGGGGTTTCCTACTTGGTTCGGTACATGGGCTGTGTGGAGGTCTTACAGTCAA 308 ||||||| ||||||||||||||||||||||||||||| |||||||||||| | ||||||| Sbjct 257 TGGGACCCGGGGTTTCCTACTTGGTTCGGTACATGGGTTGTGTGGAGGTCCTCCAGTCAA 316 Query 309 TGCGAGCCCTTGACTTCAATACCCGGACTCAGGTCACCAGGGAGGCCATCAGTTTGGTGT 368 |||| ||||| |||||||| ||||||||||||||||||||||||||||||||| |||||| Sbjct 317 TGCGTGCCCTGGACTTCAACACCCGGACTCAGGTCACCAGGGAGGCCATCAGTCTGGTGT 376 Query 369 GTGAAGCTGTGCCTGGTGCCAAAGGGGCGACAAGGAGGAGAAAGCCTTGTAGCCGCCCAC 428 |||| |||||||| ||||| || ||||||||||||||||||||||| ||||||||||| | Sbjct 377 GTGAGGCTGTGCCGGGTGCTAAGGGGGCGACAAGGAGGAGAAAGCCCTGTAGCCGCCCGC 436 Query 429 TCAGCTCCATCCTGGGGAGGAGTAACCTGAAGTTTGCTGGAATGCCAATCACTCTCACTG 488 ||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| | Sbjct 437 TCAGCTCTATCCTGGGGAGGAGTAACCTGAAATTTGCTGGAATGCCAATCACTCTCACCG 496 Query 489 TGTCTACCAGCAGCCTTAACCTCATGGCAGCCGACTGCAAACAGATCATTGCCAACCATC 548 | || ||||||||||| ||||||||||| || ||||||||||||||||| |||||||| | Sbjct 497 TCTCCACCAGCAGCCTCAACCTCATGGCCGCAGACTGCAAACAGATCATCGCCAACCACC 556 Query 549 ACATGCAATCTATCTC-TTTCGCGTCCGGTGGGGATCCGGACACAGCTGAGTATGTTGCC 607 |||||||||||||||| ||| || ||||| ||||||||||||||||| |||||||| ||| Sbjct 557 ACATGCAATCTATCTCATTT-GCATCCGGCGGGGATCCGGACACAGCCGAGTATGTCGCC 615 Query 608 TATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCATATCCTGGAGTGTCCTGAAGGG 667 |||||||||||||||||||||||||||||||||||||| || ||||||||||| |||||| Sbjct 616 TATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCACATTCTGGAGTGTCCCGAAGGG 675 Query 668 CTTGCTCAGGATGTCATCAGCACCATCGGGCAGGCCTTTGAGTTGCGCTTCAAACAGTAT 727 ||||| |||||||||||||||||||| || |||||||| ||||||||||||||||| || Sbjct 676 CTTGCCCAGGATGTCATCAGCACCATTGGCCAGGCCTTCGAGTTGCGCTTCAAACAATAC 735 Query 728 CTCAGGAATCCACCGAAGCTGGTCACCCCCCATGACAGGATGGCTGGCTTTGATGGCTCA 787 |||||||| ||||| || ||||||||||| |||||||||||||||||||||||||||||| Sbjct 736 CTCAGGAACCCACCCAAACTGGTCACCCCTCATGACAGGATGGCTGGCTTTGATGGCTCA 795 Query 788 GCTTGGGATGAGGAGGAAGAAGAGCCCCCTGACCATCAGTACTACAATGACTTTCCAGGG 847 || |||||||||||||| |||||||| ||||||||||||||||| |||||||| || ||| Sbjct 796 GCATGGGATGAGGAGGAGGAAGAGCCACCTGACCATCAGTACTATAATGACTTCCCGGGG 855 Query 848 AAGGAACCCCCTCTTGGTGGGG-TGGTAGATATGAGGCTTCGGGAAGG-G--GCT---G- 899 ||||||||||| ||||| |||| ||||||| ||||||||||||||||| | ||| | Sbjct 856 AAGGAACCCCC-CTTGGGGGGGGTGGTAGACATGAGGCTTCGGGAAGGAGCCGCTCCAGG 914 Query 900 --CT-C--GACCCACT-CTGCCTAGTGCCCAGATGTCCAGCCACTTGGGAGCTACACTGC 953 || | |||||||| | || | |||||||| |||||||||||||||||||| ||| Sbjct 915 GGCTGCTCGACCCACTGCACCCAA-TGCCCAGACCCCCAGCCACTTGGGAGCTACATTGC 973 Query 954 CTATAGGGCAGCATGCTGCAGGAGA-CCATGAAGTCCGTAAACAGATGTTGCCTCCGCCG 1012 || |||| |||| || || ||||| ||| |||||||| ||||||||| ||||| || Sbjct 974 CTGTAGGACAGCCTGTTGGGGGAGATCCA-GAAGTCCGCAAACAGATGCCACCTCCACCA 1032 Query 1013 CCTTG-CC--CAGGCAGAGAACTCTTCGATGACCCCTCCTATGTCAACATCCAGAATCTA 1069 || || || |||||||||| || || ||||| ||||||||||||||| ||||||| ||| Sbjct 1033 CCCTGTCCAGCAGGCAGAGAGCTTTTTGATGATCCCTCCTATGTCAACGTCCAGAACCTA 1092 Query 1070 GACAAGGCCCGGCAGGCTGGGGGTGGGGCTGGGCCCCCAAATCCTTCTCTTAATGGCAGT 1129 |||||||||||||| || | |||||| ||||||||||| |||||| || | ||||||||| Sbjct 1093 GACAAGGCCCGGCAAGCAGTGGGTGGTGCTGGGCCCCCCAATCCTGCTATCAATGGCAGT 1152 Query 1130 GCACCCCGAGACCTTTTTGACATGAAGCCCTTTGAAGATGCACTTCGGGTGCCACCCCCA 1189 |||||||| ||||| ||||||||||||||||| |||||||| ||||| ||||| || || Sbjct 1153 GCACCCCGGGACCTGTTTGACATGAAGCCCTTCGAAGATGCTCTTCGCGTGCCTCCACCT 1212 Query 1190 CCGCAGTCCATGTCCATGGCTGAGCAGCTGCAAGGGGAGCCCTGGTTCCACGGGAAGCTG 1249 || ||||| ||||||||||||||||||| | |||||||||||||||||| ||||||||| Sbjct 1213 CCCCAGTCGGTGTCCATGGCTGAGCAGCTCCGAGGGGAGCCCTGGTTCCATGGGAAGCTG 1272 Query 1250 AGCCGGAGGGAGGCCGAGGCGCTGCTGCAGCTCAATGGTGACTTCTTGGTGCGAGAGAGC 1309 |||||| ||||||| ||||| ||||||||||||||||| |||||| |||| || |||||| Sbjct 1273 AGCCGGCGGGAGGCTGAGGCACTGCTGCAGCTCAATGGGGACTTCCTGGTACGGGAGAGC 1332 Query 1310 ACGACCACGCCTGGCCAGTATGTGCTCACTGGCCTGCAGAGTGGGCAGCCCAAGCACTTG 1369 |||||||| |||||||||||||||||||||||| |||||||||||||||| ||||| ||| Sbjct 1333 ACGACCACACCTGGCCAGTATGTGCTCACTGGCTTGCAGAGTGGGCAGCCTAAGCATTTG 1392 Query 1370 CTGCTGGTGGACCCTGAAGGTGTGGTTCGGACAAAGGATCACCGCTTTGAGAGTGTCAGT 1429 || |||||||||||||| |||||||||||||| ||||||||||||||||| ||||||||| Sbjct 1393 CTACTGGTGGACCCTGAGGGTGTGGTTCGGACTAAGGATCACCGCTTTGAAAGTGTCAGT 1452 Query 1430 CACCTGATCAGCTACCACATGGACAATCACTTGCCCATCATCTCTGCGGGCAGCGAACTG 1489 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1453 CACCTTATCAGCTACCACATGGACAATCACTTGCCCATCATCTCTGCGGGCAGCGAACTG 1512 Query 1490 TGCCTACAGCAACCCGTGGATCGGAAAGTGTGATCCTTCTC-AGC--T-TCT-CCA-ACA 1543 || ||||||||||| ||||| |||||| ||||||| | | | ||| | ||| ||| | | Sbjct 1513 TGTCTACAGCAACCTGTGGAGCGGAAACTGTGATC-TGCCCTAGCGCTCTCTTCCAGA-A 1570 Query 1544 GGATGCTCTCCATTTCCGT-CT-CCCGTATTCTCTAACT-TGTGGGACCTC-T--G---- 1593 | |||| ||||| | || | | ||| ||||| |||||| | |||||||| | | Sbjct 1571 G-ATGCCCTCCAAT-CCTTTCCACCC-TATTCCCTAACTCTC-GGGACCTCGTTTGGGAG 1626 Query 1594 T-TT-TGTGGGTCT-GGCCTTGGGTGGGAACTGGGAGCAACGA-GGACA-TGGGTTT-AG 1647 | || |||||| || ||||||| || || ||||||| | | | |||| ||||||| | Sbjct 1627 TGTTCTGTGGG-CTTGGCCTTGTGTCAGAGCTGGGAGTAGC-ATGGACTCTGGGTTTCA- 1683 Query 1648 TGCCCA-CTTGAGAGAGAGAAAAAGAGGGTTTCAGT-AAGGAGCCTGGG-GTAGCATCCT 1704 | ||| || ||| ||||| | | ||| ||| || |||||||| | || ||||| Sbjct 1684 TATCCAGCT-GAGTGAGAG-----G-G--TTTGAGTCAAA-AGCCTGGGTG-AGAATCCT 1732 Query 1705 GCCTCTGGCCAAAC-TT---CACCAAAGTATTAATGTGCAGAGTGGTCCCTTGTCTGGGC 1760 |||||| |||||| || ||||||||||||||||| |||||||| |||| |||||| Sbjct 1733 GCCTCTCCCCAAACATTAATCACCAAAGTATTAATGTACAGAGTGGCCCCTCACCTGGGC 1792 Query 1761 CTTGCCTGTGCCAACCTGATGCCC-TTcccccccAAAGGGTGGGTTCTTATAATGGAAAA 1819 ||| |||||||||||||||||||| |||||| || || || || ||| | |||||||| Sbjct 1793 CTTTCCTGTGCCAACCTGATGCCCCTTCCCCAAGAA-GG-TGAGTGCTTGTCATGGAAAA 1850 Query 1820 TGCCCTGTGATGATAGGCCCAGTGGA 1845 || |||||| ||| |||||||||||| Sbjct 1851 TGTCCTGTGGTGACAGGCCCAGTGGA 1876 >emb|X68148.1|HSSHC UniGene infoGeoGene info H.sapiens SHC mRNA Length=3031 Score = 2028 bits (1098), Expect = 0.0 Identities = 1619/1861 (86%), Gaps = 73/1861 (3%) Strand=Plus/Plus Query 31 GCGGTGACTTAAGCAGACAGTTGCGTGATCCGGAACCAGATCGGCCCGCGGTGCGGTGCG 90 ||||| || ||||| | |||| ||||||||||| |||| ||||||||||||||| ||||| Sbjct 1 GCGGTAACCTAAGCTGGCAGTGGCGTGATCCGGCACCAAATCGGCCCGCGGTGC-GTGCG 59 Query 91 GAGACTCCATGAGACCCTGGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCG 150 ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| Sbjct 60 GAGACTCCATGAGGCCCTGGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCG 119 Query 151 GGTAGAAGGGGGCCAGCTGGGGGGCGAGGAGTGGACCAGACACGGGAGCTTTGTCAATAA 210 ||| |||||||||||||| |||||||||||||||||| | |||||||||||||||||||| Sbjct 120 GGTGGAAGGGGGCCAGCTTGGGGGCGAGGAGTGGACCCGCCACGGGAGCTTTGTCAATAA 179 Query 211 GCCCACACGAGGCTGGCTGCATCCCAACGACAAAGTCATGGGACCTGGGGTTTCCTACTT 270 |||||| || ||||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct 180 GCCCACGCGGGGCTGGCTGCATCCCAACGACAAAGTCATGGGACCCGGGGTTTCCTACTT 239 Query 271 GGTTCGGTACATGGGCTGTGTGGAGGTCTTACAGTCAATGCGAGCCCTTGACTTCAATAC 330 ||||||||||||||| |||||||||||| | ||||||||||| ||||| |||||||| || Sbjct 240 GGTTCGGTACATGGGTTGTGTGGAGGTCCTCCAGTCAATGCGTGCCCTGGACTTCAACAC 299 Query 331 CCGGACTCAGGTCACCAGGGAGGCCATCAGTTTGGTGTGTGAAGCTGTGCCTGGTGCCAA 390 ||||||||||||||||||||||||||||||| |||||||||| |||||||| ||||| || Sbjct 300 CCGGACTCAGGTCACCAGGGAGGCCATCAGTCTGGTGTGTGAGGCTGTGCCGGGTGCTAA 359 Query 391 AGGGGCGACAAGGAGGAGAAAGCCTTGTAGCCGCCCACTCAGCTCCATCCTGGGGAGGAG 450 ||||||||||||||||||||||| ||||||||||| |||||||| |||||||||||||| Sbjct 360 GGGGGCGACAAGGAGGAGAAAGCCCTGTAGCCGCCCGCTCAGCTCTATCCTGGGGAGGAG 419 Query 451 TAACCTGAAGTTTGCTGGAATGCCAATCACTCTCACTGTGTCTACCAGCAGCCTTAACCT 510 ||||||||| |||||||||||||||||||||||||| || || ||||||||||| ||||| Sbjct 420 TAACCTGAAATTTGCTGGAATGCCAATCACTCTCACCGTCTCCACCAGCAGCCTCAACCT 479 Query 511 CATGGCAGCCGACTGCAAACAGATCATTGCCAACCATCACATGCAATCTATCTC-TTTCG 569 |||||| || ||||||||||||||||| |||||||| ||||||||||||||||| ||| | Sbjct 480 CATGGCCGCAGACTGCAAACAGATCATCGCCAACCACCACATGCAATCTATCTCATTT-G 538 Query 570 CGTCCGGTGGGGATCCGGACACAGCTGAGTATGTTGCCTATGTTGCCAAAGACCCTGTGA 629 | ||||| ||||||||||||||||| |||||||| ||||||||||||||||||||||||| Sbjct 539 CATCCGGCGGGGATCCGGACACAGCCGAGTATGTCGCCTATGTTGCCAAAGACCCTGTGA 598 Query 630 ATCAGAGAGCCTGCCATATCCTGGAGTGTCCTGAAGGGCTTGCTCAGGATGTCATCAGCA 689 |||||||||||||||| || ||||||||||| ||||||||||| |||||||||||||||| Sbjct 599 ATCAGAGAGCCTGCCACATTCTGGAGTGTCCCGAAGGGCTTGCCCAGGATGTCATCAGCA 658 Query 690 CCATCGGGCAGGCCTTTGAGTTGCGCTTCAAACAGTATCTCAGGAATCCACCGAAGCTGG 749 |||| || |||||||| ||||||||||||||||| || |||||||| ||||| || |||| Sbjct 659 CCATTGGCCAGGCCTTCGAGTTGCGCTTCAAACAATACCTCAGGAACCCACCCAAACTGG 718 Query 750 TCACCCCCCATGACAGGATGGCTGGCTTTGATGGCTCAGCTTGGGATGAGGAGGAAGAAG 809 ||||||| |||||||||||||||||||||||||||||||| |||||||||||||| |||| Sbjct 719 TCACCCCTCATGACAGGATGGCTGGCTTTGATGGCTCAGCATGGGATGAGGAGGAGGAAG 778 Query 810 AGCCCCCTGACCATCAGTACTACAATGACTTTCCAGGGAAGGAACCCCCTCTTGGTGGGG 869 |||| ||||||||||||||||| |||||||| || |||||||||||||| ||||| |||| Sbjct 779 AGCCACCTGACCATCAGTACTATAATGACTTCCCGGGGAAGGAACCCCC-CTTGGGGGGG 837 Query 870 -TGGTAGATATGAGGCTTCGGGAAGG-G--GCT---G---CT-C--GACCCACT-CTGCC 915 ||||||| ||||||||||||||||| | ||| | || | |||||||| | || Sbjct 838 GTGGTAGACATGAGGCTTCGGGAAGGAGCCGCTCCAGGGGCTGCTCGACCCACTGCACCC 897 Query 916 TAGTGCCCAGATGTCCAGCCACTTGGGAGCTACACTGCCTATAGGGCAGCATGCTGCAGG 975 | |||||||| |||||||||||||||||||| ||||| |||| |||| || || || Sbjct 898 AA-TGCCCAGACCCCCAGCCACTTGGGAGCTACATTGCCTGTAGGACAGCCTGTTGGGGG 956 Query 976 AGA-CCATGAAGTCCGTAAACAGATGTTGCCTCCGCCGCCTTGCCCAGGCAGAGAACTCT 1034 ||| ||| |||||||| ||||||||| ||||| || || || ||||||||||| || | Sbjct 957 AGATCCA-GAAGTCCGCAAACAGATGCCACCTCCACCACCCTGTCCAGGCAGAGAGCTTT 1015 Query 1035 TCGATGACCCCTCCTATGTCAACATCCAGAATCTAGACAAGGCCCGGCAGGCTGGGGGTG 1094 | ||||| ||||||||||||||| ||||||| ||||||||||||||||| || | ||||| Sbjct 1016 TTGATGATCCCTCCTATGTCAACGTCCAGAACCTAGACAAGGCCCGGCAAGCAGTGGGTG 1075 Query 1095 GGGCTGGGCCCCCAAATCCTTCTCTTAATGGCAGTGCACCCCGAGACCTTTTTGACATGA 1154 | ||||||||||| |||||| || | ||||||||||||||||| ||||| |||||||||| Sbjct 1076 GTGCTGGGCCCCCCAATCCTGCTATCAATGGCAGTGCACCCCGGGACCTGTTTGACATGA 1135 Query 1155 AGCCCTTTGAAGATGCACTTCGGGTGCCACCCCCACCGCAGTCCATGTCCATGGCTGAGC 1214 ||||||| |||||||| ||||||||||| || || || ||||| ||||||||||||||| Sbjct 1136 AGCCCTTCGAAGATGCTCTTCGGGTGCCTCCACCTCCCCAGTCGGTGTCCATGGCTGAGC 1195 Query 1215 AGCTGCAAGGGGAGCCCTGGTTCCACGGGAAGCTGAGCCGGAGGGAGGCCGAGGCGCTGC 1274 |||| | |||||||||||||||||| ||||||||||||||| ||||||| ||||| |||| Sbjct 1196 AGCTCCGAGGGGAGCCCTGGTTCCATGGGAAGCTGAGCCGGCGGGAGGCTGAGGCACTGC 1255 Query 1275 TGCAGCTCAATGGTGACTTCTTGGTGCGAGAGAGCACGACCACGCCTGGCCAGTATGTGC 1334 ||||||||||||| ||||||||||| || |||||||||||||| |||||||||||||||| Sbjct 1256 TGCAGCTCAATGGGGACTTCTTGGTACGGGAGAGCACGACCACACCTGGCCAGTATGTGC 1315 Query 1335 TCACTGGCCTGCAGAGTGGGCAGCCCAAGCACTTGCTGCTGGTGGACCCTGAAGGTGTGG 1394 |||||||| |||||||||||||||| ||||| ||||| |||||||||||||| ||||||| Sbjct 1316 TCACTGGCTTGCAGAGTGGGCAGCCTAAGCATTTGCTACTGGTGGACCCTGAGGGTGTGG 1375 Query 1395 TTCGGACAAAGGATCACCGCTTTGAGAGTGTCAGTCACCTGATCAGCTACCACATGGACA 1454 ||||||| ||||||||||||||||| |||||||||||||| ||||||||||||||||||| Sbjct 1376 TTCGGACTAAGGATCACCGCTTTGAAAGTGTCAGTCACCTTATCAGCTACCACATGGACA 1435 Query 1455 ATCACTTGCCCATCATCTCTGCGGGCAGCGAACTGTGCCTACAGCAACCCGTGGATCGGA 1514 ||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| |||| Sbjct 1436 ATCACTTGCCCATCATCTCTGCGGGCAGCGAACTGTGTCTACAGCAACCTGTGGAGCGGA 1495 Query 1515 AAGTGTGATCCTTCTC-AGC--T-TCT-CCA-ACAGGATGCTCTCCATTTCCGT-CT-CC 1566 || ||||||| | | | ||| | ||| ||| | || |||| ||||| | || | | || Sbjct 1496 AACTGTGATC-TGCCCTAGCGCTCTCTTCCAGA-AG-ATGCCCTCCAAT-CCTTTCCACC 1551 Query 1567 CGTATTCTCTAACT-TGTGGGACCTC-T--G----T-TT-TGTGGGTCT-GGCCTTGGGT 1615 | ||||| |||||| | |||||||| | | | || |||||| || ||||||| || Sbjct 1552 C-TATTCCCTAACTCTC-GGGACCTCGTTTGGGAGTGTTCTGTGGG-CTTGGCCTTGTGT 1608 Query 1616 GGGAACTGGGAGCAACGA-GGACA-TGGGTTT-AGTGCCCA-CTTGAGAGAGAGAAAAAG 1671 || ||||||| | | | |||| ||||||| | | ||| || ||| ||||| | Sbjct 1609 CAGAGCTGGGAGTAGC-ATGGACTCTGGGTTTCA-TATCCAGCT-GAGTGAGAG-----G 1660 Query 1672 AGGGTTTCAGT-AAGGAGCCTGGG-GTAGCATCCTGCCTCTGGCCAAAC-TT---CACCA 1725 | ||| ||| || |||||||| | || ||||||||||| |||||| || ||||| Sbjct 1661 -G--TTTGAGTCAAA-AGCCTGGGTG-AGAATCCTGCCTCTCCCCAAACATTAATCACCA 1715 Query 1726 AAGTATTAATGTGCAGAGTGGTCCCTTGTCTGGGCCTTGCCTGTGCCAACCTGATGCCC- 1784 |||||||||||| |||||||| |||| ||||||||| |||||||||||||||||||| Sbjct 1716 AAGTATTAATGTACAGAGTGGCCCCTCACCTGGGCCTTTCCTGTGCCAACCTGATGCCCC 1775 Query 1785 TTcccccccAAAGGGTGGGTTCTTATAATGGAAAATGCCCTGTGATGATAGGCCCAGTGG 1844 |||||| || || || || ||| | |||||||||| |||||| ||| ||||||||||| Sbjct 1776 TTCCCCAAGAA-GG-TGAGTGCTTGTCATGGAAAATGTCCTGTGGTGACAGGCCCAGTGG 1833 Query 1845 A 1845 | Sbjct 1834 A 1834 >ref|XM_001112447.1| UniGene infoGene info PREDICTED: Macaca mulatta similar to SHC (Src homology 2 domain containing) transforming protein 1 isoform p66Shc (LOC718982), mRNA Length=3779 Score = 1991 bits (1078), Expect = 0.0 Identities = 1794/2123 (84%), Gaps = 116/2123 (5%) Strand=Plus/Plus Query 109 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCT 168 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct 873 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTGGAAGGGGGCCAGCT 932 Query 169 GGGGGGCGAGGAGTGGACCAGACACGGGAGCTTTGTCAATAAGCCCACACGAGGCTGGCT 228 ||||||||||||||||||| | |||||||||||||||||||||||||| || |||||||| Sbjct 933 GGGGGGCGAGGAGTGGACCCGCCACGGGAGCTTTGTCAATAAGCCCACGCGGGGCTGGCT 992 Query 229 GCATCCCAACGACAAAGTCATGGGACCTGGGGTTTCCTACTTGGTTCGGTACATGGGCTG 288 ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| Sbjct 993 GCATCCCAACGACAAAGTCATGGGACCCGGGGTTTCCTACTTGGTTCGGTACATGGGCTG 1052 Query 289 TGTGGAGGTC-TTACAGTCAATGCGAGCCCTTGACTTCAATACCCGGACTCAGGTCACCA 347 |||||||||| || ||||||||||| ||||| |||||||| |||||||||||||| |||| Sbjct 1053 TGTGGAGGTCCTT-CAGTCAATGCGTGCCCTGGACTTCAACACCCGGACTCAGGTTACCA 1111 Query 348 GGGAGGCCATCAGTTTGGTGTGTGAAGCTGTGCCTGGTGCCAAAGGGGCGACAAGGAGGA 407 |||||||||||||| |||||||||| |||||||| ||||| || |||||||||||||||| Sbjct 1112 GGGAGGCCATCAGTCTGGTGTGTGAGGCTGTGCCGGGTGCTAAGGGGGCGACAAGGAGGA 1171 Query 408 GAAAGCCTTGTAGCCGCCCACTCAGCTCCATCCTGGGGAGGAGTAACCTGAAGTTTGCTG 467 ||||||| ||||||||||| |||||||| ||||||||||||||||||||||| ||||||| Sbjct 1172 GAAAGCCCTGTAGCCGCCCGCTCAGCTCTATCCTGGGGAGGAGTAACCTGAAATTTGCTG 1231 Query 468 GAATGCCAATCACTCTCACTGTGTCTACCAGCAGCCTTAACCTCATGGCAGCCGACTGCA 527 ||||||||||||||||||| || || ||||||||||| ||||||||||| || ||||||| Sbjct 1232 GAATGCCAATCACTCTCACCGTCTCCACCAGCAGCCTCAACCTCATGGCCGCAGACTGCA 1291 Query 528 AACAGATCATTGCCAACCATCACATGCAATCTATCTC-TTTCGCGTCCGGTGGGGATCCG 586 |||||||||| |||||||| ||||||||||||||||| ||| || ||||| ||||||||| Sbjct 1292 AACAGATCATCGCCAACCACCACATGCAATCTATCTCATTT-GCATCCGGCGGGGATCCG 1350 Query 587 GACACAGCTGAGTATGTTGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCAT 646 |||||||| |||||||| ||||| ||||||||||||||||||||||||||||||||||| Sbjct 1351 GACACAGCCGAGTATGTCGCCTACGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCAC 1410 Query 647 ATCCTGGAGTGTCCTGAAGGGCTTGCTCAGGATGTCATCAGCACCATCGGGCAGGCCTTT 706 || ||||||||||| ||||||||||| |||||||||||||||||||| || ||||||||| Sbjct 1411 ATTCTGGAGTGTCCCGAAGGGCTTGCCCAGGATGTCATCAGCACCATTGGCCAGGCCTTT 1470 Query 707 GAGTTGCGCTTCAAACAGTATCTCAGGAATCCACCGAAGCTGGTCACCCCCCATGACAGG 766 ||||||||||||||||| || |||||||| ||||| || ||||||||||| ||||||||| Sbjct 1471 GAGTTGCGCTTCAAACAATACCTCAGGAACCCACCCAAACTGGTCACCCCTCATGACAGG 1530 Query 767 ATGGCTGGCTTTGATGGCTCAGCTTGGGATGAGGAGGAAGAAGAGCCCCCTGACCATCAG 826 ||||||||||||||||||||||| |||||||||||||| |||||||| |||||||||||| Sbjct 1531 ATGGCTGGCTTTGATGGCTCAGCGTGGGATGAGGAGGAGGAAGAGCCACCTGACCATCAG 1590 Query 827 TACTACAATGACTTTCCAGGGAAGGAACCCCCTCTTGGTGGGGTGGTAGATATGAGGCTT 886 ||||| |||||||| || |||||||||||||| || |||||||||||||| ||||||||| Sbjct 1591 TACTATAATGACTTCCCGGGGAAGGAACCCCCCCTGGGTGGGGTGGTAGACATGAGGCTT 1650 Query 887 CGGGAAGGGGCTGCTCGA----C--C-C-A-CT-CTGC-CT-AGTGCCCAGATGTCC-AG 933 |||||||| ||||||| | | | | | | |||| | |||||||||| || || Sbjct 1651 CGGGAAGGAGCTGCTCCAGGGGCTGCTCGATCCACTGCACCCAGTGCCCAGACC-CCTAG 1709 Query 934 CCACTTGGGAGCTACACTGCCTATAGGGCAGCATGCTGCAGGAGA-CCATGAAGTCCGTA 992 |||||||||||||||||||||| |||| |||| || || ||||| ||| |||||||| | Sbjct 1710 CCACTTGGGAGCTACACTGCCTGTAGGACAGCCTGTTGGGGGAGATCCA-GAAGTCCGAA 1768 Query 993 AACAGATGTTGCCTCCGCCGCCTTGCCCAGGCAGAGAACTCTTCGATGACCCCTCCTATG 1052 |||||||| ||||| || || || ||||||||||| ||||| || || |||||||||| Sbjct 1769 AACAGATGCCACCTCCACCACCCTGTCCAGGCAGAGAGCTCTTTGACGATCCCTCCTATG 1828 Query 1053 TCAACATCCAGAATCTAGACAAGGCCCGGCAGGCTGGGGGTGGGGCTGGGC-CCCCAAAT 1111 ||||| ||||||| |||||||||| |||||| || | |||||| ||||||| |||||| | Sbjct 1829 TCAACGTCCAGAACCTAGACAAGGTCCGGCAAGCAGTGGGTGGTGCTGGGCTCCCCAA-T 1887 Query 1112 CCTTCTCTTAATGGCAGTGCACCCCGAGACCTTTTTGACATGAAGCCCTTTGAAGATGCA 1171 ||| || | ||||||||||||||||| ||||| ||||| |||||||||||||||||||| Sbjct 1888 CCTGCTGTCAATGGCAGTGCACCCCGTGACCTGTTTGATATGAAGCCCTTTGAAGATGCT 1947 Query 1172 CTTCGGGTGCCACCCCCACCGCAGTCCA-TGTCCATGGCTGAGCAGCTGCAAGGGGAGCC 1230 ||||||||||| || || || ||||| | ||||||||||||||||||| | ||||||||| Sbjct 1948 CTTCGGGTGCCTCCACCTCCCCAGTC-AGTGTCCATGGCTGAGCAGCTCCGAGGGGAGCC 2006 Query 1231 CTGGTTCCACGGGAAGCTGAGCCGGAGGGAGGCCGAGGCGCTGCTGCAGCTCAATGGTGA 1290 ||||||||| ||||||||||| ||| ||||||| ||||| |||||||||||||| || || Sbjct 2007 CTGGTTCCATGGGAAGCTGAGTCGGCGGGAGGCTGAGGCACTGCTGCAGCTCAACGGGGA 2066 Query 1291 CTTCTTGGTGCGAGAGAGCACGACCACGCCTGGCCAGTATGTGCTCACTGGCCTGCAGAG 1350 |||| ||||||| |||||||||||||| |||||||||||||||||||||||| ||||||| Sbjct 2067 CTTCCTGGTGCGGGAGAGCACGACCACACCTGGCCAGTATGTGCTCACTGGCTTGCAGAG 2126 Query 1351 TGGGCAGCCCAAGCA-CTTGCTGCTGGTGGACCCTGAAGGTGTGGTTCGGACAAAGGATC 1409 ||||||||||||||| || ||| |||||||||||||| |||||||||||||| ||||||| Sbjct 2127 TGGGCAGCCCAAGCATCT-GCTACTGGTGGACCCTGAGGGTGTGGTTCGGACTAAGGATC 2185 Query 1410 ACCGCTTTGAGAGTGTCAGTCACCTGATCAGCTACCACATGGACAATCACTTGCCCATCA 1469 ||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||| Sbjct 2186 ACCGCTTTGAGAGTGTCAGTCACCTCATCAGCTACCATATGGACAATCACTTGCCCATCA 2245 Query 1470 TCTCTGCGGGCAGCGAACTGTGCCTACAGCAACCCGTGGATCGGAAAGTGTGATCCTTCT 1529 |||||||||||||||||||||| ||||||||||| ||||| |||||| ||||||| | | Sbjct 2246 TCTCTGCGGGCAGCGAACTGTGTCTACAGCAACCTGTGGAGCGGAAACTGTGATC-TGCC 2304 Query 1530 C-AG-C-T-TCT-CCA-ACAGGATGCTCTCCATTTCCGTCT-CCCGTATTCTCTAACT-T 1581 | || | | ||| ||| | || |||| ||||| | || || ||| ||||| |||||| | Sbjct 2305 CCAGACCTCTCTTCCAGA-AG-ATGCCCTCCAATCCCTTCCACCC-TATTCCCTAACTCT 2361 Query 1582 GTGGGACCTC-T--G----T-TT-TGTGGGTCT-GGCCTTGGGTGGGAACTGGGAGCAAC 1631 ||||||||| | | | || |||||| || ||||||| || || ||||||| | Sbjct 2362 -TGGGACCTCATTTGGGAGTGTTCTGTGGG-CTTGGCCTTGTGTCAGAGCTGGGAGTAGT 2419 Query 1632 GAGGACA-TGGGTTT-AGTGCCCA-CTTGAGAGAGAGAAAAAGAGGGTTTCAGTAAGGAG 1688 | |||| ||||||| | | ||| || ||| ||| | |||||||| ||| || || Sbjct 2420 GTGGACTCTGGGTTTCA-TATCCAGCT-GAGTGAGGGTTT--GAGGGTTTGAGTCAGAAG 2475 Query 1689 CCTGGGGTAGCATCCTGCCTCTGGCCAAAC-TT---CACCAAAGTATTAATGTGCAGAGT 1744 ||||||| || ||||||||||| |||||| || ||||||||||||||||| |||||| Sbjct 2476 CCTGGGGGAGAATCCTGCCTCTCCCCAAACATTGATCACCAAAGTATTAATGTACAGAGT 2535 Query 1745 GGTCCCTTGTC-TGGGCCTTGCCTGTGCCAACCTGATGCCC-TTcccccccAAAGGGTGG 1802 || ||||| | |||||||| |||||||||||||||||||| |||||| |||| || Sbjct 2536 GG-CCCTTCACCTGGGCCTTTCCTGTGCCAACCTGATGCCCCTTCCCCAAGAAAG--TGA 2592 Query 1803 GTTCTTATAATGGAAAATGCCCTGTGATGATAGGCCCAGTGGAGCAA-CTGCCCTTTGGG 1861 || || | |||||||||| |||||| ||| |||||||||||| || | |||||| || Sbjct 2593 GTGGTTGTCATGGAAAATGTCCTGTGGTGACAGGCCCAGTGGAACAGTCA-CCCTTTTGG 2651 Query 1862 GGAAGGGA-AATAATTATACCTCTGGTTTACTCCTGGGTCTTCAGGGTACCCCAGATCCC 1920 | ||||| || || || | | ||| ||| | |||||||||| |||||| ||| Sbjct 2652 GCAAGGGGGAACAA--AT-CA-C------ACTTCTGCG-CTTCAGGGTATCCCAGA-CCC 2699 Query 1921 G-CAT-AACATATCCCACTCCCTCTGCTTCCCCTTAAACTTTGTGCCTTTGACTATCA-T 1977 | | |||| ||||| ||| | | | |||||||||||||||||||| ||| | Sbjct 2700 TTC-TCAACACC-CCCAC-CCCAC--CATGT--TTAAACTTTGTGCCTTTGACCATCTCT 2752 Query 1978 -AGGTCTGCA-GATACTTAATGCAGAGTTCTCAGGCCCTTCACGTG---TGGACAGGGGT 2032 ||||||| | |||| || |||||||||||| ||||| | | || || |||||| | Sbjct 2753 TAGGTCTG-ATGATATTTTATGCAGAGTTCTTGGGCCCCTGA-GTTCAATG-ACAGGGAT 2809 Query 2033 TACTGCCACCTT---GGCTTCTGGAGCCCTGTCCTATT-C--AGCACCCCTTCCTGT--G 2084 | | ||||| ||||||||| | |||||| | || | ||||| | |||| || | Sbjct 2810 GCCAAC-ACCTTCTTGGCTTCTGG-GACCTGTCTTCTTGCTCAGCACTCTTTCCGGTTTG 2867 Query 2085 -TCTAGGGAGAATAG-GGACAGGAGTGGCCGCTATCTGCTCTGCCTTTCGGATGTGCAGC 2142 | | |||| || || || |||||||||| ||| || |||| ||| |||| |||| | Sbjct 2868 GTTT-GGGATAACAGAGG-CAGGAGTGGCAGCTGTCCCCTCTCCCTGG-GGATATGCAAC 2924 Query 2143 CCTTAAGAGATTGCCCCA-AGCC 2164 ||||| |||||||||||| |||| Sbjct 2925 CCTTA-GAGATTGCCCCAGAGCC 2946 >ref|XM_513843.2| Gene info PREDICTED: Pan troglodytes SHC (Src homology 2 domain containing) transforming protein 1 (SHC1), mRNA Length=3252 Score = 1947 bits (1054), Expect = 0.0 Identities = 1551/1782 (87%), Gaps = 70/1782 (3%) Strand=Plus/Plus Query 109 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCT 168 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct 239 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTGGAAGGGGGCCAGCT 298 Query 169 GGGGGGCGAGGAGTGGACCAGACACGGGAGCTTTGTCAATAAGCCCACACGAGGCTGGCT 228 |||||||||||||||||| | |||||||||||||||||||||||||| || |||||||| Sbjct 299 TGGGGGCGAGGAGTGGACCCGCCACGGGAGCTTTGTCAATAAGCCCACGCGGGGCTGGCT 358 Query 229 GCATCCCAACGACAAAGTCATGGGACCTGGGGTTTCCTACTTGGTTCGGTACATGGGCTG 288 ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| Sbjct 359 GCATCCCAACGACAAAGTCATGGGACCCGGGGTTTCCTACTTGGTTCGGTACATGGGCTG 418 Query 289 TGTGGAGGTCTTACAGTCAATGCGAGCCCTTGACTTCAATACCCGGACTCAGGTCACCAG 348 |||||||||| | ||||||||||| ||||| |||||||| |||||||||||||||||||| Sbjct 419 TGTGGAGGTCCTCCAGTCAATGCGTGCCCTGGACTTCAACACCCGGACTCAGGTCACCAG 478 Query 349 GGAGGCCATCAGTTTGGTGTGTGAAGCTGTGCCTGGTGCCAAAGGGGCGACAAGGAGGAG 408 ||||||||||||| |||||||||| |||||||| ||||| || ||||||||||||||||| Sbjct 479 GGAGGCCATCAGTCTGGTGTGTGAGGCTGTGCCAGGTGCTAAGGGGGCGACAAGGAGGAG 538 Query 409 AAAGCCTTGTAGCCGCCCACTCAGCTCCATCCTGGGGAGGAGTAACCTGAAGTTTGCTGG 468 |||||| ||||||||||| |||||||| ||||||||||||||||||||||| |||||||| Sbjct 539 AAAGCCCTGTAGCCGCCCGCTCAGCTCTATCCTGGGGAGGAGTAACCTGAAATTTGCTGG 598 Query 469 AATGCCAATCACTCTCACTGTGTCTACCAGCAGCCTTAACCTCATGGCAGCCGACTGCAA 528 |||||||||||||||||| || || ||||||||||| ||||||||||| || |||||||| Sbjct 599 AATGCCAATCACTCTCACCGTCTCCACCAGCAGCCTCAACCTCATGGCCGCAGACTGCAA 658 Query 529 ACAGATCATTGCCAACCATCACATGCAATCTATCTC-TTTCGCGTCCGGTGGGGATCCGG 587 ||||||||| |||||||| ||||||||||||||||| ||| || ||||| |||||||||| Sbjct 659 ACAGATCATCGCCAACCACCACATGCAATCTATCTCATTT-GCATCCGGCGGGGATCCGG 717 Query 588 ACACAGCTGAGTATGTTGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCATA 647 ||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| | Sbjct 718 ACACAGCCGAGTATGTCGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCACA 777 Query 648 TCCTGGAGTGTCCTGAAGGGCTTGCTCAGGATGTCATCAGCACCATCGGGCAGGCCTTTG 707 | ||||||||||| ||||||||||| |||||||||||||||||||| || |||||||| | Sbjct 778 TTCTGGAGTGTCCCGAAGGGCTTGCCCAGGATGTCATCAGCACCATTGGCCAGGCCTTCG 837 Query 708 AGTTGCGCTTCAAACAGTATCTCAGGAATCCACCGAAGCTGGTCACCCCCCATGACAGGA 767 |||||||||||||||| || |||||||| ||||| || ||||||||||| |||||||||| Sbjct 838 AGTTGCGCTTCAAACAATACCTCAGGAACCCACCCAAACTGGTCACCCCTCATGACAGGA 897 Query 768 TGGCTGGCTTTGATGGCTCAGCTTGGGATGAGGAGGAAGAAGAGCCCCCTGACCATCAGT 827 |||||||||||||||||||||| |||||||||||||| |||||||| ||||||||||||| Sbjct 898 TGGCTGGCTTTGATGGCTCAGCATGGGATGAGGAGGAGGAAGAGCCACCTGACCATCAGT 957 Query 828 ACTACAATGACTTTCCAGGGAAGGAACCCCCTCTTGGTGGGG-TGGTAGATATGAGGCTT 886 |||| |||||||| || |||||||||||||| ||||| |||| ||||||| ||||||||| Sbjct 958 ACTATAATGACTTCCCGGGGAAGGAACCCCC-CTTGGGGGGGGTGGTAGACATGAGGCTT 1016 Query 887 CGGGAAGG-G--GCT---G---CT-C--GACCCACT-CTGCCTAGTGCCCAGATGTCCAG 933 |||||||| | ||| | || | |||||||| | || | |||||||| |||| Sbjct 1017 CGGGAAGGAGCCGCTCCAGGGGCTGCTCGACCCACTGCACCCAA-TGCCCAGACCCCCAG 1075 Query 934 CCACTTGGGAGCTACACTGCCTATAGGGCAGCATGCTGCAGGAGA-CCATGAAGTCCGTA 992 |||||||||||||||||||||| |||| |||| || || ||||| ||| |||||||| | Sbjct 1076 CCACTTGGGAGCTACACTGCCTGTAGGACAGCCTGTTGGGGGAGATCCA-GAAGTCCGCA 1134 Query 993 AACAGATGTTGCCTCCGCCGCCTTGCCCAGGCAGAGAACTCTTCGATGACCCCTCCTATG 1052 |||||||| ||||| || || || ||||||||||| || || ||||| |||||||||| Sbjct 1135 AACAGATGCCACCTCCACCACCCTGTCCAGGCAGAGAGCTTTTTGATGATCCCTCCTATG 1194 Query 1053 TCAACATCCAGAATCTAGACAAGGCCCGGCAGGCTGGGGGTGGGGCTGGGCCCCCAAATC 1112 ||||| ||||||| ||||||||||||||||| || | |||||| ||||||||||| |||| Sbjct 1195 TCAACGTCCAGAACCTAGACAAGGCCCGGCAAGCAGTGGGTGGTGCTGGGCCCCCCAATC 1254 Query 1113 CTTCTCTTAATGGCAGTGCACCCCGAGACCTTTTTGACATGAAGCCCTTTGAAGATGCAC 1172 || || | |||||||||| |||||| ||||| ||||||||||||||||| |||||||| | Sbjct 1255 CTGCTGTCAATGGCAGTGTACCCCGGGACCTGTTTGACATGAAGCCCTTCGAAGATGCTC 1314 Query 1173 TTCGGGTGCCACCCCCACCGCAGTCCATGTCCATGGCTGAGCAGCTGCAAGGGGAGCCCT 1232 |||||||||| || || || ||||| ||||||||||||||||||| | ||||||||||| Sbjct 1315 TTCGGGTGCCTCCACCTCCCCAGTCGGTGTCCATGGCTGAGCAGCTCCGAGGGGAGCCCT 1374 Query 1233 GGTTCCACGGGAAGCTGAGCCGGAGGGAGGCCGAGGCGCTGCTGCAGCTCAATGGTGACT 1292 ||||||| ||||||||||||||| ||||||| ||||| ||||||||||||||||| |||| Sbjct 1375 GGTTCCATGGGAAGCTGAGCCGGCGGGAGGCTGAGGCACTGCTGCAGCTCAATGGGGACT 1434 Query 1293 TCTTGGTGCGAGAGAGCACGACCACGCCTGGCCAGTATGTGCTCACTGGCCTGCAGAGTG 1352 || ||||||| |||||||||||||| |||||||||||||||||||||||| ||||||||| Sbjct 1435 TCCTGGTGCGGGAGAGCACGACCACACCTGGCCAGTATGTGCTCACTGGCTTGCAGAGTG 1494 Query 1353 GGCAGCCCAAGCACTTGCTGCTGGTGGACCCTGAAGGTGTGGTTCGGACAAAGGATCACC 1412 ||||||| ||||| ||||| |||||||||||||| |||||||||||||| |||||||||| Sbjct 1495 GGCAGCCTAAGCATTTGCTACTGGTGGACCCTGAGGGTGTGGTTCGGACTAAGGATCACC 1554 Query 1413 GCTTTGAGAGTGTCAGTCACCTGATCAGCTACCACATGGACAATCACTTGCCCATCATCT 1472 ||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct 1555 GCTTTGAAAGTGTCAGTCACCTTATCAGCTACCACATGGACAATCACTTGCCCATCATCT 1614 Query 1473 CTGCGGGCAGCGAACTGTGCCTACAGCAACCCGTGGATCGGAAAGTGTGATCCTTCTC-A 1531 ||||||||||||||||||| ||||||||||| ||||| |||||| ||||||| | | | | Sbjct 1615 CTGCGGGCAGCGAACTGTGTCTACAGCAACCTGTGGAGCGGAAACTGTGATC-TGCCCTA 1673 Query 1532 GC--T-TCT-CCA-ACAGGATGCTCTCCATTTCCGT-CT-CCCGTATTCTCTAACT-TGT 1583 || | ||| ||| | || |||| ||||| | || | | ||| ||||| |||||| | Sbjct 1674 GCGCTCTCTTCCAGA-AG-ATGCCCTCCAAT-CCTTTCCACCC-TATTCCCTAACTCTC- 1728 Query 1584 GGGACCTC-T--G----T-TT-TGTGGGTCT-GGCCTTGGGTGGGAACTGGGAGCAACGA 1633 |||||||| | | | || |||||| || ||||||| || || ||||||| | | | Sbjct 1729 GGGACCTCGTTTGGGAGTGTTCTGTGGG-CTTGGCCTTGTGTCAGAGCTGGGAGTAGC-A 1786 Query 1634 -GGACA-TGGGTTT-AGTGCCCA-CTTGAGAGAGAGAAAAAGAGGGTTTCAGTAAGGAGC 1689 |||| ||||||| | | ||| || ||| ||||| | | ||| ||| || ||| Sbjct 1787 TGGACTCTGGGTTTCA-TATCCAGCT-GAGTGAGAG-----G-G--TTTGAGTCAGAAGC 1836 Query 1690 CTGGG-GTAGCATCCTGCCTCTGGCCAAAC-TT---CACCAAAGTATTAATGTGCAGAGT 1744 ||||| | || ||||||||||| |||||| || ||||||||||||||||| |||||| Sbjct 1837 CTGGGTG-AGAATCCTGCCTCTCCCCAAACATTAATCACCAAAGTATTAATGTACAGAGT 1895 Query 1745 GGTCCCTTGTCTGGGCCTTGCCTGTGCCAACCTGATGCCC-TTcccccccAAAGGGTGGG 1803 || |||| ||||||||| |||||||||||||||||||| |||||| || || || | Sbjct 1896 GGCCCCTCACCTGGGCCTTTCCTGTGCCAACCTGATGCCCCTTCCCCAAGAA-GG-TGAG 1953 Query 1804 TTCTTATAATGGAAAATGCCCTGTGATGATAGGCCCAGTGGA 1845 | ||| | |||||||||| |||||| ||| |||||||||||| Sbjct 1954 TGCTTGTCATGGAAAATGTCCTGTGGTGACAGGCCCAGTGGA 1995 >gb|U73377.1|HSU73377 GeoGene info Human p66shc (SHC) mRNA, complete cds Length=3664 Score = 1936 bits (1048), Expect = 0.0 Identities = 1550/1783 (86%), Gaps = 72/1783 (4%) Strand=Plus/Plus Query 109 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCT 168 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct 521 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTGGAAGGGGGCCAGCT 580 Query 169 GGGGGGCGAGGAGTGGACCAGACACGGGAGCTTTGTCAATAAGCCCACACGAGGCTGGCT 228 |||||||||||||||||| | |||||||||||||||||||||||||| || |||||||| Sbjct 581 TGGGGGCGAGGAGTGGACCCGCCACGGGAGCTTTGTCAATAAGCCCACGCGGGGCTGGCT 640 Query 229 GCATCCCAACGACAAAGTCATGGGACCTGGGGTTTCCTACTTGGTTCGGTACATGGGCTG 288 ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| || Sbjct 641 GCATCCCAACGACAAAGTCATGGGACCCGGGGTTTCCTACTTGGTTCGGTACATGGGTTG 700 Query 289 TGTGGAGGTCTTACAGTCAATGCGAGCCCTTGACTTCAATACCCGGACTCAGGTCACCAG 348 |||||||||| | ||||||||||| ||||| |||||||| |||||||||||||||||||| Sbjct 701 TGTGGAGGTCCTCCAGTCAATGCGTGCCCTGGACTTCAACACCCGGACTCAGGTCACCAG 760 Query 349 GGAGGCCATCAGTTTGGTGTGTGAAGCTGTGCCTGGTGCCAAAGGGGCGACAAGGAGGAG 408 ||||||||||||| |||||||||| |||||||| ||||| || ||||||||||||||||| Sbjct 761 GGAGGCCATCAGTCTGGTGTGTGAGGCTGTGCCGGGTGCTAAGGGGGCGACAAGGAGGAG 820 Query 409 AAAGCCTTGTAGCCGCCCACTCAGCTCCATCCTGGGGAGGAGTAACCTGAAGTTTGCTGG 468 |||||| ||||||||||| |||||||| ||||||||||||||||||||||| |||||||| Sbjct 821 AAAGCCCTGTAGCCGCCCGCTCAGCTCTATCCTGGGGAGGAGTAACCTGAAATTTGCTGG 880 Query 469 AATGCCAATCACTCTCACTGTGTCTACCAGCAGCCTTAACCTCATGGCAGCCGACTGCAA 528 |||||||||||||||||| || || ||||||||||| ||||||||||| || |||||||| Sbjct 881 AATGCCAATCACTCTCACCGTCTCCACCAGCAGCCTCAACCTCATGGCCGCAGACTGCAA 940 Query 529 ACAGATCATTGCCAACCATCACATGCAATCTATCTC-TTTCGCGTCCGGTGGGGATCCGG 587 ||||||||| |||||||| ||||||||||||||||| ||| || ||||| |||||||||| Sbjct 941 ACAGATCATCGCCAACCACCACATGCAATCTATCTCATTT-GCATCCGGCGGGGATCCGG 999 Query 588 ACACAGCTGAGTATGTTGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCATA 647 ||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| | Sbjct 1000 ACACAGCCGAGTATGTCGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCACA 1059 Query 648 TCCTGGAGTGTCCTGAAGGGCTTGCTCAGGATGTCATCAGCACCATCGGGCAGGCCTTTG 707 | ||||||||||| ||||||||||| |||||||||||||||||||| || |||||||| | Sbjct 1060 TTCTGGAGTGTCCCGAAGGGCTTGCCCAGGATGTCATCAGCACCATTGGCCAGGCCTTCG 1119 Query 708 AGTTGCGCTTCAAACAGTATCTCAGGAATCCACCGAAGCTGGTCACCCCCCATGACAGGA 767 |||||||||||||||| || |||||||| ||||| || ||||||||||| |||||||||| Sbjct 1120 AGTTGCGCTTCAAACAATACCTCAGGAACCCACCCAAACTGGTCACCCCTCATGACAGGA 1179 Query 768 TGGCTGGCTTTGATGGCTCAGCTTGGGATGAGGAGGAAGAAGAGCCCCCTGACCATCAGT 827 |||||||||||||||||||||| |||||||||||||| |||||||| ||||||||||||| Sbjct 1180 TGGCTGGCTTTGATGGCTCAGCATGGGATGAGGAGGAGGAAGAGCCACCTGACCATCAGT 1239 Query 828 ACTACAATGACTTTCCAGGGAAGGAACCCCCTCTTGGTGGGG-TGGTAGATATGAGGCTT 886 |||| |||||||| || |||||||||||||| ||||| |||| ||||||| ||||||||| Sbjct 1240 ACTATAATGACTTCCCGGGGAAGGAACCCCC-CTTGGGGGGGGTGGTAGACATGAGGCTT 1298 Query 887 CGGGAAGG-G--GCT---G---CT-C--GACCCACT-CTGCCTAGTGCCCAGATGTCCAG 933 |||||||| | ||| | || | |||||||| | || | |||||||| |||| Sbjct 1299 CGGGAAGGAGCCGCTCCAGGGGCTGCTCGACCCACTGCACCCAA-TGCCCAGACCCCCAG 1357 Query 934 CCACTTGGGAGCTACACTGCCTATAGGGCAGCATGCTGCAGGAGA-CCATGAAGTCCGTA 992 |||||||||||||||| ||||| |||| |||| || || ||||| ||| |||||||| | Sbjct 1358 CCACTTGGGAGCTACATTGCCTGTAGGACAGCCTGTTGGGGGAGATCCA-GAAGTCCGCA 1416 Query 993 AACAGATGTTGCCTCCGCCGCCTTGCCCAGGCAGAGAACTCTTCGATGACCCCTCCTATG 1052 |||||||| ||||| || || || ||||||||||| || || ||||| |||||||||| Sbjct 1417 AACAGATGCCACCTCCACCACCCTGTCCAGGCAGAGAGCTTTTTGATGATCCCTCCTATG 1476 Query 1053 TCAACATCCAGAATCTAGACAAGGCCCGGCAGGCTGGGGGTGGGGCTGGGCCCCCAAATC 1112 ||||| ||||||| ||||||||||||||||| || | |||||| ||||||||||| |||| Sbjct 1477 TCAACGTCCAGAACCTAGACAAGGCCCGGCAAGCAGTGGGTGGTGCTGGGCCCCCCAATC 1536 Query 1113 CTTCTCTTAATGGCAGTGCACCCCGAGACCTTTTTGACATGAAGCCCTTTGAAGATGCAC 1172 || || | ||||||||||||||||| ||||| ||||||||||||||||| |||||||| | Sbjct 1537 CTGCTATCAATGGCAGTGCACCCCGGGACCTGTTTGACATGAAGCCCTTCGAAGATGCTC 1596 Query 1173 TTCGGGTGCCACCCCCACCGCAGTCCATGTCCATGGCTGAGCAGCTGCAAGGGGAGCCCT 1232 |||||||||| || || || ||||| ||||||||||||||||||| | ||||||||||| Sbjct 1597 TTCGGGTGCCTCCACCTCCCCAGTCGGTGTCCATGGCTGAGCAGCTCCGAGGGGAGCCCT 1656 Query 1233 GGTTCCACGGGAAGCTGAGCCGGAGGGAGGCCGAGGCGCTGCTGCAGCTCAATGGTGACT 1292 ||||||| ||||||||||||||| ||||||| ||||| ||||||||||||||||| |||| Sbjct 1657 GGTTCCATGGGAAGCTGAGCCGGCGGGAGGCTGAGGCACTGCTGCAGCTCAATGGGGACT 1716 Query 1293 TCTTGGTGCGAGAGAGCACGACCACGCCTGGCCAGTATGTGCTCACTGGCCTGCAGAGTG 1352 ||||||| || |||||||||||||| |||||||||||||||||||||||| ||||||||| Sbjct 1717 TCTTGGTACGGGAGAGCACGACCACACCTGGCCAGTATGTGCTCACTGGCTTGCAGAGTG 1776 Query 1353 GGCAGCCCAAGCACTTGCTGCTGGTGGACCCTGAAGGTGTGGTTCGGACAAAGGATCACC 1412 ||||||| ||||| ||||| |||||||||||||| |||||||||||||| |||||||||| Sbjct 1777 GGCAGCCTAAGCATTTGCTACTGGTGGACCCTGAGGGTGTGGTTCGGACTAAGGATCACC 1836 Query 1413 GCTTTGAGAGTGTCAGTCACCTGATCAGCTACCACATGGACAATCACTTGCCCATCATCT 1472 ||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct 1837 GCTTTGAAAGTGTCAGTCACCTTATCAGCTACCACATGGACAATCACTTGCCCATCATCT 1896 Query 1473 CTGCGGGCAGCGAACTGTGCCTACAGCAACCCGTGGATCGGAAAGTGTGATCCTTCTC-A 1531 ||||||||||||||||||| ||||||||||| ||||| |||||| ||||||| | | | | Sbjct 1897 CTGCGGGCAGCGAACTGTGTCTACAGCAACCTGTGGAGCGGAAACTGTGATC-TGCCCTA 1955 Query 1532 GC--T-TCT-CCA-ACAGGATGCTCTCCATTTCCGT-CT-CCCGTATTCTCTAACT-TGT 1583 || | ||| ||| | || |||| ||||| | || | | ||| ||||| |||||| | Sbjct 1956 GCGCTCTCTTCCAGA-AG-ATGCCCTCCAAT-CCTTTCCACCC-TATTCCCTAACTCTC- 2010 Query 1584 GGGACCTC-T--G----T-TT-TGTGGGTCT-GGCCTTGGGTGGGAACTGGGAGCAACGA 1633 |||||||| | | | || |||||| || ||||||| || || ||||||| | | | Sbjct 2011 GGGACCTCGTTTGGGAGTGTTCTGTGGG-CTTGGCCTTGTGTCAGAGCTGGGAGTAGC-A 2068 Query 1634 -GGACA-TGGGTTT-AGTGCCCA-CTTGAGAGAGAGAAAAAGAGGGTTTCAGT-AAGGAG 1688 |||| ||||||| | | ||| || ||| ||||| | | ||| ||| || || Sbjct 2069 TGGACTCTGGGTTTCA-TATCCAGCT-GAGTGAGAG-----G-G--TTTGAGTCAAA-AG 2117 Query 1689 CCTGGG-GTAGCATCCTGCCTCTGGCCAAAC-TT---CACCAAAGTATTAATGTGCAGAG 1743 |||||| | || ||||||||||| |||||| || ||||||||||||||||| ||||| Sbjct 2118 CCTGGGTG-AGAATCCTGCCTCTCCCCAAACATTAATCACCAAAGTATTAATGTACAGAG 2176 Query 1744 TGGTCCCTTGTCTGGGCCTTGCCTGTGCCAACCTGATGCCC-TTcccccccAAAGGGTGG 1802 ||| |||| ||||||||| |||||||||||||||||||| |||||| || || || Sbjct 2177 TGGCCCCTCACCTGGGCCTTTCCTGTGCCAACCTGATGCCCCTTCCCCAAGAA-GG-TGA 2234 Query 1803 GTTCTTATAATGGAAAATGCCCTGTGATGATAGGCCCAGTGGA 1845 || ||| | |||||||||| |||||| ||| |||||||||||| Sbjct 2235 GTGCTTGTCATGGAAAATGTCCTGTGGTGACAGGCCCAGTGGA 2277 >emb|BX647136.1|HSM807280 UniGene infoGene info Homo sapiens mRNA; cDNA DKFZp686J19171 (from clone DKFZp686J19171) Length=3409 Score = 1930 bits (1045), Expect = 0.0 Identities = 1549/1783 (86%), Gaps = 72/1783 (4%) Strand=Plus/Plus Query 109 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCT 168 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct 464 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTGGAAGGGGGCCAGCT 523 Query 169 GGGGGGCGAGGAGTGGACCAGACACGGGAGCTTTGTCAATAAGCCCACACGAGGCTGGCT 228 |||||||||||||||||| | |||||||||||||||||||||||||| || |||||||| Sbjct 524 TGGGGGCGAGGAGTGGACCCGCCACGGGAGCTTTGTCAATAAGCCCACGCGGGGCTGGCT 583 Query 229 GCATCCCAACGACAAAGTCATGGGACCTGGGGTTTCCTACTTGGTTCGGTACATGGGCTG 288 ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| || Sbjct 584 GCATCCCAACGACAAAGTCATGGGACCCGGGGTTTCCTACTTGGTTCGGTACATGGGTTG 643 Query 289 TGTGGAGGTCTTACAGTCAATGCGAGCCCTTGACTTCAATACCCGGACTCAGGTCACCAG 348 |||||||||| | ||||||||||| ||||| |||||||| |||||||||||||||||||| Sbjct 644 TGTGGAGGTCCTCCAGTCAATGCGTGCCCTGGACTTCAACACCCGGACTCAGGTCACCAG 703 Query 349 GGAGGCCATCAGTTTGGTGTGTGAAGCTGTGCCTGGTGCCAAAGGGGCGACAAGGAGGAG 408 ||||||||||||| |||||||||| |||||||| |||||||| ||||||||||||||||| Sbjct 704 GGAGGCCATCAGTCTGGTGTGTGAGGCTGTGCCGGGTGCCAAGGGGGCGACAAGGAGGAG 763 Query 409 AAAGCCTTGTAGCCGCCCACTCAGCTCCATCCTGGGGAGGAGTAACCTGAAGTTTGCTGG 468 |||||| ||||||||||| |||||||| ||||||||||||||||||||||| |||||||| Sbjct 764 AAAGCCCTGTAGCCGCCCGCTCAGCTCTATCCTGGGGAGGAGTAACCTGAAATTTGCTGG 823 Query 469 AATGCCAATCACTCTCACTGTGTCTACCAGCAGCCTTAACCTCATGGCAGCCGACTGCAA 528 |||||||||||||||||| || || ||||||||||| ||||||||||| || |||||||| Sbjct 824 AATGCCAATCACTCTCACCGTCTCCACCAGCAGCCTCAACCTCATGGCCGCAGACTGCAA 883 Query 529 ACAGATCATTGCCAACCATCACATGCAATCTATCTC-TTTCGCGTCCGGTGGGGATCCGG 587 ||||||||| |||||||| ||||||||||||||||| ||| || ||||| |||||||||| Sbjct 884 ACAGATCATCGCCAACCACCACATGCAATCTATCTCATTT-GCATCCGGCGGGGATCCGG 942 Query 588 ACACAGCTGAGTATGTTGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCATA 647 ||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| | Sbjct 943 ACACAGCCGAGTATGTCGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCACA 1002 Query 648 TCCTGGAGTGTCCTGAAGGGCTTGCTCAGGATGTCATCAGCACCATCGGGCAGGCCTTTG 707 | ||||||||||| ||||||||||| |||||||||||||||||||| || |||||||| | Sbjct 1003 TTCTGGAGTGTCCCGAAGGGCTTGCCCAGGATGTCATCAGCACCATTGGCCAGGCCTTCG 1062 Query 708 AGTTGCGCTTCAAACAGTATCTCAGGAATCCACCGAAGCTGGTCACCCCCCATGACAGGA 767 |||||||||||||||| || |||||||| ||||| || ||||||||||| |||||||||| Sbjct 1063 AGTTGCGCTTCAAACAATACCTCAGGAACCCACCCAAACTGGTCACCCCTCATGACAGGA 1122 Query 768 TGGCTGGCTTTGATGGCTCAGCTTGGGATGAGGAGGAAGAAGAGCCCCCTGACCATCAGT 827 |||||||||||||||||||||| |||||||||||||| |||||||| ||||||||||||| Sbjct 1123 TGGCTGGCTTTGATGGCTCAGCATGGGATGAGGAGGAGGAAGAGCCACCTGACCATCAGT 1182 Query 828 ACTACAATGACTTTCCAGGGAAGGAACCCCCTCTTGGTGGGG-TGGTAGATATGAGGCTT 886 |||| |||||||| || |||||||||||||| ||||| |||| ||||||| ||||||||| Sbjct 1183 ACTATAATGACTTCCCGGGGAAGGAACCCCC-CTTGGGGGGGGTGGTAGACATGAGGCTT 1241 Query 887 CGGGAAGG-G--GCT---G---CT-C--GACCCACT-CTGCCTAGTGCCCAGATGTCCAG 933 |||||||| | ||| | || | |||||||| | || | |||||||| |||| Sbjct 1242 CGGGAAGGAGCCGCTCCAGGGGCTGCTCGACCCACTGCACCCAA-TGCCCAGACCCCCAG 1300 Query 934 CCACTTGGGAGCTACACTGCCTATAGGGCAGCATGCTGCAGGAGA-CCATGAAGTCCGTA 992 |||||||||||||||| ||||| |||| |||| || || ||||| ||| |||||||| | Sbjct 1301 CCACTTGGGAGCTACATTGCCTGTAGGACAGCCTGTTGGGGGAGATCCA-GAAGTCCGCA 1359 Query 993 AACAGATGTTGCCTCCGCCGCCTTGCCCAGGCAGAGAACTCTTCGATGACCCCTCCTATG 1052 |||||||| ||||| || || || ||||||||||| || || ||||| |||||||||| Sbjct 1360 AACAGATGCCACCTCCACCACCCTGTCCAGGCAGAGAGCTTTTTGATGATCCCTCCTATG 1419 Query 1053 TCAACATCCAGAATCTAGACAAGGCCCGGCAGGCTGGGGGTGGGGCTGGGCCCCCAAATC 1112 ||||| ||||||| ||||||||||||||||| || | |||||| ||||||||||| |||| Sbjct 1420 TCAACGTCCAGAACCTAGACAAGGCCCGGCAAGCAGTGGGTGGTGCTGGGCCCCCCAATC 1479 Query 1113 CTTCTCTTAATGGCAGTGCACCCCGAGACCTTTTTGACATGAAGCCCTTTGAAGATGCAC 1172 || || | ||||||||||||||||| ||||| ||||||||||||||||| |||||||| | Sbjct 1480 CTGCTATCAATGGCAGTGCACCCCGGGACCTGTTTGACATGAAGCCCTTCGAAGATGCTC 1539 Query 1173 TTCGGGTGCCACCCCCACCGCAGTCCATGTCCATGGCTGAGCAGCTGCAAGGGGAGCCCT 1232 |||| ||||| || || || ||||| ||||||||||||||||||| | ||||||||||| Sbjct 1540 TTCGCGTGCCTCCACCTCCCCAGTCGGTGTCCATGGCTGAGCAGCTCCGAGGGGAGCCCT 1599 Query 1233 GGTTCCACGGGAAGCTGAGCCGGAGGGAGGCCGAGGCGCTGCTGCAGCTCAATGGTGACT 1292 ||||||| ||||||||||||||| ||||||| ||||| ||||||||||||||||| |||| Sbjct 1600 GGTTCCATGGGAAGCTGAGCCGGCGGGAGGCTGAGGCACTGCTGCAGCTCAATGGGGACT 1659 Query 1293 TCTTGGTGCGAGAGAGCACGACCACGCCTGGCCAGTATGTGCTCACTGGCCTGCAGAGTG 1352 || |||| || |||||||||||||| |||||||||||||||||||||||| ||||||||| Sbjct 1660 TCCTGGTACGGGAGAGCACGACCACACCTGGCCAGTATGTGCTCACTGGCTTGCAGAGTG 1719 Query 1353 GGCAGCCCAAGCACTTGCTGCTGGTGGACCCTGAAGGTGTGGTTCGGACAAAGGATCACC 1412 ||||||| ||||| ||||| |||||||||||||| |||||||||||||| |||||||||| Sbjct 1720 GGCAGCCTAAGCATTTGCTACTGGTGGACCCTGAGGGTGTGGTTCGGACTAAGGATCACC 1779 Query 1413 GCTTTGAGAGTGTCAGTCACCTGATCAGCTACCACATGGACAATCACTTGCCCATCATCT 1472 ||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct 1780 GCTTTGAAAGTGTCAGTCACCTTATCAGCTACCACATGGACAATCACTTGCCCATCATCT 1839 Query 1473 CTGCGGGCAGCGAACTGTGCCTACAGCAACCCGTGGATCGGAAAGTGTGATCCTTCTC-A 1531 ||||||||||||||||||| ||||||||||| ||||| |||||| ||||||| | | | | Sbjct 1840 CTGCGGGCAGCGAACTGTGTCTACAGCAACCTGTGGAGCGGAAACTGTGATC-TGCCCTA 1898 Query 1532 GC--T-TCT-CCA-ACAGGATGCTCTCCATTTCCGT-CT-CCCGTATTCTCTAACT-TGT 1583 || | ||| ||| | || |||| ||||| | || | | ||| ||||| |||||| | Sbjct 1899 GCGCTCTCTTCCAGA-AG-ATGCCCTCCAAT-CCTTTCCACCC-TATTCCCTAACTCTC- 1953 Query 1584 GGGACCTC-T--G----T-TT-TGTGGGTCT-GGCCTTGGGTGGGAACTGGGAGCAACGA 1633 |||||||| | | | || |||||| || ||||||| || || ||||||| | | | Sbjct 1954 GGGACCTCGTTTGGGAGTGTTCTGTGGG-CTTGGCCTTGTGTCAGAGCTGGGAGTAGC-A 2011 Query 1634 -GGACA-TGGGTTT-AGTGCCCA-CTTGAGAGAGAGAAAAAGAGGGTTTCAGT-AAGGAG 1688 |||| ||||||| | | ||| || ||| ||||| | | ||| ||| || || Sbjct 2012 TGGACTCTGGGTTTCA-TATCCAGCT-GAGTGAGAG-----G-G--TTTGAGTCAAA-AG 2060 Query 1689 CCTGGG-GTAGCATCCTGCCTCTGGCCAAAC-TT---CACCAAAGTATTAATGTGCAGAG 1743 |||||| | || ||||||||||| |||||| || ||||||||||||||||| ||||| Sbjct 2061 CCTGGGTG-AGAATCCTGCCTCTCCCCAAACATTAATCACCAAAGTATTAATGTACAGAG 2119 Query 1744 TGGTCCCTTGTCTGGGCCTTGCCTGTGCCAACCTGATGCCC-TTcccccccAAAGGGTGG 1802 ||| |||| ||||||||| |||||||||||||||||||| |||||| || || || Sbjct 2120 TGGCCCCTCACCTGGGCCTTTCCTGTGCCAACCTGATGCCCCTTCCCCAAGAA-GG-TGA 2177 Query 1803 GTTCTTATAATGGAAAATGCCCTGTGATGATAGGCCCAGTGGA 1845 || ||| | |||||||||| |||||| ||| |||||||||||| Sbjct 2178 GTGCTTGTCATGGAAAATGTCCTGTGGTGACAGGCCCAGTGGA 2220 >emb|CR859992.1| Pongo pygmaeus mRNA; cDNA DKFZp459K018 (from clone DKFZp459K018) Length=3554 Score = 1925 bits (1042), Expect = 0.0 Identities = 1548/1783 (86%), Gaps = 71/1783 (3%) Strand=Plus/Plus Query 109 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCT 168 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct 548 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTGGAAGGGGGCCAGCT 607 Query 169 GGGGGGCGAGGAGTGGACCAGACACGGGAGCTTTGTCAATAAGCCCACACGAGGCTGGCT 228 ||||||||||||||||||| | |||||||||||||||||||||||||| || |||||||| Sbjct 608 GGGGGGCGAGGAGTGGACCCGCCACGGGAGCTTTGTCAATAAGCCCACGCGGGGCTGGCT 667 Query 229 GCATCCCAACGACAAAGTCATGGGACCTGGGGTTTCCTACTTGGTTCGGTACATGGGCTG 288 ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| Sbjct 668 GCATCCCAACGACAAAGTCATGGGACCCGGGGTTTCCTACTTGGTTCGGTACATGGGCTG 727 Query 289 TGTGGAGGTC-TTACAGTCAATGCGAGCCCTTGACTTCAATACCCGGACTCAGGTCACCA 347 |||||||||| || ||||||||||| ||||| |||||||| ||||||||||||||||||| Sbjct 728 TGTGGAGGTCCTT-CAGTCAATGCGTGCCCTGGACTTCAACACCCGGACTCAGGTCACCA 786 Query 348 GGGAGGCCATCAGTTTGGTGTGTGAAGCTGTGCCTGGTGCCAAAGGGGCGACAAGGAGGA 407 |||||||||||||| |||||||||| |||||||| ||||| || ||||| || ||||||| Sbjct 787 GGGAGGCCATCAGTCTGGTGTGTGAGGCTGTGCCGGGTGCTAAGGGGGCAACGAGGAGGA 846 Query 408 GAAAGCCTTGTAGCCGCCCACTCAGCTCCATCCTGGGGAGGAGTAACCTGAAGTTTGCTG 467 ||||||| ||||||||||| |||||||| ||||||||||||||||||||||| ||||||| Sbjct 847 GAAAGCCCTGTAGCCGCCCGCTCAGCTCTATCCTGGGGAGGAGTAACCTGAAATTTGCTG 906 Query 468 GAATGCCAATCACTCTCACTGTGTCTACCAGCAGCCTTAACCTCATGGCAGCCGACTGCA 527 ||||||||||||||||||| || || ||||||||||| ||||||||||| || ||||||| Sbjct 907 GAATGCCAATCACTCTCACCGTCTCCACCAGCAGCCTCAACCTCATGGCCGCAGACTGCA 966 Query 528 AACAGATCATTGCCAACCATCACATGCAATCTATCTC-TTTCGCGTCCGGTGGGGATCCG 586 |||||||||| |||||||| ||||||||||||||||| ||| || ||||| ||||||||| Sbjct 967 AACAGATCATCGCCAACCACCACATGCAATCTATCTCATTT-GCATCCGGCGGGGATCCG 1025 Query 587 GACACAGCTGAGTATGTTGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCAT 646 |||||||| |||||||| ||||| ||||||||||||||||||||||||||||||||||| Sbjct 1026 GACACAGCCGAGTATGTCGCCTACGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCAC 1085 Query 647 ATCCTGGAGTGTCCTGAAGGGCTTGCTCAGGATGTCATCAGCACCATCGGGCAGGCCTTT 706 || ||||||||||| ||||||||||| |||||||||||||||||||| || |||||||| Sbjct 1086 ATTCTGGAGTGTCCCGAAGGGCTTGCCCAGGATGTCATCAGCACCATTGGCCAGGCCTTC 1145 Query 707 GAGTTGCGCTTCAAACAGTATCTCAGGAATCCACCGAAGCTGGTCACCCCCCATGACAGG 766 ||||||||||||||||| || |||||||| ||||| || ||||||||||| ||||||||| Sbjct 1146 GAGTTGCGCTTCAAACAATACCTCAGGAACCCACCCAAACTGGTCACCCCTCATGACAGG 1205 Query 767 ATGGCTGGCTTTGATGGCTCAGCTTGGGATGAGGAGGAAGAAGAGCCCCCTGACCATCAG 826 ||||||||||||||||||||||| |||||||||||||| |||||||| |||||||||||| Sbjct 1206 ATGGCTGGCTTTGATGGCTCAGCATGGGATGAGGAGGAGGAAGAGCCACCTGACCATCAG 1265 Query 827 TACTACAATGACTTTCCAGGGAAGGAACCCCCTCTTGGTGGGGTGGTAGATATGAGGCTT 886 ||||| |||||||| || |||||||||||||| || || ||||||||||| ||||||||| Sbjct 1266 TACTATAATGACTTCCCGGGGAAGGAACCCCCCCTGGGGGGGGTGGTAGACATGAGGCTT 1325 Query 887 CGGGAAGG-G--GCT---G---CT-C--GACCCACT-CTGCCTAGTGCCCAGATGTCCAG 933 |||||||| | ||| | || | || |||| | || |||||||||| |||| Sbjct 1326 CGGGAAGGAGCCGCTCCAGGGGCTGCTCGATCCACCGCACCC-AGTGCCCAGACCCCCAG 1384 Query 934 CCACTTGGGAGCTACACTGCCTATAGGGCAGCATGCTGCAGGAGA-CCATGAAGTCCGTA 992 |||||||||||||||||||||| |||| |||| || || ||||| ||| |||||||| | Sbjct 1385 CCACTTGGGAGCTACACTGCCTGTAGGACAGCCTGTTGGGGGAGATCCA-GAAGTCCGCA 1443 Query 993 AACAGATGTTGCCTCCGCCGCCTTGCCCAGGCAGAGAACTCTTCGATGACCCCTCCTATG 1052 |||||||| ||||| || || || ||||| ||||| ||||| ||||| |||||||||| Sbjct 1444 AACAGATGCCACCTCCACCACCCTGTCCAGGTAGAGAGCTCTTTGATGATCCCTCCTATG 1503 Query 1053 TCAACATCCAGAATCTAGACAAGGCCCGGCAGGCTGGGGGTGGGGCTGGGCCCCCAAATC 1112 ||||| ||||||| ||||||||||||||||| || | |||||| ||||||||||| |||| Sbjct 1504 TCAACGTCCAGAACCTAGACAAGGCCCGGCAAGCAGTGGGTGGTGCTGGGCCCCCTAATC 1563 Query 1113 CTTCTCTTAATGGCAGTGCACCCCGAGACCTTTTTGACATGAAGCCCTTTGAAGATGCAC 1172 || || | ||||||||||||||||| ||||| |||||||||| |||||| |||||||| | Sbjct 1564 CTGCTGTCAATGGCAGTGCACCCCGGGACCTGTTTGACATGAGGCCCTTCGAAGATGCTC 1623 Query 1173 TTCGGGTGCCACCCCCACCGCAGTCCATGTCCATGGCTGAGCAGCTGCAAGGGGAGCCCT 1232 |||||||||| || || || ||||| ||||||||||||||||||| | ||||||||||| Sbjct 1624 TTCGGGTGCCTCCACCTCCCCAGTCGGTGTCCATGGCTGAGCAGCTCCGAGGGGAGCCCT 1683 Query 1233 GGTTCCACGGGAAGCTGAGCCGGAGGGAGGCCGAGGCGCTGCTGCAGCTCAATGGTGACT 1292 ||||||||||||||||||||||| ||||||| ||||| |||||||||||||| || |||| Sbjct 1684 GGTTCCACGGGAAGCTGAGCCGGCGGGAGGCTGAGGCACTGCTGCAGCTCAACGGGGACT 1743 Query 1293 TCTTGGTGCGAGAGAGCACGACCACGCCTGGCCAGTATGTGCTCACTGGCCTGCAGAGTG 1352 || ||||||| |||||||||||||| |||||||||||||||||||||||| ||||||||| Sbjct 1744 TCCTGGTGCGGGAGAGCACGACCACACCTGGCCAGTATGTGCTCACTGGCTTGCAGAGTG 1803 Query 1353 GGCAGCCCAAGCACTTGCTGCTGGTGGACCCTGAAGGTGTGGTTCGGACAAAGGATCACC 1412 ||||||||||||| ||||| |||||||||||||| |||||||||||||| |||||||||| Sbjct 1804 GGCAGCCCAAGCATTTGCTACTGGTGGACCCTGAGGGTGTGGTTCGGACTAAGGATCACC 1863 Query 1413 GCTTTGAGAGTGTCAGTCACCTGATCAGCTACCACATGGACAATCACTTGCCCATCATCT 1472 |||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| Sbjct 1864 GCTTTGAGAGTGTCAGTCACCTTATCGGCTACCACATGGACAATCACTTGCCCATCATCT 1923 Query 1473 CTGCGGGCAGCGAACTGTGCCTACAGCAACCCGTGGATCGGAAAGTGTGATCCTTCTC-A 1531 ||||||||||||||||||| ||||||||||| ||||| |||||| ||||||| | | | | Sbjct 1924 CTGCGGGCAGCGAACTGTGTCTACAGCAACCTGTGGAGCGGAAACTGTGATC-TGCCCTA 1982 Query 1532 GC--T-TCT-CCA-ACAGGATGCTCTCCATTTCCGT-CT-CCCGTATTCTCTAACT-TGT 1583 || | ||| ||| | || |||| ||||| | || | | ||| ||||| |||||| | Sbjct 1983 GCGCTCTCTTCCAGA-AG-ATGCCCTCCAAT-CCTTTCCACCC-TATTCCCTAACTCTC- 2037 Query 1584 GGGACCTC-T--G----T-TT-TGTGGGTCT-GGCCTTGGGTGGGAACTGGGAGCAACGA 1633 |||||||| | | | || |||||| || ||||||| || || ||||||| | || Sbjct 2038 GGGACCTCGTTTGGGAGTGTTCTGTGGG-CTTGGCCTTGTGTCAGAGCTGGGAGTAGCGT 2096 Query 1634 GGACA-TGGGTTT-AGTGCCCA-CTTGAGAGAGAGAAAAAGAGGGTTTCAGTAAGGAGCC 1690 |||| ||||||| | | ||| || ||| ||||| | | ||| ||| || |||| Sbjct 2097 GGACTCTGGGTTTCA-TATCCAGCT-GAGTGAGAG-----G-G--TTTGAGTCAGAAGCC 2146 Query 1691 TGGG-GTAGCATCCTGCCTCTGGCCAAAC-TT---CACCAAAGTATTAATGTGCAGAGTG 1745 |||| | || ||||||||||| |||||| || |||||||||||| |||| ||||||| Sbjct 2147 TGGGTG-AGAATCCTGCCTCTCCCCAAACATTAATCACCAAAGTATTCATGTACAGAGTG 2205 Query 1746 GTCCCTTGTCT-GGGCCTTG-CCTGTGCCAACCTGATGCCC-TTcccccccAAAGGGTGG 1802 | |||| || ||||||| |||||||||||||||||||| |||||| || || || Sbjct 2206 GCCCCTCA-CTTGGGCCTTTTCCTGTGCCAACCTGATGCCCCTTCCCCAAGAA-GG-TGA 2262 Query 1803 GTTCTTATAATGGAAAATGCCCTGTGATGATAGGCCCAGTGGA 1845 || ||| | |||||||||| |||||| ||| |||||||||||| Sbjct 2263 GTGCTTGTCATGGAAAATGTCCTGTGGTGACAGGCCCAGTGGA 2305 >dbj|AK096169.1| UniGene infoGene info Homo sapiens cDNA FLJ38850 fis, clone MESAN2010031, highly similar to SHC TRANSFORMING PROTEIN Length=3463 Score = 1916 bits (1037), Expect = 0.0 Identities = 1549/1786 (86%), Gaps = 75/1786 (4%) Strand=Plus/Plus Query 109 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCT 168 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct 531 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTGGAAGGGGGCCAGCT 590 Query 169 GGGGGGCGAGGAGTGGACCAGACACGGGAGCTTTGTCAATAAGCCCACACGAGGCTGGCT 228 |||||||||||||||||| | |||||||||||||||||||||||||| || |||||||| Sbjct 591 TGGGGGCGAGGAGTGGACCCGCCACGGGAGCTTTGTCAATAAGCCCACGCGGGGCTGGCT 650 Query 229 GCATCCCAACGACAAAGTCATGGGACCTGGGGTTTCCTACTTGGTTCGGTACATGGGCTG 288 ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| || Sbjct 651 GCATCCCAACGACAAAGTCATGGGACCCGGGGTTTCCTACTTGGTTCGGTACATGGGTTG 710 Query 289 TGTGGAGGTCTTACAGTCAATGCGAGCCCTTGACTTCAATACCCGGACTCAGGTCACCAG 348 |||||||||| | ||||||||||| ||||| |||||||| |||||||||||||||||||| Sbjct 711 TGTGGAGGTCCTCCAGTCAATGCGTGCCCTGGACTTCAACACCCGGACTCAGGTCACCAG 770 Query 349 GGAGGCCATCAGTTTGGTGTGTGAAGCTGTGCCTGGTGCCAAAGGGGCGACAAGGAGGAG 408 ||||||||||||| |||||||||| |||||||| ||||| || ||||||||||||||||| Sbjct 771 GGAGGCCATCAGTCTGGTGTGTGAGGCTGTGCCGGGTGCTAAGGGGGCGACAAGGAGGAG 830 Query 409 AAAGCCTTGTAGCCGCCCACTCAGCTCCATCCTGGGGAGGAGTAACCTGAAGTTTGCTGG 468 |||||| ||||||||||| |||||||| ||||||||||||||||||||||| |||||||| Sbjct 831 AAAGCCCTGTAGCCGCCCGCTCAGCTCTATCCTGGGGAGGAGTAACCTGAAATTTGCTGG 890 Query 469 AATGCCAATCACTCTCACTGTGTCTACCAGCAGCCTTAACCTCATGGCAGCCGACTGCAA 528 |||||||||||||||||| || || ||||||||||| ||||||||||| || |||||||| Sbjct 891 AATGCCAATCACTCTCACCGTCTCCACCAGCAGCCTCAACCTCATGGCCGCAGACTGCAA 950 Query 529 ACAGATCATTGCCAACCATCACATGCAATCTATCTC-TTTCGCGTCCGGTGGGGATCCGG 587 ||||||||| |||||||| ||||||||||||||||| ||| || ||||| |||||||||| Sbjct 951 ACAGATCATCGCCAACCACCACATGCAATCTATCTCATTT-GCATCCGGCGGGGATCCGG 1009 Query 588 ACACAGCTGAGTATGTTGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCATA 647 ||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| | Sbjct 1010 ACACAGCCGAGTATGTCGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCACA 1069 Query 648 TCCTGGAGTGTCCTGAAGGGCTTGCTCAGGATGTCATCAGCACCATCGGGCAGGCCTTTG 707 | ||||||||||| ||||||||||| |||||||||||||||||||| || |||||||| | Sbjct 1070 TTCTGGAGTGTCCCGAAGGGCTTGCCCAGGATGTCATCAGCACCATTGGCCAGGCCTTCG 1129 Query 708 AGTTGCGCTTCAAACAGTATCTCAGGAATCCACCGAAGCTGGTCACCCCCCATGACAGGA 767 |||||||||||||||| || |||||||| ||||| || ||||||||||| |||||||||| Sbjct 1130 AGTTGCGCTTCAAACAATACCTCAGGAACCCACCCAAACTGGTCACCCCTCATGACAGGA 1189 Query 768 TGGCTGGCTTTGATGGCTCAGCTTGGGATGAGGAGGAAGAAGAGCCCCCTGACCATCAGT 827 |||||||||||||||||||||| |||||||||||||| |||||||| ||||||||||||| Sbjct 1190 TGGCTGGCTTTGATGGCTCAGCATGGGATGAGGAGGAGGAAGAGCCACCTGACCATCAGT 1249 Query 828 ACTACAATGACTTTCCAGGGAAGGAACCCCCTCTTGGTGGGG-TGGTAGATATGAGGCTT 886 |||| |||||||| || |||||||||||||| ||||| |||| ||||||| ||||||||| Sbjct 1250 ACTATAATGACTTCCCGGGGAAGGAACCCCC-CTTGGGGGGGGTGGTAGACATGAGGCTT 1308 Query 887 CGGGAAGG-G--GCT---G---CT-C--GACCCACT-CTGCCTAGTGCCCAGATGTCCAG 933 |||||||| | ||| | || | |||||||| | || | |||||||| |||| Sbjct 1309 CGGGAAGGAGCCGCTCCAGGGGCTGCTCGACCCACTGCACCCAA-TGCCCAGACCCCCAG 1367 Query 934 CCACTTGGGAGCTACACTGCCTATAGGGCAGCATGCTGCAGGAGA-CCATGAAGTCCGTA 992 |||||||||||||||| ||||| |||| |||| || || ||||| ||| |||||||| | Sbjct 1368 CCACTTGGGAGCTACATTGCCTGTAGGACAGCCTGTTGGGGGAGATCCA-GAAGTCCGCA 1426 Query 993 AACAGATGTTGCCTCCGCCGCCTTG-CC--CAGGCAGAGAACTCTTCGATGACCCCTCCT 1049 |||||||| ||||| || || || || |||||||||| || || ||||| ||||||| Sbjct 1427 AACAGATGCCACCTCCACCACCCTGTCCAGCAGGCAGAGAGCTTTTTGATGATCCCTCCT 1486 Query 1050 ATGTCAACATCCAGAATCTAGACAAGGCCCGGCAGGCTGGGGGTGGGGCTGGGCCCCCAA 1109 |||||||| ||||||| ||||||||||||||||| || | |||||| ||||||||||| | Sbjct 1487 ATGTCAACGTCCAGAACCTAGACAAGGCCCGGCAAGCAGTGGGTGGTGCTGGGCCCCCCA 1546 Query 1110 ATCCTTCTCTTAATGGCAGTGCACCCCGAGACCTTTTTGACATGAAGCCCTTTGAAGATG 1169 ||||| || | ||||||||||||||||| ||||| ||||||||||||||||| ||||||| Sbjct 1547 ATCCTGCTATCAATGGCAGTGCACCCCGGGACCTGTTTGACATGAAGCCCTTCGAAGATG 1606 Query 1170 CACTTCGGGTGCCACCCCCACCGCAGTCCATGTCCATGGCTGAGCAGCTGCAAGGGGAGC 1229 | ||||| ||||| || || || ||||| ||||||||||||||||||| | |||||||| Sbjct 1607 CTCTTCGCGTGCCTCCACCTCCCCAGTCGGTGTCCATGGCTGAGCAGCTCCGAGGGGAGC 1666 Query 1230 CCTGGTTCCACGGGAAGCTGAGCCGGAGGGAGGCCGAGGCGCTGCTGCAGCTCAATGGTG 1289 |||||||||| ||||||||||||||| ||||||| ||||| ||||||||||||||||| | Sbjct 1667 CCTGGTTCCATGGGAAGCTGAGCCGGCGGGAGGCTGAGGCACTGCTGCAGCTCAATGGGG 1726 Query 1290 ACTTCTTGGTGCGAGAGAGCACGACCACGCCTGGCCAGTATGTGCTCACTGGCCTGCAGA 1349 ||||| |||| || |||||||||||||| |||||||||||||||||||||||| |||||| Sbjct 1727 ACTTCCTGGTACGGGAGAGCACGACCACACCTGGCCAGTATGTGCTCACTGGCTTGCAGA 1786 Query 1350 GTGGGCAGCCCAAGCACTTGCTGCTGGTGGACCCTGAAGGTGTGGTTCGGACAAAGGATC 1409 |||||||||| ||||| ||||| |||||||||||||| |||||||||||||| ||||||| Sbjct 1787 GTGGGCAGCCTAAGCATTTGCTACTGGTGGACCCTGAGGGTGTGGTTCGGACTAAGGATC 1846 Query 1410 ACCGCTTTGAGAGTGTCAGTCACCTGATCAGCTACCACATGGACAATCACTTGCCCATCA 1469 |||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||| Sbjct 1847 ACCGCTTTGAAAGTGTCAGTCACCTTATCAGCTACCACATGGACAATCACTTGCCCATCA 1906 Query 1470 TCTCTGCGGGCAGCGAACTGTGCCTACAGCAACCCGTGGATCGGAAAGTGTGATCCTTCT 1529 |||||||||||||||||||||| ||||||||||| ||||| |||||| ||||||| | | Sbjct 1907 TCTCTGCGGGCAGCGAACTGTGTCTACAGCAACCTGTGGAGCGGAAACTGTGATC-TGCC 1965 Query 1530 C-AGC--T-TCT-CCA-ACAGGATGCTCTCCATTTCCGT-CT-CCCGTATTCTCTAACT- 1580 | ||| | ||| ||| | || |||| ||||| | || | | ||| ||||| |||||| Sbjct 1966 CTAGCGCTCTCTTCCAGA-AG-ATGCCCTCCAAT-CCTTTCCACCC-TATTCCCTAACTC 2021 Query 1581 TGTGGGACCTC-T--G----T-TT-TGTGGGTCT-GGCCTTGGGTGGGAACTGGGAGCAA 1630 | |||||||| | | | || |||||| || ||||||| || || ||||||| | Sbjct 2022 TC-GGGACCTCGTTTGGGAGTGTTCTGTGGG-CTTGGCCTTGTGTCAGAGCTGGGAGTAG 2079 Query 1631 CGA-GGACA-TGGGTTT-AGTGCCCA-CTTGAGAGAGAGAAAAAGAGGGTTTCAGT-AAG 1685 | | |||| ||||||| | | ||| || ||| ||||| | | ||| ||| || Sbjct 2080 C-ATGGACTCTGGGTTTCA-TATCCAGCT-GAGTGAGAG-----G-G--TTTGAGTCAAA 2128 Query 1686 GAGCCTGGG-GTAGCATCCTGCCTCTGGCCAAAC-TT---CACCAAAGTATTAATGTGCA 1740 |||||||| | || ||||||||||| |||||| || ||||||||||||||||| || Sbjct 2129 -AGCCTGGGTG-AGAATCCTGCCTCTCCCCAAACATTAATCACCAAAGTATTAATGTACA 2186 Query 1741 GAGTGGTCCCTTGTCTGGGCCTTGCCTGTGCCAACCTGATGCCC-TTcccccccAAAGGG 1799 |||||| |||| ||||||||| |||||||||||||||||||| |||||| || || Sbjct 2187 GAGTGGCCCCTCACCTGGGCCTTTCCTGTGCCAACCTGATGCCCCTTCCCCAAGAA-GG- 2244 Query 1800 TGGGTTCTTATAATGGAAAATGCCCTGTGATGATAGGCCCAGTGGA 1845 || || ||| | |||||||||| |||||| ||| |||||||||||| Sbjct 2245 TGAGTGCTTGTCATGGAAAATGTCCTGTGGTGACAGGCCCAGTGGA 2290 >emb|BX647149.1|HSM807293 UniGene infoGene info Homo sapiens mRNA; cDNA DKFZp686L06171 (from clone DKFZp686L06171) Length=3497 Score = 1916 bits (1037), Expect = 0.0 Identities = 1549/1786 (86%), Gaps = 75/1786 (4%) Strand=Plus/Plus Query 109 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCT 168 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct 548 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTGGAAGGGGGCCAGCT 607 Query 169 GGGGGGCGAGGAGTGGACCAGACACGGGAGCTTTGTCAATAAGCCCACACGAGGCTGGCT 228 |||||||||||||||||| | |||||||||||||||||||||||||| || |||||||| Sbjct 608 TGGGGGCGAGGAGTGGACCCGCCACGGGAGCTTTGTCAATAAGCCCACGCGGGGCTGGCT 667 Query 229 GCATCCCAACGACAAAGTCATGGGACCTGGGGTTTCCTACTTGGTTCGGTACATGGGCTG 288 ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| || Sbjct 668 GCATCCCAACGACAAAGTCATGGGACCCGGGGTTTCCTACTTGGTTCGGTACATGGGTTG 727 Query 289 TGTGGAGGTCTTACAGTCAATGCGAGCCCTTGACTTCAATACCCGGACTCAGGTCACCAG 348 |||||||||| | ||||||||||| ||||| |||||||| |||||||||||||||||||| Sbjct 728 TGTGGAGGTCCTCCAGTCAATGCGTGCCCTGGACTTCAACACCCGGACTCAGGTCACCAG 787 Query 349 GGAGGCCATCAGTTTGGTGTGTGAAGCTGTGCCTGGTGCCAAAGGGGCGACAAGGAGGAG 408 ||||||||||||| |||||||||| |||||||| ||||| || ||||||||||||||||| Sbjct 788 GGAGGCCATCAGTCTGGTGTGTGAGGCTGTGCCGGGTGCTAAGGGGGCGACAAGGAGGAG 847 Query 409 AAAGCCTTGTAGCCGCCCACTCAGCTCCATCCTGGGGAGGAGTAACCTGAAGTTTGCTGG 468 |||||| ||||||||||| |||||||| ||||||||||||||||||||||| |||||||| Sbjct 848 AAAGCCCTGTAGCCGCCCGCTCAGCTCTATCCTGGGGAGGAGTAACCTGAAATTTGCTGG 907 Query 469 AATGCCAATCACTCTCACTGTGTCTACCAGCAGCCTTAACCTCATGGCAGCCGACTGCAA 528 |||||||||||||||||| || || ||||||||||| ||||||||||| || |||||||| Sbjct 908 AATGCCAATCACTCTCACCGTCTCCACCAGCAGCCTCAACCTCATGGCCGCAGACTGCAA 967 Query 529 ACAGATCATTGCCAACCATCACATGCAATCTATCTC-TTTCGCGTCCGGTGGGGATCCGG 587 ||||||||| |||||||| ||||||||||||||||| ||| || ||||| |||||||||| Sbjct 968 ACAGATCATCGCCAACCACCACATGCAATCTATCTCATTT-GCATCCGGCGGGGATCCGG 1026 Query 588 ACACAGCTGAGTATGTTGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCATA 647 ||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| | Sbjct 1027 ACACAGCCGAGTATGTCGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCACA 1086 Query 648 TCCTGGAGTGTCCTGAAGGGCTTGCTCAGGATGTCATCAGCACCATCGGGCAGGCCTTTG 707 | ||||||||||| ||||||||||| |||||||||||||||||||| || |||||||| | Sbjct 1087 TTCTGGAGTGTCCCGAAGGGCTTGCCCAGGATGTCATCAGCACCATTGGCCAGGCCTTCG 1146 Query 708 AGTTGCGCTTCAAACAGTATCTCAGGAATCCACCGAAGCTGGTCACCCCCCATGACAGGA 767 |||||||||||||||| || |||||||| ||||| || ||||||||||| |||||||||| Sbjct 1147 AGTTGCGCTTCAAACAATACCTCAGGAACCCACCCAAACTGGTCACCCCTCATGACAGGA 1206 Query 768 TGGCTGGCTTTGATGGCTCAGCTTGGGATGAGGAGGAAGAAGAGCCCCCTGACCATCAGT 827 |||||||||||||||||||||| |||||||||||||| |||||||| ||||||||||||| Sbjct 1207 TGGCTGGCTTTGATGGCTCAGCATGGGATGAGGAGGAGGAAGAGCCACCTGACCATCAGT 1266 Query 828 ACTACAATGACTTTCCAGGGAAGGAACCCCCTCTTGGTGGGG-TGGTAGATATGAGGCTT 886 |||| |||||||| || |||||||||||||| ||||| |||| ||||||| ||||||||| Sbjct 1267 ACTATAATGACTTCCCGGGGAAGGAACCCCC-CTTGGGGGGGGTGGTAGACATGAGGCTT 1325 Query 887 CGGGAAGG-G--GCT---G---CT-C--GACCCACT-CTGCCTAGTGCCCAGATGTCCAG 933 |||||||| | ||| | || | |||||||| | || | |||||||| |||| Sbjct 1326 CGGGAAGGAGCCGCTCCAGGGGCTGCTCGACCCACTGCACCCAA-TGCCCAGACCCCCAG 1384 Query 934 CCACTTGGGAGCTACACTGCCTATAGGGCAGCATGCTGCAGGAGA-CCATGAAGTCCGTA 992 |||||||||||||||| ||||| |||| |||| || || ||||| ||| |||||||| | Sbjct 1385 CCACTTGGGAGCTACATTGCCTGTAGGACAGCCTGTTGGGGGAGATCCA-GAAGTCCGCA 1443 Query 993 AACAGATGTTGCCTCCGCCGCCTTG-CC--CAGGCAGAGAACTCTTCGATGACCCCTCCT 1049 |||||||| ||||| || || || || |||||||||| || || ||||| ||||||| Sbjct 1444 AACAGATGCCACCTCCACCACCCTGTCCAGCAGGCAGAGAGCTTTTTGATGATCCCTCCT 1503 Query 1050 ATGTCAACATCCAGAATCTAGACAAGGCCCGGCAGGCTGGGGGTGGGGCTGGGCCCCCAA 1109 |||||||| ||||||| ||||||||||||||||| || | |||||| ||||||||||| | Sbjct 1504 ATGTCAACGTCCAGAACCTAGACAAGGCCCGGCAAGCAGTGGGTGGTGCTGGGCCCCCCA 1563 Query 1110 ATCCTTCTCTTAATGGCAGTGCACCCCGAGACCTTTTTGACATGAAGCCCTTTGAAGATG 1169 ||||| || | ||||||||||||||||| ||||| ||||||||||||||||| ||||||| Sbjct 1564 ATCCTGCTATCAATGGCAGTGCACCCCGGGACCTGTTTGACATGAAGCCCTTCGAAGATG 1623 Query 1170 CACTTCGGGTGCCACCCCCACCGCAGTCCATGTCCATGGCTGAGCAGCTGCAAGGGGAGC 1229 | ||||| ||||| || || || ||||| ||||||||||||||||||| | |||||||| Sbjct 1624 CTCTTCGCGTGCCTCCACCTCCCCAGTCGGTGTCCATGGCTGAGCAGCTCCGAGGGGAGC 1683 Query 1230 CCTGGTTCCACGGGAAGCTGAGCCGGAGGGAGGCCGAGGCGCTGCTGCAGCTCAATGGTG 1289 |||||||||| ||||||||||||||| ||||||| ||||| ||||||||||||||||| | Sbjct 1684 CCTGGTTCCATGGGAAGCTGAGCCGGCGGGAGGCTGAGGCACTGCTGCAGCTCAATGGGG 1743 Query 1290 ACTTCTTGGTGCGAGAGAGCACGACCACGCCTGGCCAGTATGTGCTCACTGGCCTGCAGA 1349 ||||| |||| || |||||||||||||| |||||||||||||||||||||||| |||||| Sbjct 1744 ACTTCCTGGTACGGGAGAGCACGACCACACCTGGCCAGTATGTGCTCACTGGCTTGCAGA 1803 Query 1350 GTGGGCAGCCCAAGCACTTGCTGCTGGTGGACCCTGAAGGTGTGGTTCGGACAAAGGATC 1409 |||||||||| ||||| ||||| |||||||||||||| |||||||||||||| ||||||| Sbjct 1804 GTGGGCAGCCTAAGCATTTGCTACTGGTGGACCCTGAGGGTGTGGTTCGGACTAAGGATC 1863 Query 1410 ACCGCTTTGAGAGTGTCAGTCACCTGATCAGCTACCACATGGACAATCACTTGCCCATCA 1469 |||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||| Sbjct 1864 ACCGCTTTGAAAGTGTCAGTCACCTTATCAGCTACCACATGGACAATCACTTGCCCATCA 1923 Query 1470 TCTCTGCGGGCAGCGAACTGTGCCTACAGCAACCCGTGGATCGGAAAGTGTGATCCTTCT 1529 |||||||||||||||||||||| ||||||||||| ||||| |||||| ||||||| | | Sbjct 1924 TCTCTGCGGGCAGCGAACTGTGTCTACAGCAACCTGTGGAGCGGAAACTGTGATC-TGCC 1982 Query 1530 C-AGC--T-TCT-CCA-ACAGGATGCTCTCCATTTCCGT-CT-CCCGTATTCTCTAACT- 1580 | ||| | ||| ||| | || |||| ||||| | || | | ||| ||||| |||||| Sbjct 1983 CTAGCGCTCTCTTCCAGA-AG-ATGCCCTCCAAT-CCTTTCCACCC-TATTCCCTAACTC 2038 Query 1581 TGTGGGACCTC-T--G----T-TT-TGTGGGTCT-GGCCTTGGGTGGGAACTGGGAGCAA 1630 | |||||||| | | | || |||||| || ||||||| || || ||||||| | Sbjct 2039 TC-GGGACCTCGTTTGGGAGTGTTCTGTGGG-CTTGGCCTTGTGTCAGAGCTGGGAGTAG 2096 Query 1631 CGA-GGACA-TGGGTTT-AGTGCCCA-CTTGAGAGAGAGAAAAAGAGGGTTTCAGT-AAG 1685 | | |||| ||||||| | | ||| || ||| ||||| | | ||| ||| || Sbjct 2097 C-ATGGACTCTGGGTTTCA-TATCCAGCT-GAGTGAGAG-----G-G--TTTGAGTCAAA 2145 Query 1686 GAGCCTGGG-GTAGCATCCTGCCTCTGGCCAAAC-TT---CACCAAAGTATTAATGTGCA 1740 |||||||| | || ||||||||||| |||||| || ||||||||||||||||| || Sbjct 2146 -AGCCTGGGTG-AGAATCCTGCCTCTCCCCAAACATTAATCACCAAAGTATTAATGTACA 2203 Query 1741 GAGTGGTCCCTTGTCTGGGCCTTGCCTGTGCCAACCTGATGCCC-TTcccccccAAAGGG 1799 |||||| |||| ||||||||| |||||||||||||||||||| |||||| || || Sbjct 2204 GAGTGGCCCCTCACCTGGGCCTTTCCTGTGCCAACCTGATGCCCCTTCCCCAAGAA-GG- 2261 Query 1800 TGGGTTCTTATAATGGAAAATGCCCTGTGATGATAGGCCCAGTGGA 1845 || || ||| | |||||||||| |||||| ||| |||||||||||| Sbjct 2262 TGAGTGCTTGTCATGGAAAATGTCCTGTGGTGACAGGCCCAGTGGA 2307 >gb|BC017283.1| UniGene infoGene info Homo sapiens cDNA clone IMAGE:4890240, containing frame-shift errors Length=2502 Score = 1914 bits (1036), Expect = 0.0 Identities = 1547/1784 (86%), Gaps = 73/1784 (4%) Strand=Plus/Plus Query 109 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCT 168 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct 542 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTGGAAGGGGGCCAGCT 601 Query 169 GGGGGGCGAGGAGTGGACCAGACACGGGAGCTTTGTCAATAAGCCCACACGAGGCTGGCT 228 |||||||||||||||||| | |||||||||||||||||||||||||| || |||||||| Sbjct 602 TGGGGGCGAGGAGTGGACCCGCCACGGGAGCTTTGTCAATAAGCCCACGCGGGGCTGGCT 661 Query 229 GCATCCCAACGACAAAGTCATGGGACCTGGGGTTTCCTACTTGGTTCGGTACATGGGCTG 288 ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| || Sbjct 662 GCATCCCAACGACAAAGTCATGGGACCCGGGGTTTCCTACTTGGTTCGGTACATGGGTTG 721 Query 289 TGTGGAGGTCTTACAGTCAATGCGAGCCCTTGACTTCAATACCCGGACTCAGGTCACCAG 348 |||||||||| | ||||||||||| ||||| |||||||| |||||||||||||||||||| Sbjct 722 TGTGGAGGTCCTCCAGTCAATGCGTGCCCTGGACTTCAACACCCGGACTCAGGTCACCAG 781 Query 349 GGAGGCCATCAGTTTGGTGTGTGAAGCTGTGCCTGGTGCCAAAGGGGCGACAAGGAGGAG 408 ||||||||||||| |||||||||| |||||||| ||||| || ||||||||||||||||| Sbjct 782 GGAGGCCATCAGTCTGGTGTGTGAGGCTGTGCCGGGTGCTAAGGGGGCGACAAGGAGGAG 841 Query 409 AAAGCCTTGTAGCCGCCCACTCAGCTCCATCCTGGGGAGGAGTAACCTGAAGTTTGCTGG 468 |||||| ||||||||||| |||||||| ||||||||||||||||||||||| |||||||| Sbjct 842 AAAGCCCTGTAGCCGCCCGCTCAGCTCTATCCTGGGGAGGAGTAACCTGAAATTTGCTGG 901 Query 469 AATGCCAATCACTCTCACTGTGTCTACCAGCAGCCTTAACCTCATGGCAGCCGACTGCAA 528 |||||||||||||||||| || || ||||||||||| ||||||||||| || |||||||| Sbjct 902 AATGCCAATCACTCTCACCGTCTCCACCAGCAGCCTCAACCTCATGGCCGCAGACTGCAA 961 Query 529 ACAGATCATTGCCAACCATCACATGCAATCTATCTC-TTTCGCGTCCGGTGGGGATCCGG 587 ||||||||| |||||||| ||||||||||||||||| ||| || ||||| |||||||||| Sbjct 962 ACAGATCATCGCCAACCACCACATGCAATCTATCTCATTT-GCATCCGGCGGGGATCCGG 1020 Query 588 ACACAGCTGAGTATGTTGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCATA 647 ||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| | Sbjct 1021 ACACAGCCGAGTATGTCGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCACA 1080 Query 648 TCCTGGAGTGTCCTGAAGGGCTTGCTCAGGATGTCATCAGCACCATCGGGCAGGCCTTTG 707 | ||||||||||| ||||||||||| |||||||||||||||||||| || |||||||| | Sbjct 1081 TTCTGGAGTGTCCCGAAGGGCTTGCCCAGGATGTCATCAGCACCATTGGCCAGGCCTTCG 1140 Query 708 AGTTGCGCTTCAAACAGTATCTCAGGAATCCACCGAAG-CTGGTCACCCCCCATGACAGG 766 |||||||||||||||| || |||||||| ||||| || ||||||||||| ||||||||| Sbjct 1141 AGTTGCGCTTCAAACAATACCTCAGGAACCCACCCAAAACTGGTCACCCCTCATGACAGG 1200 Query 767 ATGGCTGGCTTTGATGGCTCAGCTTGGGATGAGGAGGAAGAAGAGCCCCCTGACCATCAG 826 ||||||||||||||||||||||| |||||||||||||| |||||||| |||||||||||| Sbjct 1201 ATGGCTGGCTTTGATGGCTCAGCATGGGATGAGGAGGAGGAAGAGCCACCTGACCATCAG 1260 Query 827 TACTACAATGACTTTCCAGGGAAGGAACCCCCTCTTGGTGGGG-TGGTAGATATGAGGCT 885 ||||| |||||||| || |||||||||||||| ||||| |||| ||||||| |||||||| Sbjct 1261 TACTATAATGACTTCCCGGGGAAGGAACCCCC-CTTGGGGGGGGTGGTAGACATGAGGCT 1319 Query 886 TCGGGAAGG-G--GCT---G---CT-C--GACCCACT-CTGCCTAGTGCCCAGATGTCCA 932 ||||||||| | ||| | || | |||||||| | || | |||||||| ||| Sbjct 1320 TCGGGAAGGAGCCGCTCCAGGGGCTGCTCGACCCACTGCACCCAA-TGCCCAGACCCCCA 1378 Query 933 GCCACTTGGGAGCTACACTGCCTATAGGGCAGCATGCTGCAGGAGA-CCATGAAGTCCGT 991 ||||||||||||||||| ||||| |||| |||| || || ||||| ||| |||||||| Sbjct 1379 GCCACTTGGGAGCTACATTGCCTGTAGGACAGCCTGTTGGGGGAGATCCA-GAAGTCCGC 1437 Query 992 AAACAGATGTTGCCTCCGCCGCCTTGCCCAGGCAGAGAACTCTTCGATGACCCCTCCTAT 1051 ||||||||| ||||| || || || ||||||||||| || || ||||| ||||||||| Sbjct 1438 AAACAGATGCCACCTCCACCACCCTGTCCAGGCAGAGAGCTTTTTGATGATCCCTCCTAT 1497 Query 1052 GTCAACATCCAGAATCTAGACAAGGCCCGGCAGGCTGGGGGTGGGGCTGGGCCCCCAAAT 1111 |||||| ||||||| ||||||||||||||||| || | |||||| ||||||||||| ||| Sbjct 1498 GTCAACGTCCAGAACCTAGACAAGGCCCGGCAAGCAGTGGGTGGTGCTGGGCCCCCCAAT 1557 Query 1112 CCTTCTCTTAATGGCAGTGCACCCCGAGACCTTTTTGACATGAAGCCCTTTGAAGATGCA 1171 ||| || | ||||||||||||||||| ||||| ||||||||||||||||| |||||||| Sbjct 1558 CCTGCTATCAATGGCAGTGCACCCCGGGACCTGTTTGACATGAAGCCCTTCGAAGATGCT 1617 Query 1172 CTTCGGGTGCCACCCCCACCGCAGTCCATGTCCATGGCTGAGCAGCTGCAAGGGGAGCCC 1231 ||||| ||||| || || || ||||| ||||||||||||||||||| | |||||||||| Sbjct 1618 CTTCGCGTGCCTCCACCTCCCCAGTCGGTGTCCATGGCTGAGCAGCTCCGAGGGGAGCCC 1677 Query 1232 TGGTTCCACGGGAAGCTGAGCCGGAGGGAGGCCGAGGCGCTGCTGCAGCTCAATGGTGAC 1291 |||||||| ||||||||||||||| ||||||| ||||| ||||||||||||||||| ||| Sbjct 1678 TGGTTCCATGGGAAGCTGAGCCGGCGGGAGGCTGAGGCACTGCTGCAGCTCAATGGGGAC 1737 Query 1292 TTCTTGGTGCGAGAGAGCACGACCACGCCTGGCCAGTATGTGCTCACTGGCCTGCAGAGT 1351 ||| |||| || |||||||||||||| |||||||||||||||||||||||| |||||||| Sbjct 1738 TTCCTGGTACGGGAGAGCACGACCACACCTGGCCAGTATGTGCTCACTGGCTTGCAGAGT 1797 Query 1352 GGGCAGCCCAAGCACTTGCTGCTGGTGGACCCTGAAGGTGTGGTTCGGACAAAGGATCAC 1411 |||||||| ||||| ||||| |||||||||||||| |||||||||||||| ||||||||| Sbjct 1798 GGGCAGCCTAAGCATTTGCTACTGGTGGACCCTGAGGGTGTGGTTCGGACTAAGGATCAC 1857 Query 1412 CGCTTTGAGAGTGTCAGTCACCTGATCAGCTACCACATGGACAATCACTTGCCCATCATC 1471 ||| |||| |||||||||||||| |||||||||||||||||||||||||||||||||||| Sbjct 1858 CGCCTTGAAAGTGTCAGTCACCTTATCAGCTACCACATGGACAATCACTTGCCCATCATC 1917 Query 1472 TCTGCGGGCAGCGAACTGTGCCTACAGCAACCCGTGGATCGGAAAGTGTGATCCTTCTC- 1530 |||||||||||||||||||| ||||||||||| ||||| |||||| ||||||| | | | Sbjct 1918 TCTGCGGGCAGCGAACTGTGTCTACAGCAACCTGTGGAGCGGAAACTGTGATC-TGCCCT 1976 Query 1531 AGC--T-TCT-CCA-ACAGGATGCTCTCCATTTCCGT-CT-CCCGTATTCTCTAACT-TG 1582 ||| | ||| ||| | || |||| ||||| | || | | ||| ||||| |||||| | Sbjct 1977 AGCGCTCTCTTCCAGA-AG-ATGCCCTCCAAT-CCTTTCCACCC-TATTCCCTAACTCTC 2032 Query 1583 TGGGACCTC-T--G----T-TT-TGTGGGTCT-GGCCTTGGGTGGGAACTGGGAGCAACG 1632 |||||||| | | | || |||||| || ||||||| || || ||||||| | | Sbjct 2033 -GGGACCTCGTTTGGGAGTGTTCTGTGGG-CTTGGCCTTGTGTCAGAGCTGGGAGTAGC- 2089 Query 1633 A-GGACA-TGGGTTT-AGTGCCCA-CTTGAGAGAGAGAAAAAGAGGGTTTCAGT-AAGGA 1687 | |||| ||||||| | | ||| || ||| ||||| | | ||| ||| || | Sbjct 2090 ATGGACTCTGGGTTTCA-TATCCAGCT-GAGTGAGAG-----G-G--TTTGAGTCAAA-A 2138 Query 1688 GCCTGGG-GTAGCATCCTGCCTCTGGCCAAAC-TT---CACCAAAGTATTAATGTGCAGA 1742 ||||||| | || ||||||||||| |||||| || ||||||||||||||||| |||| Sbjct 2139 GCCTGGGTG-AGAATCCTGCCTCTCCCCAAACATTAATCACCAAAGTATTAATGTACAGA 2197 Query 1743 GTGGTCCCTTGTCTGGGCCTTGCCTGTGCCAACCTGATGCCC-TTcccccccAAAGGGTG 1801 |||| |||| ||||||||| |||||||||||||||||||| |||||| || || || Sbjct 2198 GTGGCCCCTCACCTGGGCCTTTCCTGTGCCAACCTGATGCCCCTTCCCCAAGAA-GG-TG 2255 Query 1802 GGTTCTTATAATGGAAAATGCCCTGTGATGATAGGCCCAGTGGA 1845 || ||| | |||||||||| |||||| ||| |||||||||||| Sbjct 2256 AGTGCTTGTCATGGAAAATGTCCTGTGGTGACAGGCCCAGTGGA 2299 >gb|BC011813.1| UniGene infoGene info Homo sapiens cDNA clone IMAGE:3161064, containing frame-shift errors Length=2502 Score = 1914 bits (1036), Expect = 0.0 Identities = 1547/1784 (86%), Gaps = 73/1784 (4%) Strand=Plus/Plus Query 109 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCT 168 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct 542 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTGGAAGGGGGCCAGCT 601 Query 169 GGGGGGCGAGGAGTGGACCAGACACGGGAGCTTTGTCAATAAGCCCACACGAGGCTGGCT 228 |||||||||||||||||| | |||||||||||||||||||||||||| || |||||||| Sbjct 602 TGGGGGCGAGGAGTGGACCCGCCACGGGAGCTTTGTCAATAAGCCCACGCGGGGCTGGCT 661 Query 229 GCATCCCAACGACAAAGTCATGGGACCTGGGGTTTCCTACTTGGTTCGGTACATGGGCTG 288 ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| || Sbjct 662 GCATCCCAACGACAAAGTCATGGGACCCGGGGTTTCCTACTTGGTTCGGTACATGGGTTG 721 Query 289 TGTGGAGGTCTTACAGTCAATGCGAGCCCTTGACTTCAATACCCGGACTCAGGTCACCAG 348 |||||||||| | ||||||||||| ||||| |||||||| |||||||||||||||||||| Sbjct 722 TGTGGAGGTCCTCCAGTCAATGCGTGCCCTGGACTTCAACACCCGGACTCAGGTCACCAG 781 Query 349 GGAGGCCATCAGTTTGGTGTGTGAAGCTGTGCCTGGTGCCAAAGGGGCGACAAGGAGGAG 408 ||||||||||||| |||||||||| |||||||| ||||| || ||||||||||||||||| Sbjct 782 GGAGGCCATCAGTCTGGTGTGTGAGGCTGTGCCGGGTGCTAAGGGGGCGACAAGGAGGAG 841 Query 409 AAAGCCTTGTAGCCGCCCACTCAGCTCCATCCTGGGGAGGAGTAACCTGAAGTTTGCTGG 468 |||||| ||||||||||| |||||||| ||||||||||||||||||||||| |||||||| Sbjct 842 AAAGCCCTGTAGCCGCCCGCTCAGCTCTATCCTGGGGAGGAGTAACCTGAAATTTGCTGG 901 Query 469 AATGCCAATCACTCTCACTGTGTCTACCAGCAGCCTTAACCTCATGGCAGCCGACTGCAA 528 |||||||||||||||||| || || ||||||||||| ||||||||||| || |||||||| Sbjct 902 AATGCCAATCACTCTCACCGTCTCCACCAGCAGCCTCAACCTCATGGCCGCAGACTGCAA 961 Query 529 ACAGATCATTGCCAACCATCACATGCAATCTATCTC-TTTCGCGTCCGGTGGGGATCCGG 587 ||||||||| |||||||| ||||||||||||||||| ||| || ||||| |||||||||| Sbjct 962 ACAGATCATCGCCAACCACCACATGCAATCTATCTCATTT-GCATCCGGCGGGGATCCGG 1020 Query 588 ACACAGCTGAGTATGTTGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCATA 647 ||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| | Sbjct 1021 ACACAGCCGAGTATGTCGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCACA 1080 Query 648 TCCTGGAGTGTCCTGAAGGGCTTGCTCAGGATGTCATCAGCACCATCGGGCAGGCCTTTG 707 | ||||||||||| ||||||||||| |||||||||||||||||||| || |||||||| | Sbjct 1081 TTCTGGAGTGTCCCGAAGGGCTTGCCCAGGATGTCATCAGCACCATTGGCCAGGCCTTCG 1140 Query 708 AGTTGCGCTTCAAACAGTATCTCAGGAATCCACCGAAG-CTGGTCACCCCCCATGACAGG 766 |||||||||||||||| || |||||||| ||||| || ||||||||||| ||||||||| Sbjct 1141 AGTTGCGCTTCAAACAATACCTCAGGAACCCACCCAAAACTGGTCACCCCTCATGACAGG 1200 Query 767 ATGGCTGGCTTTGATGGCTCAGCTTGGGATGAGGAGGAAGAAGAGCCCCCTGACCATCAG 826 ||||||||||||||||||||||| |||||||||||||| |||||||| |||||||||||| Sbjct 1201 ATGGCTGGCTTTGATGGCTCAGCATGGGATGAGGAGGAGGAAGAGCCACCTGACCATCAG 1260 Query 827 TACTACAATGACTTTCCAGGGAAGGAACCCCCTCTTGGTGGGG-TGGTAGATATGAGGCT 885 ||||| |||||||| || |||||||||||||| ||||| |||| ||||||| |||||||| Sbjct 1261 TACTATAATGACTTCCCGGGGAAGGAACCCCC-CTTGGGGGGGGTGGTAGACATGAGGCT 1319 Query 886 TCGGGAAGG-G--GCT---G---CT-C--GACCCACT-CTGCCTAGTGCCCAGATGTCCA 932 ||||||||| | ||| | || | |||||||| | || | |||||||| ||| Sbjct 1320 TCGGGAAGGAGCCGCTCCAGGGGCTGCTCGACCCACTGCACCCAA-TGCCCAGACCCCCA 1378 Query 933 GCCACTTGGGAGCTACACTGCCTATAGGGCAGCATGCTGCAGGAGA-CCATGAAGTCCGT 991 ||||||||||||||||| ||||| |||| |||| || || ||||| ||| |||||||| Sbjct 1379 GCCACTTGGGAGCTACATTGCCTGTAGGACAGCCTGTTGGGGGAGATCCA-GAAGTCCGC 1437 Query 992 AAACAGATGTTGCCTCCGCCGCCTTGCCCAGGCAGAGAACTCTTCGATGACCCCTCCTAT 1051 ||||||||| ||||| || || || ||||||||||| || || ||||| ||||||||| Sbjct 1438 AAACAGATGCCACCTCCACCACCCTGTCCAGGCAGAGAGCTTTTTGATGATCCCTCCTAT 1497 Query 1052 GTCAACATCCAGAATCTAGACAAGGCCCGGCAGGCTGGGGGTGGGGCTGGGCCCCCAAAT 1111 |||||| ||||||| ||||||||||||||||| || | |||||| ||||||||||| ||| Sbjct 1498 GTCAACGTCCAGAACCTAGACAAGGCCCGGCAAGCAGTGGGTGGTGCTGGGCCCCCCAAT 1557 Query 1112 CCTTCTCTTAATGGCAGTGCACCCCGAGACCTTTTTGACATGAAGCCCTTTGAAGATGCA 1171 ||| || | ||||||||||||||||| ||||| ||||||||||||||||| |||||||| Sbjct 1558 CCTGCTATCAATGGCAGTGCACCCCGGGACCTGTTTGACATGAAGCCCTTCGAAGATGCT 1617 Query 1172 CTTCGGGTGCCACCCCCACCGCAGTCCATGTCCATGGCTGAGCAGCTGCAAGGGGAGCCC 1231 ||||| ||||| || || || ||||| ||||||||||||||||||| | |||||||||| Sbjct 1618 CTTCGCGTGCCTCCACCTCCCCAGTCGGTGTCCATGGCTGAGCAGCTCCGAGGGGAGCCC 1677 Query 1232 TGGTTCCACGGGAAGCTGAGCCGGAGGGAGGCCGAGGCGCTGCTGCAGCTCAATGGTGAC 1291 |||||||| ||||||||||||||| ||||||| ||||| ||||||||||||||||| ||| Sbjct 1678 TGGTTCCATGGGAAGCTGAGCCGGCGGGAGGCTGAGGCACTGCTGCAGCTCAATGGGGAC 1737 Query 1292 TTCTTGGTGCGAGAGAGCACGACCACGCCTGGCCAGTATGTGCTCACTGGCCTGCAGAGT 1351 ||| |||| || |||||||||||||| |||||||||||||||||||||||| |||||||| Sbjct 1738 TTCCTGGTACGGGAGAGCACGACCACACCTGGCCAGTATGTGCTCACTGGCTTGCAGAGT 1797 Query 1352 GGGCAGCCCAAGCACTTGCTGCTGGTGGACCCTGAAGGTGTGGTTCGGACAAAGGATCAC 1411 |||||||| ||||| ||||| |||||||||||||| |||||||||||||| ||||||||| Sbjct 1798 GGGCAGCCTAAGCATTTGCTACTGGTGGACCCTGAGGGTGTGGTTCGGACTAAGGATCAC 1857 Query 1412 CGCTTTGAGAGTGTCAGTCACCTGATCAGCTACCACATGGACAATCACTTGCCCATCATC 1471 ||| |||| |||||||||||||| |||||||||||||||||||||||||||||||||||| Sbjct 1858 CGCCTTGAAAGTGTCAGTCACCTTATCAGCTACCACATGGACAATCACTTGCCCATCATC 1917 Query 1472 TCTGCGGGCAGCGAACTGTGCCTACAGCAACCCGTGGATCGGAAAGTGTGATCCTTCTC- 1530 |||||||||||||||||||| ||||||||||| ||||| |||||| ||||||| | | | Sbjct 1918 TCTGCGGGCAGCGAACTGTGTCTACAGCAACCTGTGGAGCGGAAACTGTGATC-TGCCCT 1976 Query 1531 AGC--T-TCT-CCA-ACAGGATGCTCTCCATTTCCGT-CT-CCCGTATTCTCTAACT-TG 1582 ||| | ||| ||| | || |||| ||||| | || | | ||| ||||| |||||| | Sbjct 1977 AGCGCTCTCTTCCAGA-AG-ATGCCCTCCAAT-CCTTTCCACCC-TATTCCCTAACTCTC 2032 Query 1583 TGGGACCTC-T--G----T-TT-TGTGGGTCT-GGCCTTGGGTGGGAACTGGGAGCAACG 1632 |||||||| | | | || |||||| || ||||||| || || ||||||| | | Sbjct 2033 -GGGACCTCGTTTGGGAGTGTTCTGTGGG-CTTGGCCTTGTGTCAGAGCTGGGAGTAGC- 2089 Query 1633 A-GGACA-TGGGTTT-AGTGCCCA-CTTGAGAGAGAGAAAAAGAGGGTTTCAGT-AAGGA 1687 | |||| ||||||| | | ||| || ||| ||||| | | ||| ||| || | Sbjct 2090 ATGGACTCTGGGTTTCA-TATCCAGCT-GAGTGAGAG-----G-G--TTTGAGTCAAA-A 2138 Query 1688 GCCTGGG-GTAGCATCCTGCCTCTGGCCAAAC-TT---CACCAAAGTATTAATGTGCAGA 1742 ||||||| | || ||||||||||| |||||| || ||||||||||||||||| |||| Sbjct 2139 GCCTGGGTG-AGAATCCTGCCTCTCCCCAAACATTAATCACCAAAGTATTAATGTACAGA 2197 Query 1743 GTGGTCCCTTGTCTGGGCCTTGCCTGTGCCAACCTGATGCCC-TTcccccccAAAGGGTG 1801 |||| |||| ||||||||| |||||||||||||||||||| |||||| || || || Sbjct 2198 GTGGCCCCTCACCTGGGCCTTTCCTGTGCCAACCTGATGCCCCTTCCCCAAGAA-GG-TG 2255 Query 1802 GGTTCTTATAATGGAAAATGCCCTGTGATGATAGGCCCAGTGGA 1845 || ||| | |||||||||| |||||| ||| |||||||||||| Sbjct 2256 AGTGCTTGTCATGGAAAATGTCCTGTGGTGACAGGCCCAGTGGA 2299 >ref|NM_001075305.1| UniGene infoGene info Bos taurus SHC (Src homology 2 domain containing) transforming protein 1 (SHC1), mRNA gb|BC122688.1| UniGene infoGene info Bos taurus SHC (Src homology 2 domain containing) transforming protein 1, mRNA (cDNA clone MGC:142708 IMAGE:8097781), complete cds Length=3025 Score = 1910 bits (1034), Expect = 0.0 Identities = 1769/2103 (84%), Gaps = 133/2103 (6%) Strand=Plus/Plus Query 48 CAGTTGCGTGATCCGGAACCAGATCGGCCCGCGGTGCGGTGCGGAGACTCCATGA-GACC 106 |||| |||||||||||||||| ||||||||||||||||||||||||||||||||| | || Sbjct 8 CAGTGGCGTGATCCGGAACCAAATCGGCCCGCGGTGCGGTGCGGAGACTCCATGAAGTCC 67 Query 107 CTGGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTAGAAGGGGGCCAG 166 |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct 68 -TGGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTGGAAGGGGGCCAG 126 Query 167 CTGGGGGGCGAGGAGTGGAC-CAGACACGGGAGCTTTGTCAATAAGCCCACACGAGGCTG 225 |||||||||||||||||||| | | |||||||||||||||||||||||||| || ||||| Sbjct 127 CTGGGGGGCGAGGAGTGGACTC-GCCACGGGAGCTTTGTCAATAAGCCCACGCGGGGCTG 185 Query 226 GCTGCATCCCAACGACAAAGTCATGGGACCTGGGGTTTCCTACTTGGTTCGGTACATGGG 285 |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| Sbjct 186 GCTGCATCCCAACGACAAAGTCATGGGACCCGGGGTTTCCTACTTGGTTCGGTACATGGG 245 Query 286 CTGTGTGGAGGTCTTACAGTCAATGCGAGCCCTTGACTTCAATACCCGGACTCAGGTCAC 345 ||||||||||||| | ||||||||||| |||||||||||||| ||||||||||||||||| Sbjct 246 CTGTGTGGAGGTCCTGCAGTCAATGCGCGCCCTTGACTTCAACACCCGGACTCAGGTCAC 305 Query 346 CAGGGAGGCCATCAGTTTGGTGTGTGAAGCTGTGCCTGGTGCCAAAGGGGCGACAAGGAG 405 |||||||||||||||| |||||||||| |||||||| ||||| || ||||| |||||||| Sbjct 306 CAGGGAGGCCATCAGTCTGGTGTGTGAGGCTGTGCCGGGTGCTAAGGGGGCAACAAGGAG 365 Query 406 GAGAAAGCCTTGTAGCCGCCCACTCAGCTCCATCCTGGGGAGGAGTAACCTGAAGTTTGC 465 ||||||||| |||||||| |||||||||||||| |||||||||||||||||||| ||||| Sbjct 366 GAGAAAGCCCTGTAGCCGTCCACTCAGCTCCATTCTGGGGAGGAGTAACCTGAAATTTGC 425 Query 466 TGGAATGCCAATCACTCTCACTGTGTCTACCAGCAGCCTTAACCTCATGGCAGCCGACTG 525 |||||||||||||||||| || || || ||||||||||| ||||||||||| || ||||| Sbjct 426 TGGAATGCCAATCACTCTGACCGTCTCCACCAGCAGCCTCAACCTCATGGCCGCAGACTG 485 Query 526 CAAACAGATCATTGCCAACCATCACATGCAATCTATCTC-TTTCGCGTCCGGTGGGGATC 584 |||||||||||| |||||||| |||||||| || ||||| ||| || ||||| ||||| | Sbjct 486 CAAACAGATCATCGCCAACCACCACATGCAGTCCATCTCGTTT-GCATCCGGCGGGGACC 544 Query 585 CGGACACAGCTGAGTATGTTGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCC 644 |||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||| Sbjct 545 CGGACACAGCCGAGTATGTTGCCTATGTTGCCAAAGACCCGGTGAATCAGAGAGCCTGCC 604 Query 645 ATATCCTGGAGTGTCCTGAAGGGCTTGCTCAGGATGTCATCAGCACCATCGGGCAGGCCT 704 | |||||||||||||| |||||||| |||||||||||||||||||||||||| ||||||| Sbjct 605 ACATCCTGGAGTGTCCCGAAGGGCTCGCTCAGGATGTCATCAGCACCATCGGCCAGGCCT 664 Query 705 TTGAGTTGCGCTTCAAACAGTATCTCAGGAATCCACCGAAGCTGGTCACCCCCCATGACA 764 | ||| |||||||||||||||| |||||||| || || | ||| ||||||||||| |||| Sbjct 665 TCGAGCTGCGCTTCAAACAGTACCTCAGGAACCCGCCCAGGCTCGTCACCCCCCACGACA 724 Query 765 GGATGGCTGGCTTTGATGGCTCAGCTTGGGATGAGGAGGAAGAAGAGCCCCCTGACCATC 824 |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| Sbjct 725 GGATGGCTGGCTTTGATGGCTCAGCTTGGGATGAGGAGGAGGAAGAGCCCCCTGACCATC 784 Query 825 AGTACTACAATGACTTTCCAGGGAAGGAACCCCCTCTTGGTGGG-GTGGTAGATATGAGG 883 ||||||| |||||||| || ||||||||||| |||||||| ||| ||||| || |||||| Sbjct 785 AGTACTATAATGACTTCCCGGGGAAGGAACCACCTCTTGG-GGGTGTGGTGGACATGAGG 843 Query 884 CTTCGGGAAGG-G--------G---CTGCTCGACCCACTCTGCCTAGTGCCCAGATGTCC 931 ||||||||||| | | ||||||||||||||| ||| |||||||||| || Sbjct 844 CTTCGGGAAGGAGCCCTCCCAGGGGCTGCTCGACCCACTCCGCCCAGTGCCCAGACCCCC 903 Query 932 AGCCACTTGGGAGCTACACTGCCTATAGGGCAGCATGCTGCAGGAGACC-ATGAAGTCCG 990 |||||| ||||||| || |||||| | ||||||| ||||| ||||||| | |||| ||| Sbjct 904 AGCCACCTGGGAGCCACGCTGCCTGTGGGGCAGCCTGCTGGGGGAGACCCA-GAAGCCCG 962 Query 991 TAAACAGATGTTGCCTCCGCCGCCTTGCCCAGGCAGAGAACTCTTCGATGACCCCTCCTA 1050 | ||||||| ||| ||||| || || |||||||||| ||||| |||||||||||||| Sbjct 963 CAGACAGATGCCGCCCCCGCCACCCAGCTCAGGCAGAGAGCTCTTTGATGACCCCTCCTA 1022 Query 1051 TGTCAACATCCAGAATCTAGACAAGGCCCGGCAGGCTGGGGGTGGGGCTGGGCCCCCAAA 1110 |||||| ||||||| ||||||||||||||||| || |||| |||||| |||||||| || Sbjct 1023 TGTCAATGTCCAGAACCTAGACAAGGCCCGGCAAGCAGGGGCTGGGGCCGGGCCCCCCAA 1082 Query 1111 TCCTTCTCTT-AATGGCAGTGCACCCCGAGACCTTTTTGACATGAAGCCCTTTGAAGATG 1169 |||| | | | ||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct 1083 TCCTAC-CATCAATGGCAGTGCACCCCGAGACCTCTTTGACATGAAGCCCTTTGAAGATG 1141 Query 1170 CACTT-CGGGTGCCACCCCCACCGCAGTC--CATGTCCATGGCTGAGCAGCTGCAAGGGG 1226 | ||| || |||| || || || ||||| || | |||||||||||||||| | ||||| Sbjct 1142 C-CTTGCGAATGCCTCCACCTCCCCAGTCAACA-G-CCATGGCTGAGCAGCTCCGAGGGG 1198 Query 1227 AGCCCTGGTTCCACGGGAAGCTGAGCCGGAGGGAGGCCGAGGCGCTGCTGCA-GCTCAAT 1285 ||||||||||||||||||||||||||||| ||||||| ||||| |||| || | |||| Sbjct 1199 AGCCCTGGTTCCACGGGAAGCTGAGCCGGCGGGAGGCTGAGGCATTGCTACAAG-TCAAC 1257 Query 1286 GGTGACTTC-TTGGTGCGAGAGAGCACGACCACGCCTGGCCAGTATGTGCTCACTGGCCT 1344 || |||||| ||| |||| || ||||| |||||||| |||||||| |||||||| ||||| Sbjct 1258 GGGGACTTCCTTG-TGCGGGAAAGCACAACCACGCCGGGCCAGTACGTGCTCACCGGCCT 1316 Query 1345 GCAGAGTGGGCAGCCCAAGCACTTGCTGCTGGTGGACCCTGAAGGTGTGGTTCGGACAAA 1404 |||||||||||||||||||||| |||| |||||||||||||| ||||||||||||||||| Sbjct 1317 GCAGAGTGGGCAGCCCAAGCACCTGCTCCTGGTGGACCCTGAGGGTGTGGTTCGGACAAA 1376 Query 1405 GGATCACCGCTTTGAGAGTGTCAGTCACCTGATCAGCTACCACATGGACAATCACTTGCC 1464 |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| Sbjct 1377 GGATCACCGCTTTGAGAGTGTCAGTCACCTCATCAGCTACCACATGGACAATCACTTGCC 1436 Query 1465 CATCATCTCTGCGGGCAGCGAACTGTGCCTACAGCAACCCGTGGATCGGAAAGTGTGATC 1524 ||||||||||||||||||||||||||| || ||||| || ||||| |||||| ||||| | Sbjct 1437 CATCATCTCTGCGGGCAGCGAACTGTGTCTCCAGCAGCCTGTGGAGCGGAAACTGTGA-C 1495 Query 1525 CT-TCTC-AG--CTT-CTC-CA-ACAGGATGCTCTCCATTTCCGTCT-CCCGTATTCTCT 1576 || | || || ||| ||| || | || |||| || | | || || ||| ||||| || Sbjct 1496 CTGT-TCCAGTGCTTTCTCTCAGA-AG-ATGCCCTGCGGTCCCTTCCACCC-TATTCCCT 1551 Query 1577 AACT-TGTGGGACCTCTGTTT----TG-T----GGGTCTGGCCTTGGGT-GGGAACTGGG 1625 ||| | | ||||||| || || | ||| ||||||||| || ||| |||| Sbjct 1552 GACTCT-TAGGACCTCACTTGGGAGTGCTCCATGGGCCTGGCCTTGTGTAGGG--CTGG- 1607 Query 1626 AGCA-AC-GAGGACA-TGGGTTTAGTGCCCACTTG-AGA-GAGAGAAAAAGAGGGTTTCA 1680 || | || | ||||| |||||| || | | | | || ||| || |||||||| | Sbjct 1608 AG-ATACTGTGGACACTGGGTTCAG--C--A-T-GCAGCTGAGTGA----GAGGGTTTGA 1656 Query 1681 GTAAGGAGCCTGGGGTAGCA-TCCTGCCTCTGGCCAAACTTCACCAAAGTATTAATGTGC 1739 || |||| || ||||||| | |||||| ||| ||| || |||||||||||||||||| | Sbjct 1657 GTCAGGAACCAGGGGTAG-AGTCCTGCTTCTCCCCAGACCTCACCAAAGTATTAATGTAC 1715 Query 1740 AGAGTGGTCCC-TTGTCTGGGCCTTGCCTGTGCCAACCTGATGCCCTTcccccccAAAG- 1797 ||||||| ||| || ||||||||| ||||||||||| |||| |||| | |||||| | Sbjct 1716 AGAGTGGCCCCCTTCCCTGGGCCTTTCCTGTGCCAACTTGATACCCT-CTTCCCCAAGGT 1774 Query 1798 GG-TG--GG-----T--------T-C-T--TA-TAATGGAAAATGCCCTGTGATGATAGG 1836 || || || | | | | | | |||||| |||| ||||| |||||| Sbjct 1775 GGGTGCTGGAGGCCTGGGCAGGATGCCTCCTGGTCATGGAAGATGCTCTGTGGCGATAGG 1834 Query 1837 CCCAGTGGAGCAA-CTGCCCTTTGGGGGAAGGGAAA-T-AATTATACCTCTGGTTTACTC 1893 ||||| ||||||| | |||||| |||||||| || | ||| |||||| | || ||| | Sbjct 1835 CCCAGCGGAGCAATCA-CCCTTTCAGGGAAGGGGAACTGAATCATACCTTTAGTCTACCC 1893 Query 1894 CTGGGTCTTCAGGGTACCCCAGA-TCC-CGCATAACATATCCCACTCCCTCTGCTTCCCC 1951 ||||| || |||||||||||||| ||| | || | || | ||| |||||| | | Sbjct 1894 CTGGG-CT-CAGGGTACCCCAGACTCCTCTCA-A-CA-A-CCC--TCCCTCC-CAGCA-- 1942 Query 1952 TT-AAACTTTGTGCCTTTGACTATCA--TAGGTCTGCAGATACTTAATGCA--GAGTTCT 2006 || |||||||||||||||||| ||| |||||||| ||||| || ||||| ||||||| Sbjct 1943 TTCAAACTTTGTGCCTTTGACCATCTCCTAGGTCTGAAGATATTTTATGCAAAGAGTTCT 2002 Query 2007 CAGGCCCTTCACGTGT-GGACAGGGGTTACTGCCA-C--CTTGGCTTCTGG-AGCCCTGT 2061 ||||| | | || ||| ||||| ||| || | |||||||||||| | ||| || Sbjct 2003 TGGGCCCCTGAAGTCAAGGATGGGGGTG-CTGACAGCTTCTTGGCTTCTGGGACCCC-GT 2060 Query 2062 CCT 2064 ||| Sbjct 2061 CCT 2063 >emb|Y09847.1|HSSHC7 Gene info H.sapiens shc gene, p66 isoform Length=1879 Score = 1842 bits (997), Expect = 0.0 Identities = 1347/1513 (89%), Gaps = 36/1513 (2%) Strand=Plus/Plus Query 109 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCT 168 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct 331 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTGGAAGGGGGCCAGCT 390 Query 169 GGGGGGCGAGGAGTGGACCAGACACGGGAGCTTTGTCAATAAGCCCACACGAGGCTGGCT 228 |||||||||||||||||| | |||||||||||||||||||||||||| || |||||||| Sbjct 391 TGGGGGCGAGGAGTGGACCCGCCACGGGAGCTTTGTCAATAAGCCCACGCGGGGCTGGCT 450 Query 229 GCATCCCAACGACAAAGTCATGGGACCTGGGGTTTCCTACTTGGTTCGGTACATGGGCTG 288 ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| || Sbjct 451 GCATCCCAACGACAAAGTCATGGGACCCGGGGTTTCCTACTTGGTTCGGTACATGGGTTG 510 Query 289 TGTGGAGGTCTTACAGTCAATGCGAGCCCTTGACTTCAATACCCGGACTCAGGTCACCAG 348 |||||||||| | ||||||||||| ||||| |||||||| |||||||||||||||||||| Sbjct 511 TGTGGAGGTCCTCCAGTCAATGCGTGCCCTGGACTTCAACACCCGGACTCAGGTCACCAG 570 Query 349 GGAGGCCATCAGTTTGGTGTGTGAAGCTGTGCCTGGTGCCAAAGGGGCGACAAGGAGGAG 408 ||||||||||||| |||||||||| |||||||| ||||| || ||||||||||||||||| Sbjct 571 GGAGGCCATCAGTCTGGTGTGTGAGGCTGTGCCGGGTGCTAAGGGGGCGACAAGGAGGAG 630 Query 409 AAAGCCTTGTAGCCGCCCACTCAGCTCCATCCTGGGGAGGAGTAACCTGAAGTTTGCTGG 468 |||||| ||||||||||| |||||||| ||||||||||||||||||||||| |||||||| Sbjct 631 AAAGCCCTGTAGCCGCCCGCTCAGCTCTATCCTGGGGAGGAGTAACCTGAAATTTGCTGG 690 Query 469 AATGCCAATCACTCTCACTGTGTCTACCAGCAGCCTTAACCTCATGGCAGCCGACTGCAA 528 |||||||||||||||||| || || ||||||||||| ||||||||||| || |||||||| Sbjct 691 AATGCCAATCACTCTCACCGTCTCCACCAGCAGCCTCAACCTCATGGCCGCAGACTGCAA 750 Query 529 ACAGATCATTGCCAACCATCACATGCAATCTATCTC-TTTCGCGTCCGGTGGGGATCCGG 587 ||||||||| |||||||| ||||||||||||||||| ||| || ||||| |||||||||| Sbjct 751 ACAGATCATCGCCAACCACCACATGCAATCTATCTCATTT-GCATCCGGCGGGGATCCGG 809 Query 588 ACACAGCTGAGTATGTTGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCATA 647 ||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| | Sbjct 810 ACACAGCCGAGTATGTCGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCACA 869 Query 648 TCCTGGAGTGTCCTGAAGGGCTTGCTCAGGATGTCATCAGCACCATCGGGCAGGCCTTTG 707 | ||||||||||| ||||||||||| |||||||||||||||||||| || |||||||| | Sbjct 870 TTCTGGAGTGTCCCGAAGGGCTTGCCCAGGATGTCATCAGCACCATTGGCCAGGCCTTCG 929 Query 708 AGTTGCGCTTCAAACAGTATCTCAGGAATCCACCGAAGCTGGTCACCCCCCATGACAGGA 767 |||||||||||||||| || |||||||| ||||| || ||||||||||| |||||||||| Sbjct 930 AGTTGCGCTTCAAACAATACCTCAGGAACCCACCCAAACTGGTCACCCCTCATGACAGGA 989 Query 768 TGGCTGGCTTTGATGGCTCAGCTTGGGATGAGGAGGAAGAAGAGCCCCCTGACCATCAGT 827 |||||||||||||||||||||| |||||||||||||| |||||||| ||||||||||||| Sbjct 990 TGGCTGGCTTTGATGGCTCAGCATGGGATGAGGAGGAGGAAGAGCCACCTGACCATCAGT 1049 Query 828 ACTACAATGACTTTCCAGGGAAGGAACCCCCTCTTGGTGGGG-TGGTAGATATGAGGCTT 886 |||| |||||||| || |||||||||||||| ||||| |||| ||||||| ||||||||| Sbjct 1050 ACTATAATGACTTCCCGGGGAAGGAACCCCC-CTTGGGGGGGGTGGTAGACATGAGGCTT 1108 Query 887 CGGGAAGG-G--GCT---G---CT-C--GACCCACT-CTGCCTAGTGCCCAGATGTCCAG 933 |||||||| | ||| | || | |||||||| | || | |||||||| |||| Sbjct 1109 CGGGAAGGAGCCGCTCCAGGGGCTGCTCGACCCACTGCACCCAA-TGCCCAGACCCCCAG 1167 Query 934 CCACTTGGGAGCTACACTGCCTATAGGGCAGCATGCTGCAGGAGA-CCATGAAGTCCGTA 992 |||||||||||||||| ||||| |||| |||| || || ||||| ||| |||||||| | Sbjct 1168 CCACTTGGGAGCTACATTGCCTGTAGGACAGCCTGTTGGGGGAGATCCA-GAAGTCCGCA 1226 Query 993 AACAGATGTTGCCTCCGCCGCCTTGCCCAGGCAGAGAACTCTTCGATGACCCCTCCTATG 1052 |||||||| ||||| || || || ||||||||||| || || ||||| |||||||||| Sbjct 1227 AACAGATGCCACCTCCACCACCCTGTCCAGGCAGAGAGCTTTTTGATGATCCCTCCTATG 1286 Query 1053 TCAACATCCAGAATCTAGACAAGGCCCGGCAGGCTGGGGGTGGGGCTGGGCCCCCAAATC 1112 ||||| ||||||| ||||||||||||||||| || | |||||| ||||||||||| |||| Sbjct 1287 TCAACGTCCAGAACCTAGACAAGGCCCGGCAAGCAGTGGGTGGTGCTGGGCCCCCCAATC 1346 Query 1113 CTTCTCTTAATGGCAGTGCACCCCGAGACCTTTTTGACATGAAGCCCTTTGAAGATGCAC 1172 || || | ||||||||||||||||| ||||| ||||||||||||||||| |||||||| | Sbjct 1347 CTGCTATCAATGGCAGTGCACCCCGGGACCTGTTTGACATGAAGCCCTTCGAAGATGCTC 1406 Query 1173 TTCGGGTGCCACCCCCACCGCAGTCCATGTCCATGGCTGAGCAGCTGCAAGGGGAGCCCT 1232 |||||||||| || || || ||||| ||||||||||||||||||| | ||||||||||| Sbjct 1407 TTCGGGTGCCTCCACCTCCCCAGTCGGTGTCCATGGCTGAGCAGCTCCGAGGGGAGCCCT 1466 Query 1233 GGTTCCACGGGAAGCTGAGCCGGAGGGAGGCCGAGGCGCTGCTGCAGCTCAATGGTGACT 1292 ||||||| ||||||||||||||| ||||||| ||||| ||||||||||||||||| |||| Sbjct 1467 GGTTCCATGGGAAGCTGAGCCGGCGGGAGGCTGAGGCACTGCTGCAGCTCAATGGGGACT 1526 Query 1293 TCTTGGTGCGAGAGAGCACGACCACGCCTGGCCAGTATGTGCTCACTGGCCTGCAGAGTG 1352 ||||||| || |||||||||||||| |||||||||||||||||||||||| ||||||||| Sbjct 1527 TCTTGGTACGGGAGAGCACGACCACACCTGGCCAGTATGTGCTCACTGGCTTGCAGAGTG 1586 Query 1353 GGCAGCCCAAGCACTTGCTGCTGGTGGACCCTGAAGGTGTGGTTCGGACAAAGGATCACC 1412 ||||||| ||||| ||||| |||||||||||||| |||||||||||||| |||||||||| Sbjct 1587 GGCAGCCTAAGCATTTGCTACTGGTGGACCCTGAGGGTGTGGTTCGGACTAAGGATCACC 1646 Query 1413 GCTTTGAGAGTGTCAGTCACCTGATCAGCTACCACATGGACAATCACTTGCCCATCATCT 1472 ||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct 1647 GCTTTGAAAGTGTCAGTCACCTTATCAGCTACCACATGGACAATCACTTGCCCATCATCT 1706 Query 1473 CTGCGGGCAGCGAACTGTGCCTACAGCAACCCGTGGATCGGAAAGTGTGATCCTTCTC-A 1531 ||||||||||||||||||| ||||||||||| ||||| |||||| ||||||| | | | | Sbjct 1707 CTGCGGGCAGCGAACTGTGTCTACAGCAACCTGTGGAGCGGAAACTGTGATC-TGCCCTA 1765 Query 1532 GC--T-TCT-CCA-ACAGGATGCTCTCCATTTCCGT-CT-CCCGTATTCTCTAACT-TGT 1583 || | ||| ||| | || |||| ||||| | || | | ||| ||||| |||||| | Sbjct 1766 GCGCTCTCTTCCAGA-AG-ATGCCCTCCAAT-CCTTTCCACCC-TATTCCCTAACTCTC- 1820 Query 1584 GGGACCTCTGTTT 1596 |||||||| |||| Sbjct 1821 GGGACCTC-GTTT 1832 >ref|NM_183001.3| UniGene infoGeoGene info Homo sapiens SHC (Src homology 2 domain containing) transforming protein 1 (SHC1), transcript variant 1, mRNA Length=1752 Score = 1836 bits (994), Expect = 0.0 Identities = 1288/1430 (90%), Gaps = 20/1430 (1%) Strand=Plus/Plus Query 109 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCT 168 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct 327 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTGGAAGGGGGCCAGCT 386 Query 169 GGGGGGCGAGGAGTGGACCAGACACGGGAGCTTTGTCAATAAGCCCACACGAGGCTGGCT 228 |||||||||||||||||| | |||||||||||||||||||||||||| || |||||||| Sbjct 387 TGGGGGCGAGGAGTGGACCCGCCACGGGAGCTTTGTCAATAAGCCCACGCGGGGCTGGCT 446 Query 229 GCATCCCAACGACAAAGTCATGGGACCTGGGGTTTCCTACTTGGTTCGGTACATGGGCTG 288 ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| || Sbjct 447 GCATCCCAACGACAAAGTCATGGGACCCGGGGTTTCCTACTTGGTTCGGTACATGGGTTG 506 Query 289 TGTGGAGGTCTTACAGTCAATGCGAGCCCTTGACTTCAATACCCGGACTCAGGTCACCAG 348 |||||||||| | ||||||||||| ||||| |||||||| |||||||||||||||||||| Sbjct 507 TGTGGAGGTCCTCCAGTCAATGCGTGCCCTGGACTTCAACACCCGGACTCAGGTCACCAG 566 Query 349 GGAGGCCATCAGTTTGGTGTGTGAAGCTGTGCCTGGTGCCAAAGGGGCGACAAGGAGGAG 408 ||||||||||||| |||||||||| |||||||| ||||| || ||||||||||||||||| Sbjct 567 GGAGGCCATCAGTCTGGTGTGTGAGGCTGTGCCGGGTGCTAAGGGGGCGACAAGGAGGAG 626 Query 409 AAAGCCTTGTAGCCGCCCACTCAGCTCCATCCTGGGGAGGAGTAACCTGAAGTTTGCTGG 468 |||||| ||||||||||| |||||||| ||||||||||||||||||||||| |||||||| Sbjct 627 AAAGCCCTGTAGCCGCCCGCTCAGCTCTATCCTGGGGAGGAGTAACCTGAAATTTGCTGG 686 Query 469 AATGCCAATCACTCTCACTGTGTCTACCAGCAGCCTTAACCTCATGGCAGCCGACTGCAA 528 |||||||||||||||||| || || ||||||||||| ||||||||||| || |||||||| Sbjct 687 AATGCCAATCACTCTCACCGTCTCCACCAGCAGCCTCAACCTCATGGCCGCAGACTGCAA 746 Query 529 ACAGATCATTGCCAACCATCACATGCAATCTATCTC-TTTCGCGTCCGGTGGGGATCCGG 587 ||||||||| |||||||| ||||||||||||||||| ||| || ||||| |||||||||| Sbjct 747 ACAGATCATCGCCAACCACCACATGCAATCTATCTCATTT-GCATCCGGCGGGGATCCGG 805 Query 588 ACACAGCTGAGTATGTTGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCATA 647 ||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| | Sbjct 806 ACACAGCCGAGTATGTCGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCACA 865 Query 648 TCCTGGAGTGTCCTGAAGGGCTTGCTCAGGATGTCATCAGCACCATCGGGCAGGCCTTTG 707 | ||||||||||| ||||||||||| |||||||||||||||||||| || |||||||| | Sbjct 866 TTCTGGAGTGTCCCGAAGGGCTTGCCCAGGATGTCATCAGCACCATTGGCCAGGCCTTCG 925 Query 708 AGTTGCGCTTCAAACAGTATCTCAGGAATCCACCGAAGCTGGTCACCCCCCATGACAGGA 767 |||||||||||||||| || |||||||| ||||| || ||||||||||| |||||||||| Sbjct 926 AGTTGCGCTTCAAACAATACCTCAGGAACCCACCCAAACTGGTCACCCCTCATGACAGGA 985 Query 768 TGGCTGGCTTTGATGGCTCAGCTTGGGATGAGGAGGAAGAAGAGCCCCCTGACCATCAGT 827 |||||||||||||||||||||| |||||||||||||| |||||||| ||||||||||||| Sbjct 986 TGGCTGGCTTTGATGGCTCAGCATGGGATGAGGAGGAGGAAGAGCCACCTGACCATCAGT 1045 Query 828 ACTACAATGACTTTCCAGGGAAGGAACCCCCTCTTGGTGGGG-TGGTAGATATGAGGCTT 886 |||| |||||||| || |||||||||||||| ||||| |||| ||||||| ||||||||| Sbjct 1046 ACTATAATGACTTCCCGGGGAAGGAACCCCC-CTTGGGGGGGGTGGTAGACATGAGGCTT 1104 Query 887 CGGGAAGG-G--GCT---G---CT-C--GACCCACT-CTGCCTAGTGCCCAGATGTCCAG 933 |||||||| | ||| | || | |||||||| | || | |||||||| |||| Sbjct 1105 CGGGAAGGAGCCGCTCCAGGGGCTGCTCGACCCACTGCACCCAA-TGCCCAGACCCCCAG 1163 Query 934 CCACTTGGGAGCTACACTGCCTATAGGGCAGCATGCTGCAGGAGA-CCATGAAGTCCGTA 992 |||||||||||||||| ||||| |||| |||| || || ||||| ||| |||||||| | Sbjct 1164 CCACTTGGGAGCTACATTGCCTGTAGGACAGCCTGTTGGGGGAGATCCA-GAAGTCCGCA 1222 Query 993 AACAGATGTTGCCTCCGCCGCCTTGCCCAGGCAGAGAACTCTTCGATGACCCCTCCTATG 1052 |||||||| ||||| || || || ||||||||||| || || ||||| |||||||||| Sbjct 1223 AACAGATGCCACCTCCACCACCCTGTCCAGGCAGAGAGCTTTTTGATGATCCCTCCTATG 1282 Query 1053 TCAACATCCAGAATCTAGACAAGGCCCGGCAGGCTGGGGGTGGGGCTGGGCCCCCAAATC 1112 ||||| ||||||| ||||||||||||||||| || | |||||| ||||||||||| |||| Sbjct 1283 TCAACGTCCAGAACCTAGACAAGGCCCGGCAAGCAGTGGGTGGTGCTGGGCCCCCCAATC 1342 Query 1113 CTTCTCTTAATGGCAGTGCACCCCGAGACCTTTTTGACATGAAGCCCTTTGAAGATGCAC 1172 || || | ||||||||||||||||| ||||| ||||||||||||||||| |||||||| | Sbjct 1343 CTGCTATCAATGGCAGTGCACCCCGGGACCTGTTTGACATGAAGCCCTTCGAAGATGCTC 1402 Query 1173 TTCGGGTGCCACCCCCACCGCAGTCCATGTCCATGGCTGAGCAGCTGCAAGGGGAGCCCT 1232 |||||||||| || || || ||||| ||||||||||||||||||| | ||||||||||| Sbjct 1403 TTCGGGTGCCTCCACCTCCCCAGTCGGTGTCCATGGCTGAGCAGCTCCGAGGGGAGCCCT 1462 Query 1233 GGTTCCACGGGAAGCTGAGCCGGAGGGAGGCCGAGGCGCTGCTGCAGCTCAATGGTGACT 1292 ||||||| ||||||||||||||| ||||||| ||||| ||||||||||||||||| |||| Sbjct 1463 GGTTCCATGGGAAGCTGAGCCGGCGGGAGGCTGAGGCACTGCTGCAGCTCAATGGGGACT 1522 Query 1293 TCTTGGTGCGAGAGAGCACGACCACGCCTGGCCAGTATGTGCTCACTGGCCTGCAGAGTG 1352 ||||||| || |||||||||||||| |||||||||||||||||||||||| ||||||||| Sbjct 1523 TCTTGGTACGGGAGAGCACGACCACACCTGGCCAGTATGTGCTCACTGGCTTGCAGAGTG 1582 Query 1353 GGCAGCCCAAGCACTTGCTGCTGGTGGACCCTGAAGGTGTGGTTCGGACAAAGGATCACC 1412 ||||||| ||||| ||||| |||||||||||||| |||||||||||||| |||||||||| Sbjct 1583 GGCAGCCTAAGCATTTGCTACTGGTGGACCCTGAGGGTGTGGTTCGGACTAAGGATCACC 1642 Query 1413 GCTTTGAGAGTGTCAGTCACCTGATCAGCTACCACATGGACAATCACTTGCCCATCATCT 1472 ||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct 1643 GCTTTGAAAGTGTCAGTCACCTTATCAGCTACCACATGGACAATCACTTGCCCATCATCT 1702 Query 1473 CTGCGGGCAGCGAACTGTGCCTACAGCAACCCGTGGATCGGAAAGTGTGA 1522 ||||||||||||||||||| ||||||||||| ||||| |||||| ||||| Sbjct 1703 CTGCGGGCAGCGAACTGTGTCTACAGCAACCTGTGGAGCGGAAACTGTGA 1752 >dbj|AK225332.1| UniGene infoGene info Homo sapiens mRNA for SHC transforming protein 1 variant, clone: HEP09014 Length=1958 Score = 1823 bits (987), Expect = 0.0 Identities = 1287/1432 (89%), Gaps = 20/1432 (1%) Strand=Plus/Plus Query 109 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCT 168 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct 473 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTGGAAGGGGGCCAGCT 532 Query 169 GGGGGGCGAGGAGTGGACCAGACACGGGAGCTTTGTCAATAAGCCCACACGAGGCTGGCT 228 |||||||||||||||||| | |||||||||||||||||||||||||| || |||||||| Sbjct 533 TGGGGGCGAGGAGTGGACCCGCCACGGGAGCTTTGTCAATAAGCCCACGCGGGGCTGGCT 592 Query 229 GCATCCCAACGACAAAGTCATGGGACCTGGGGTTTCCTACTTGGTTCGGTACATGGGCTG 288 ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| || Sbjct 593 GCATCCCAACGACAAAGTCATGGGACCCGGGGTTTCCTACTTGGTTCGGTACATGGGTTG 652 Query 289 TGTGGAGGTCTTACAGTCAATGCGAGCCCTTGACTTCAATACCCGGACTCAGGTCACCAG 348 |||||||||| | ||||||||||| ||||| |||||||| |||||||||||||||||||| Sbjct 653 TGTGGAGGTCCTCCAGTCAATGCGTGCCCTGGACTTCAACACCCGGACTCAGGTCACCAG 712 Query 349 GGAGGCCATCAGTTTGGTGTGTGAAGCTGTGCCTGGTGCCAAAGGGGCGACAAGGAGGAG 408 ||||||||||||| |||||||||| |||||||| ||||| || ||||||||||||||||| Sbjct 713 GGAGGCCATCAGTCTGGTGTGTGAGGCTGTGCCGGGTGCTAAGGGGGCGACAAGGAGGAG 772 Query 409 AAAGCCTTGTAGCCGCCCACTCAGCTCCATCCTGGGGAGGAGTAACCTGAAGTTTGCTGG 468 |||||| ||||||||||| |||||||| ||||||||||||||||||||||| |||||||| Sbjct 773 AAAGCCCTGTAGCCGCCCGCTCAGCTCTATCCTGGGGAGGAGTAACCTGAAATTTGCTGG 832 Query 469 AATGCCAATCACTCTCACTGTGTCTACCAGCAGCCTTAACCTCATGGCAGCCGACTGCAA 528 |||||||||||||||||| || || ||||||||||| ||||||||||| || |||||||| Sbjct 833 AATGCCAATCACTCTCACCGTCTCCACCAGCAGCCTCAACCTCATGGCCGCAGACTGCAA 892 Query 529 ACAGATCATTGCCAACCATCACATGCAATCTATCTC-TTTCGCGTCCGGTGGGGATCCGG 587 ||||||||| |||||||| ||||||||||||||||| ||| || ||||| |||||||||| Sbjct 893 ACAGATCATCGCCAACCACCACATGCAATCTATCTCATTT-GCATCCGGCGGGGATCCGG 951 Query 588 ACACAGCTGAGTATGTTGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCATA 647 ||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| | Sbjct 952 ACACAGCCGAGTATGTCGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCACA 1011 Query 648 TCCTGGAGTGTCCTGAAGGGCTTGCTCAGGATGTCATCAGCACCATCGGGCAGGCCTTTG 707 | ||||||||||| ||||||||||| |||||||||||||||||||| || |||||||| | Sbjct 1012 TTCTGGAGTGTCCCGAAGGGCTTGCCCAGGATGTCATCAGCACCATTGGCCAGGCCTTCG 1071 Query 708 AGTTGCGCTTCAAACAGTATCTCAGGAATCCACCGAAGCTGGTCACCCCCCATGACAGGA 767 |||||||||||||||| || |||||||| ||||| || ||||||||||| |||||||||| Sbjct 1072 AGTTGCGCTTCAAACAATACCTCAGGAACCCACCCAAACTGGTCACCCCTCATGACAGGA 1131 Query 768 TGGCTGGCTTTGATGGCTCAGCTTGGGATGAGGAGGAAGAAGAGCCCCCTGACCATCAGT 827 |||||||||||||||||||||| |||||||||||||| |||||||| ||||||||||||| Sbjct 1132 TGGCTGGCTTTGATGGCTCAGCATGGGATGAGGAGGAGGAAGAGCCACCTGACCATCAGT 1191 Query 828 ACTACAATGACTTTCCAGGGAAGGAACCCCCTCTTGGTGGGG-TGGTAGATATGAGGCTT 886 |||| |||||||| || |||||||||||||| ||||| |||| ||||||| ||||||||| Sbjct 1192 ACTATAATGACTTCCCGGGGAAGGAACCCCC-CTTGGGGGGGGTGGTAGACATGAGGCTT 1250 Query 887 CGGGAAGG-G--GCT---G---CT-C--GACCCACT-CTGCCTAGTGCCCAGATGTCCAG 933 |||||||| | ||| | || | |||||||| | || | |||||||| |||| Sbjct 1251 CGGGAAGGAGCCGCTCCAGGGGCTGCTCGACCCACTGCACCCAA-TGCCCAGACCCCCAG 1309 Query 934 CCACTTGGGAGCTACACTGCCTATAGGGCAGCATGCTGCAGGAGA-CCATGAAGTCCGTA 992 |||||||||||||||| ||||| |||| |||| || || ||||| ||| |||||||| | Sbjct 1310 CCACTTGGGAGCTACATTGCCTGTAGGACAGCCTGTTGGGGGAGATCCA-GAAGTCCGCA 1368 Query 993 AACAGATGTTGCCTCCGCCGCCTTGCCCAGGCAGAGAACTCTTCGATGACCCCTCCTATG 1052 |||||||| ||||| || || || ||||||||||| || || ||||| |||||||||| Sbjct 1369 AACAGATGCCACCTCCACCACCCTGTCCAGGCAGAGAGCTTTTTGATGATCCCTCCTATG 1428 Query 1053 TCAACATCCAGAATCTAGACAAGGCCCGGCAGGCTGGGGGTGGGGCTGGGCCCCCAAATC 1112 ||||| ||||||| ||||||||||||||||| || | |||||| ||||||||||| |||| Sbjct 1429 TCAACGTCCAGAACCTAGACAAGGCCCGGCAAGCAGTGGGTGGTGCTGGGCCCCCCAATC 1488 Query 1113 CTTCTCTTAATGGCAGTGCACCCCGAGACCTTTTTGACATGAAGCCCTTTGAAGATGCAC 1172 || || | ||||||||||||||||| ||||| ||||||||||||||||| |||||||| | Sbjct 1489 CTGCTATCAATGGCAGTGCACCCCGGGACCTGTTTGACATGAAGCCCTTCGAAGATGCTC 1548 Query 1173 TTCGGGTGCCACCCCCACCGCAGTCCATGTCCATGGCTGAGCAGCTGCAAGGGGAGCCCT 1232 |||| ||||| || || || ||||| ||||||||||||||||||| | ||||||||||| Sbjct 1549 TTCGCGTGCCTCCACCTCCCCAGTCGGTGTCCATGGCTGAGCAGCTCCGAGGGGAGCCCT 1608 Query 1233 GGTTCCACGGGAAGCTGAGCCGGAGGGAGGCCGAGGCGCTGCTGCAGCTCAATGGTGACT 1292 ||||||| ||||||||||||||| ||||||| ||||| ||||||||||||||||| |||| Sbjct 1609 GGTTCCATGGGAAGCTGAGCCGGCGGGAGGCTGAGGCACTGCTGCAGCTCAATGGGGACT 1668 Query 1293 TCTTGGTGCGAGAGAGCACGACCACGCCTGGCCAGTATGTGCTCACTGGCCTGCAGAGTG 1352 || |||| || |||||||||||||| |||||||||||||||||||||||| ||||||||| Sbjct 1669 TCCTGGTACGGGAGAGCACGACCACACCTGGCCAGTATGTGCTCACTGGCTTGCAGAGTG 1728 Query 1353 GGCAGCCCAAGCACTTGCTGCTGGTGGACCCTGAAGGTGTGGTTCGGACAAAGGATCACC 1412 ||||||| ||||| ||||| ||||||||||||| |||||||||||||| |||||||||| Sbjct 1729 GGCAGCCTAAGCATTTGCTACTGGTGGACCCTGCGGGTGTGGTTCGGACTAAGGATCACC 1788 Query 1413 GCTTTGAGAGTGTCAGTCACCTGATCAGCTACCACATGGACAATCACTTGCCCATCATCT 1472 ||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct 1789 GCTTTGAAAGTGTCAGTCACCTTATCAGCTACCACATGGACAATCACTTGCCCATCATCT 1848 Query 1473 CTGCGGGCAGCGAACTGTGCCTACAGCAACCCGTGGATCGGAAAGTGTGATC 1524 ||||||||||||||||||| ||||||||||| ||||| |||||| ||||||| Sbjct 1849 CTGCGGGCAGCGAACTGTGTCTACAGCAACCTGTGGAGCGGAAACTGTGATC 1900 >ref|XR_005512.1| UniGene infoGene info PREDICTED: Rattus norvegicus similar to src homology 2 domain-containing transforming protein C1 (LOC500206), mRNA Length=1370 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 1770 bits (958), Expect = 0.0 Identities = 1154/1250 (92%), Gaps = 8/1250 (0%) Strand=Plus/Plus Query 277 GTACATGGGCTGTGTGGAGGTCTTACAGTCAATGCGAGCCCTTGACTTCAATACCCGGAC 336 ||||||| | || ||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 125 GTACATGAGTTGCGTGGAGGTCTTACAGTCAATGCGAGCCCTTGACTTCAATACCCGGAC 184 Query 337 TCAGGTCACCAGGGAGGCCATCAGTTTGGTGTGTGAAGCTGTGCCTGGTGCCAAAGGGGC 396 |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct 185 TCAGGTCACCAGGGAGGCCATCGGTTTGGTGTGTGAAGCTGTGCCTGGTGCCAAAGGGGC 244 Query 397 GACAAGGAGGAGAAAG-CCTTGTAGCCGCCCACTCAGCTCCATCCTGGGGAGGAGTAACC 455 ||| | |||||||||| ||| | ||||||||||||||||| ||||||||||||||||||| Sbjct 245 GACGACGAGGAGAAAGTCCT-GCAGCCGCCCACTCAGCTCTATCCTGGGGAGGAGTAACC 303 Query 456 TGAAGTTTGCTGGAATGCCAATCACTCTCACTGTGTCTACCAGCAGCCTTAACCTCATGG 515 |||||||||||||| |||| |||| |||||||| ||||||||||||||| |||||||||| Sbjct 304 TGAAGTTTGCTGGAGTGCCGATCATTCTCACTGCGTCTACCAGCAGCCT-AACCTCATGG 362 Query 516 CAGCCGACTGCAAACAGATCATTGCCAACCATCACATGCAATCTATCTCTTTCGCGTCCG 575 |||| ||| |||| ||||||||||||||||||||||||||||||||| | |||||||| | Sbjct 363 CAGCAGACCGCAAGCAGATCATTGCCAACCATCACATGCAATCTATCCCATTCGCGTCTG 422 Query 576 GTGGGGATCCGGACACAGCTGAGTATGTTGCCTATGTTGCCAAAGACCCTGTGAATCAGA 635 ||||| ||| ||||||| ||||||| ||||||||||||||||||||||||| |||||||| Sbjct 423 GTGGGAATCTGGACACAACTGAGTACGTTGCCTATGTTGCCAAAGACCCTGCGAATCAGA 482 Query 636 GAGCCTGCCATATCCTGGAGTGTCCTGAAGGGCTTGCTCAGGATGTCATCAGCACCATCG 695 ||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||| Sbjct 483 GAGCCTGCCATATCCTGGAGTGTCCTGAAGGACTTGCTCAGGACGTCATCAGCACCATCG 542 Query 696 GGCAGGCCTTTGAGTTGCGCTTCAAACAGTATCTCAGGAATCCACCGAAGCTGGTCACCC 755 ||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||| Sbjct 543 GGCAGGCCTTTGAGTTGCGCTTCAAACAGTATCTCAGGAATTCACCCAAGCTGGTCACCC 602 Query 756 CCCATGACAGGATGGCTGGCTTTGATGGCTCAGCTTGGGATGAGGAGGAAGAAGAGCCCC 815 ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| Sbjct 603 CCCATGACAGGATGGCTGGCTTTGATGACTCAGCTTGGGATGAGGAGGAAGAAGAGCCCC 662 Query 816 CTGACCATCAGTACTACAATGACTTTCCAGGGAAGGAACCCCCTCTTGGTGGG-GTGGTA 874 ||||||||||||||||||||||||| ||||||||||||||||||| |||| || |||||| Sbjct 663 CTGACCATCAGTACTACAATGACTTCCCAGGGAAGGAACCCCCTCCTGGTTGGAGTGGTA 722 Query 875 GATATGAGGCTTCGGGAAGGGGCTGCTCGACCCACTCTGCCTAGTGCCCAGATGTC-CAG 933 |||||||||||| |||||||||||||||||||||||||||| |||||||| ||| | ||| Sbjct 723 GATATGAGGCTTTGGGAAGGGGCTGCTCGACCCACTCTGCCCAGTGCCCAAATG-CACAG 781 Query 934 CCACTTGGGAGCTACACTGCCTATAGGGCAGCATGCTGCAGGAGACCATGAAGTCCGTAA 993 |||||||||||||||||||| ||||||||||||| | |||||||||||||||||||||| Sbjct 782 TCACTTGGGAGCTACACTGCCAATAGGGCAGCATGTTACAGGAGACCATGAAGTCCGTAA 841 Query 994 ACAGATGTTGCCTCCGCCGCCTTGCCCAGGCAGAGAACTCTTCGATGACCCCTCCTATGT 1053 ||||||| |||| || || || ||||||||||||||| |||||||||| || | |||||| Sbjct 842 ACAGATGCTGCCCCCACCACCGTGCCCAGGCAGAGAATTCTTCGATGATCCTTTCTATGT 901 Query 1054 CAACATCCAGAATCTAGACAAGGCCCGGCAGGCTGGGGGTGGGGCTGGGCCCCCAAATCC 1113 |||||| ||||||||||||||||||||||| ||||| |||||||| || |||||||||| Sbjct 902 CAACATACAGAATCTAGACAAGGCCCGGCAAGCTGGTGGTGGGGCCGGATCCCCAAATCC 961 Query 1114 TTCTCTTAATGGCAGTGCACCCCGAGACCTTTTTGACATGAAGCCCTTTGAAGATGCACT 1173 |||| ||||||||||||||||||||||||| |||||||||||||||||||||||| |||| Sbjct 962 TTCTATTAATGGCAGTGCACCCCGAGACCTCTTTGACATGAAGCCCTTTGAAGATACACT 1021 Query 1174 TCGGGTGCCACCCCCACCGCAGTCCATGTCCATGGCTGAGCAGCTGCAAGGGGAGCCCTG 1233 || ||||| || | || |||||||||||||||||||||||||| ||||||||| |||| Sbjct 1022 CCGTGTGCCGCCAGCTCCCCAGTCCATGTCCATGGCTGAGCAGCTCCAAGGGGAGTCCTG 1081 Query 1234 GTTCCACGGGAAGCTGAGCCGG-AGGGAGGCCGAGGCGCTGCTGCAGCTCAATGGTGACT 1292 ||| || ||||| || |||||| ||| || | || ||||||||||||||||| ||||||| Sbjct 1082 GTTTCATGGGAAACTCAGCCGGCAGG-AGTCTGAAGCGCTGCTGCAGCTCAACGGTGACT 1140 Query 1293 TCTTGGTGCGAGAGAGCACGACCACGCCTGGCCAGTATGTGCTCACTGGCCTGCAGAGTG 1352 |||||||||||||||| || ||||| ||||||||||| |||||||||||||||||||| | Sbjct 1141 TCTTGGTGCGAGAGAGTACAACCACACCTGGCCAGTACGTGCTCACTGGCCTGCAGAGGG 1200 Query 1353 GGCAGCCCAAGCACTTGCTGCTGGTGGACCCTGAAGGTGTGGTTCGGACAAAGGATCACC 1412 ||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||| Sbjct 1201 GGCAGCCCAAGCACTTGCTTCTGGTGGACCCTGAAGGTGTGGTTCAGACAAAGGATCACC 1260 Query 1413 GCTTTGAGAGTGTCAGTCACCTGATCAGCTACCACATGGACAATCACTTGCCCATCATCT 1472 ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| Sbjct 1261 GCTTTGAGAGTGTCAGTCACCTGATCAGCTACCACATGGACAATCACTTACCCATCATCT 1320 Query 1473 CTGCGGGCAGCGAACTGTGCCTACAGCAACCCGTGGATCGGAAAGTGTGA 1522 |||| |||||||| ||| | ||||||||||| |||||| |||||||||| Sbjct 1321 CTGCAGGCAGCGAGCTGCGTCTACAGCAACCTTTGGATCTGAAAGTGTGA 1370 Score = 154 bits (83), Expect = 2e-33 Identities = 95/101 (94%), Gaps = 0/101 (0%) Strand=Plus/Plus Query 16 GGGGTGAAAGTTGGGGCGGTGACTTAAGCAGACAGTTGCGTGATCCGGAACCAGATCGGC 75 ||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||| Sbjct 32 GGGGTGAAAGTTGGGGCGGTGACTTAAGCAGACAGTTGCATGACCCGGAACCAGATCGGC 91 Query 76 CCGCGGTGCGGTGCGGAGACTCCATGAGACCCTGGACATGA 116 |||||||| | |||||||| |||||||||||||| |||||| Sbjct 92 CCGCGGTGTGATGCGGAGATTCCATGAGACCCTGTACATGA 132 >ref|XM_860039.1| UniGene infoGene info PREDICTED: Canis familiaris similar to src homology 2 domain-containing transforming protein C, transcript variant 2 (LOC490439), mRNA Length=3013 Score = 1755 bits (950), Expect = 0.0 Identities = 1349/1540 (87%), Gaps = 34/1540 (2%) Strand=Plus/Plus Query 16 GGGGTGAAAGTTGGGGCGGTGACTTAAGCAGACAGTTGCGTGATCCGGAACCAGATCG-G 74 |||| ||||||||| ||| ||| |||| || |||| |||||||||||||||| |||| | Sbjct 81 GGGGAGAAAGTTGGAACGGCGACCTAAGGAGGCAGTGGCGTGATCCGGAACCAAATCGAG 140 Query 75 CCCGCGGTGCGGTGCGGAGACTCCATGAGACCCTGGACATGAACAAGCTGAGTGGAGGCG 134 |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| | Sbjct 141 -CCGCGGTGCGGTGCGGAGACTCCATGAGGCCCTGGACATGAACAAGCTGAGTGGAGGAG 199 Query 135 GCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCTGGGGGGCGAGGAGTGGACCAGACACG 194 ||||||||||||| ||||| ||||||||||||||||||||||||||||||||| | |||| Sbjct 200 GCGGGCGCAGGACGCGGGTGGAAGGGGGCCAGCTGGGGGGCGAGGAGTGGACCCGCCACG 259 Query 195 GGAGCTTTGTCAATAAGCCCACACGAGGCTGGCTGCATCCCAACGACAAAGTCATGGGAC 254 ||||||| ||||||||||||||||| |||||||| ||||||||||||||||||||||||| Sbjct 260 GGAGCTTCGTCAATAAGCCCACACGGGGCTGGCTACATCCCAACGACAAAGTCATGGGAC 319 Query 255 CTGGGGTTTCCTACTTGGTTCGGTACATGGGCTGTGTGGAGGTCTTACAGTCAATGCGAG 314 |||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| | Sbjct 320 CTGGGGTTTCCTACTTGGTTCGGTACATGGGCTGTGTGGAGGTCCTGCAGTCAATGCGTG 379 Query 315 CCCTT-GACTTCAATACCCGGACTCAGGTCACCAGGGAGGCCATCAGTTTGGTGTGTGAA 373 |||| |||||||| ||||| || || ||||||||||||||||||||| |||||||||| Sbjct 380 -CCTTGGACTTCAACACCCGCACCCAAGTCACCAGGGAGGCCATCAGTCTGGTGTGTGAG 438 Query 374 GCTGTGCCTGGTGCCAAAGGGGCGACAAGGAGGAGAAAGCCTTGTAGCCGCCCACTCAGC 433 |||||||| |||||||| ||||| ||||| ||||||||||| ||||||||||||||||| Sbjct 439 GCTGTGCCCGGTGCCAAGGGGGCTACAAGAAGGAGAAAGCCCTGTAGCCGCCCACTCAG- 497 Query 434 T-CCATCCTGGGGAGGAGTAACCTGAAGTTTGCTGGAATGCCAATCACTCTCACTGTGTC 492 | ||||||||||||||||||| ||||| ||||| |||||||||||||||||||| || || Sbjct 498 TGCCATCCTGGGGAGGAGTAATCTGAAATTTGCGGGAATGCCAATCACTCTCACCGTCTC 557 Query 493 TACCAGCAGCCTTAACCTCATGGCAGCCGACTGCAAACAGATCATTGCCAACCATCACAT 552 ||||||||||| ||||| ||||| || ||||||||||||||||| |||||||| ||||| Sbjct 558 CACCAGCAGCCTCAACCTTATGGCCGCAGACTGCAAACAGATCATCGCCAACCACCACAT 617 Query 553 GCAATCTATCT-CTTTCGCGTCCGGTGGGGATCCGGACACAGCTGAGTATGTTGCCTATG 611 ||| ||||||| |||| |||||||||||||| ||||||||||||||||| || ||||||| Sbjct 618 GCAGTCTATCTCCTTT-GCGTCCGGTGGGGACCCGGACACAGCTGAGTACGTCGCCTATG 676 Query 612 TTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCATATCCTGGAGTGTCCTGAAGGGCTTG 671 ||||||||||||| ||||||||||||||||| ||||||||||| ||||| |||||||||| Sbjct 677 TTGCCAAAGACCCGGTGAATCAGAGAGCCTGTCATATCCTGGAATGTCCCGAAGGGCTTG 736 Query 672 CTCAGGATGTCATCAGCACCATCGGGCAGGCCTTTGAGTTGCGCTTCAAACAGTATCTCA 731 ||||||||||||||||||||||||| |||||||| ||||||||||||||||| || |||| Sbjct 737 CTCAGGATGTCATCAGCACCATCGGCCAGGCCTTCGAGTTGCGCTTCAAACAATACCTCA 796 Query 732 GGAATCCACCGAAGCTGGTCACCCCCCATGACAGGATGGCTGGCTTTGATGGCTCAGCTT 791 |||| || || |||||||||||||| ||||||||||||||||| ||||| |||||||||| Sbjct 797 GGAACCCGCCCAAGCTGGTCACCCCTCATGACAGGATGGCTGGTTTTGACGGCTCAGCTT 856 Query 792 GGGATGAGGAGGAAGAAGAGCCCCCTGACCATCAGTACTACAATGACTTTCCAGGGAAGG 851 ||||||||||||| |||||||| |||||||| |||||||| |||||||| || ||||||| Sbjct 857 GGGATGAGGAGGAGGAAGAGCCACCTGACCACCAGTACTATAATGACTTCCCGGGGAAGG 916 Query 852 AACCCCCTCTTGGTGGG-GTGGTAGATATGAGGCTTCGGG-A--A---------GGGGCT 898 | ||||||||||| ||| ||||| || ||||||||||||| | | |||||| Sbjct 917 AGCCCCCTCTTGG-GGGAGTGGTGGACATGAGGCTTCGGGAAGCAGCCCCCCTGGGGGCT 975 Query 899 GCTCGACCCACTCTGCC-TA-G-TGCCCAGATGTCCAGCCACTTGGGAGCTACACTGCCT 955 | ||| ||||| | || | | || ||||| |||||||| ||||||| || |||||| Sbjct 976 GTTCGGCCCAC-C--CCACACGTTGTCCAGACCCCCAGCCACCTGGGAGCAACGCTGCCT 1032 Query 956 ATAGGGCAGCATGCTGCAGGAGA-CCATGAAGTCCGTAAACAGATGTTGCCTCCGCCGCC 1014 | ||||||| || || ||||| ||| ||| | || ||||||||| ||||| || || Sbjct 1033 GTGGGGCAGCCTGTTGGGGGAGACCCA-GAAATTCGCAAACAGATGCCACCTCCACCACC 1091 Query 1015 TTGCCCAGGCAGAGAACTCTTCGATGACCCCTCCTATGTCAACATCCAGAATCTAGACAA 1074 |||||||| | ||| ||||| ||||| || ||||| ||||| ||||||| ||||||| Sbjct 1092 CTGCCCAGGTAAAGAGCTCTTTGATGATCCATCCTACGTCAATGTCCAGAACCTAGACAG 1151 Query 1075 GGCCCGGCAGGCTGGGGGTGGGGCTGGGCCCCCAAATCCTTCTC-TTAATGGCAGTGCAC 1133 ||||||||| || |||||||||||||||||||| |||||| | | | |||||||| | | Sbjct 1152 GGCCCGGCAAGCAGGGGGTGGGGCTGGGCCCCCCAATCCTGC-CATCAATGGCAGCGTGC 1210 Query 1134 CCCGAGACCTTTTTGACATGAAGCCCTTTGAAGATGCACTTCGGGTGCCACCCCCACCGC 1193 ||||||| || ||||| ||||||||||| |||||||| ||||||||||| || || || | Sbjct 1211 CCCGAGATCTCTTTGATATGAAGCCCTTCGAAGATGCGCTTCGGGTGCCTCCACCTCCCC 1270 Query 1194 AGTCCATGTCCATGGCTGAGCAGCTGCAAGGGGAGCCCTGGTTCCACGGGAAGCTGAGCC 1253 || | || |||||||||||||||| | |||||||||||||||||| ||||||||||||| Sbjct 1271 AGGCGGTGGCCATGGCTGAGCAGCTCCGAGGGGAGCCCTGGTTCCATGGGAAGCTGAGCC 1330 Query 1254 GGAGGGAGGCCGAGGCGCTGCTGCAGCTCAATGGTGACTTCTTGGTGCGAGAGAGCACGA 1313 || ||||||||||||| ||||||||||||||||| |||||| ||||||| |||||||||| Sbjct 1331 GGCGGGAGGCCGAGGCCCTGCTGCAGCTCAATGGGGACTTCCTGGTGCGGGAGAGCACGA 1390 Query 1314 CCACGCCTGGCCAGTATGTGCTCACTGGCCTGCAGAGTGGGCAGCCCAAGCACTTGCTGC 1373 |||| || |||||||| |||||||||||| ||||||||||||||||||||||| |||||| Sbjct 1391 CCACACCCGGCCAGTACGTGCTCACTGGCTTGCAGAGTGGGCAGCCCAAGCACCTGCTGC 1450 Query 1374 TGGTGGACCCTGAAGGTGTGGTTCGGACAAAGGATCACCGCTTTGAGAGTGTCAGTCACC 1433 |||||||||| || ||||||||||| ||||||||||||||||||||||||||||| |||| Sbjct 1451 TGGTGGACCCGGAGGGTGTGGTTCGAACAAAGGATCACCGCTTTGAGAGTGTCAGCCACC 1510 Query 1434 TGATCAGCTACCACATGGACAATCACTTGCCCATCATCTCTGCGGGCAGCGAACTGTGCC 1493 | |||||||||||| |||||||||||||||| ||||||||||||||||| ||||| || | Sbjct 1511 TCATCAGCTACCACGTGGACAATCACTTGCCTATCATCTCTGCGGGCAGTGAACTCTGTC 1570 Query 1494 TACAGCAACCCGTGGATCGGAAAG-TGTGATCCTTCTCAG 1532 | || || || ||||| ||||| | |||||||| |||||| Sbjct 1571 TCCAACAGCCTGTGGAGCGGAA-GCTGTGATCCATCTCAG 1609 >ref|XM_547561.2| UniGene infoGene info PREDICTED: Canis familiaris similar to src homology 2 domain-containing transforming protein C, transcript variant 1 (LOC490439), mRNA Length=3262 Score = 1650 bits (893), Expect = 0.0 Identities = 1267/1446 (87%), Gaps = 32/1446 (2%) Strand=Plus/Plus Query 109 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCT 168 |||||||||||||||||||||||| |||||||||||||| ||||| |||||||||||||| Sbjct 423 GGACATGAACAAGCTGAGTGGAGGAGGCGGGCGCAGGACGCGGGTGGAAGGGGGCCAGCT 482 Query 169 GGGGGGCGAGGAGTGGACCAGACACGGGAGCTTTGTCAATAAGCCCACACGAGGCTGGCT 228 ||||||||||||||||||| | ||||||||||| ||||||||||||||||| |||||||| Sbjct 483 GGGGGGCGAGGAGTGGACCCGCCACGGGAGCTTCGTCAATAAGCCCACACGGGGCTGGCT 542 Query 229 GCATCCCAACGACAAAGTCATGGGACCTGGGGTTTCCTACTTGGTTCGGTACATGGGCTG 288 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 543 ACATCCCAACGACAAAGTCATGGGACCTGGGGTTTCCTACTTGGTTCGGTACATGGGCTG 602 Query 289 TGTGGAGGTCTTACAGTCAATGCGAGCCCTT-GACTTCAATACCCGGACTCAGGTCACCA 347 |||||||||| | ||||||||||| | |||| |||||||| ||||| || || ||||||| Sbjct 603 TGTGGAGGTCCTGCAGTCAATGCGTG-CCTTGGACTTCAACACCCGCACCCAAGTCACCA 661 Query 348 GGGAGGCCATCAGTTTGGTGTGTGAAGCTGTGCCTGGTGCCAAAGGGGCGACAAGGAGGA 407 |||||||||||||| |||||||||| |||||||| |||||||| ||||| ||||| |||| Sbjct 662 GGGAGGCCATCAGTCTGGTGTGTGAGGCTGTGCCCGGTGCCAAGGGGGCTACAAGAAGGA 721 Query 408 GAAAGCCTTGTAGCCGCCCACTCAGCT-CCATCCTGGGGAGGAGTAACCTGAAGTTTGCT 466 ||||||| ||||||||||||||||| | ||||||||||||||||||| ||||| ||||| Sbjct 722 GAAAGCCCTGTAGCCGCCCACTCAG-TGCCATCCTGGGGAGGAGTAATCTGAAATTTGCG 780 Query 467 GGAATGCCAATCACTCTCACTGTGTCTACCAGCAGCCTTAACCTCATGGCAGCCGACTGC 526 |||||||||||||||||||| || || ||||||||||| ||||| ||||| || |||||| Sbjct 781 GGAATGCCAATCACTCTCACCGTCTCCACCAGCAGCCTCAACCTTATGGCCGCAGACTGC 840 Query 527 AAACAGATCATTGCCAACCATCACATGCAATCTATCT-CTTTCGCGTCCGGTGGGGATCC 585 ||||||||||| |||||||| |||||||| ||||||| |||| |||||||||||||| || Sbjct 841 AAACAGATCATCGCCAACCACCACATGCAGTCTATCTCCTTT-GCGTCCGGTGGGGACCC 899 Query 586 GGACACAGCTGAGTATGTTGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCA 645 ||||||||||||||| || |||||||||||||||||||| ||||||||||||||||| || Sbjct 900 GGACACAGCTGAGTACGTCGCCTATGTTGCCAAAGACCCGGTGAATCAGAGAGCCTGTCA 959 Query 646 TATCCTGGAGTGTCCTGAAGGGCTTGCTCAGGATGTCATCAGCACCATCGGGCAGGCCTT 705 ||||||||| ||||| ||||||||||||||||||||||||||||||||||| |||||||| Sbjct 960 TATCCTGGAATGTCCCGAAGGGCTTGCTCAGGATGTCATCAGCACCATCGGCCAGGCCTT 1019 Query 706 TGAGTTGCGCTTCAAACAGTATCTCAGGAATCCACCGAAGCTGGTCACCCCCCATGACAG 765 ||||||||||||||||| || |||||||| || || |||||||||||||| |||||||| Sbjct 1020 CGAGTTGCGCTTCAAACAATACCTCAGGAACCCGCCCAAGCTGGTCACCCCTCATGACAG 1079 Query 766 GATGGCTGGCTTTGATGGCTCAGCTTGGGATGAGGAGGAAGAAGAGCCCCCTGACCATCA 825 ||||||||| ||||| ||||||||||||||||||||||| |||||||| |||||||| || Sbjct 1080 GATGGCTGGTTTTGACGGCTCAGCTTGGGATGAGGAGGAGGAAGAGCCACCTGACCACCA 1139 Query 826 GTACTACAATGACTTTCCAGGGAAGGAACCCCCTCTTGGTGGG-GTGGTAGATATGAGGC 884 |||||| |||||||| || |||||||| ||||||||||| ||| ||||| || ||||||| Sbjct 1140 GTACTATAATGACTTCCCGGGGAAGGAGCCCCCTCTTGG-GGGAGTGGTGGACATGAGGC 1198 Query 885 TTCGGG-A--A---------GGGGCTGCTCGACCCACTCTGCC-TA-G-TGCCCAGATGT 929 |||||| | | ||||||| ||| ||||| | || | | || ||||| Sbjct 1199 TTCGGGAAGCAGCCCCCCTGGGGGCTGTTCGGCCCAC-C--CCACACGTTGTCCAGACCC 1255 Query 930 CCAGCCACTTGGGAGCTACACTGCCTATAGGGCAGCATGCTGCAGGAGA-CCATGAAGTC 988 |||||||| ||||||| || |||||| | ||||||| || || ||||| ||| ||| | Sbjct 1256 CCAGCCACCTGGGAGCAACGCTGCCTGTGGGGCAGCCTGTTGGGGGAGACCCA-GAAATT 1314 Query 989 CGTAAACAGATGTTGCCTCCGCCGCCTTGCCCAGGCAGAGAACTCTTCGATGACCCCTCC 1048 || ||||||||| ||||| || || |||||||| | ||| ||||| ||||| || ||| Sbjct 1315 CGCAAACAGATGCCACCTCCACCACCCTGCCCAGGTAAAGAGCTCTTTGATGATCCATCC 1374 Query 1049 TATGTCAACATCCAGAATCTAGACAAGGCCCGGCAGGCTGGGGGTGGGGCTGGGCCCCCA 1108 || ||||| ||||||| ||||||| ||||||||| || |||||||||||||||||||| Sbjct 1375 TACGTCAATGTCCAGAACCTAGACAGGGCCCGGCAAGCAGGGGGTGGGGCTGGGCCCCCC 1434 Query 1109 AATCCTTCTC-TTAATGGCAGTGCACCCCGAGACCTTTTTGACATGAAGCCCTTTGAAGA 1167 |||||| | | | |||||||| | |||||||| || ||||| ||||||||||| ||||| Sbjct 1435 AATCCTGC-CATCAATGGCAGCGTGCCCCGAGATCTCTTTGATATGAAGCCCTTCGAAGA 1493 Query 1168 TGCACTTCGGGTGCCACCCCCACCGCAGTCCATGTCCATGGCTGAGCAGCTGCAAGGGGA 1227 ||| ||||||||||| || || || ||| | || |||||||||||||||| | |||||| Sbjct 1494 TGCGCTTCGGGTGCCTCCACCTCCCCAGGCGGTGGCCATGGCTGAGCAGCTCCGAGGGGA 1553 Query 1228 GCCCTGGTTCCACGGGAAGCTGAGCCGGAGGGAGGCCGAGGCGCTGCTGCAGCTCAATGG 1287 |||||||||||| ||||||||||||||| ||||||||||||| ||||||||||||||||| Sbjct 1554 GCCCTGGTTCCATGGGAAGCTGAGCCGGCGGGAGGCCGAGGCCCTGCTGCAGCTCAATGG 1613 Query 1288 TGACTTCTTGGTGCGAGAGAGCACGACCACGCCTGGCCAGTATGTGCTCACTGGCCTGCA 1347 |||||| ||||||| |||||||||||||| || |||||||| |||||||||||| |||| Sbjct 1614 GGACTTCCTGGTGCGGGAGAGCACGACCACACCCGGCCAGTACGTGCTCACTGGCTTGCA 1673 Query 1348 GAGTGGGCAGCCCAAGCACTTGCTGCTGGTGGACCCTGAAGGTGTGGTTCGGACAAAGGA 1407 ||||||||||||||||||| |||||||||||||||| || ||||||||||| |||||||| Sbjct 1674 GAGTGGGCAGCCCAAGCACCTGCTGCTGGTGGACCCGGAGGGTGTGGTTCGAACAAAGGA 1733 Query 1408 TCACCGCTTTGAGAGTGTCAGTCACCTGATCAGCTACCACATGGACAATCACTTGCCCAT 1467 ||||||||||||||||||||| ||||| |||||||||||| |||||||||||||||| || Sbjct 1734 TCACCGCTTTGAGAGTGTCAGCCACCTCATCAGCTACCACGTGGACAATCACTTGCCTAT 1793 Query 1468 CATCTCTGCGGGCAGCGAACTGTGCCTACAGCAACCCGTGGATCGGAAAG-TGTGATCCT 1526 ||||||||||||||| ||||| || || || || || ||||| ||||| | |||||||| Sbjct 1794 CATCTCTGCGGGCAGTGAACTCTGTCTCCAACAGCCTGTGGAGCGGAA-GCTGTGATCCA 1852 Query 1527 TCTCAG 1532 |||||| Sbjct 1853 TCTCAG 1858 >emb|AL034408.2| GeoDownload subject sequence spanning the HSP Human DNA sequence from clone RP4-710L4 on chromosome Xq11.2-12, complete sequence Length=129849 Score = 1519 bits (822), Expect = 0.0 Identities = 1516/1840 (82%), Gaps = 92/1840 (5%) Strand=Plus/Plus Query 109 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCT 168 |||||||||||||||||||||||| || ||| ||||||||| ||| |||||||||||||| Sbjct 113808 GGACATGAACAAGCTGAGTGGAGGTGGTGGGTGCAGGACTCAGGTGGAAGGGGGCCAGCT 113867 Query 169 GGGGGGCGAGGAGTGGACCAGACACGGGAGCTTTGTCAATAAGCCCACACGAGGCTGGCT 228 |||||| |||||||||||| | || |||||||||||||||||||||| | |||| ||| Sbjct 113868 GGGGGGTGAGGAGTGGACCCGCCATGGGAGCTTTGTCAATAAGCCCATGTGGGGCTAGCT 113927 Query 229 GCATCCCAACGACAAAGTCATGGGACCTGGGGTTTCCTACTTGGTTCGGTACATGGGCTG 288 ||||||||| |||||||||| | ||||||||||||||||||||||| ||||||||||||| Sbjct 113928 GCATCCCAATGACAAAGTCACGAGACCTGGGGTTTCCTACTTGGTTTGGTACATGGGCTG 113987 Query 289 TGTGGAGGTCTTACAGTCAATGCGAGCCCTTGACTTCAATACCCGGACTCAGGTCACCAG 348 |||||||||| | ||||||||| | ||||| |||||||| ||| |||||||||||||||| Sbjct 113988 TGTGGAGGTCCTGCAGTCAATGAGTGCCCTGGACTTCAACACCTGGACTCAGGTCACCAG 114047 Query 349 GGAGGCCATCAGTTTGGTGTGTGAAGCTGTGCCTGGTGCCAAAGGGGCGACAAGGAGGAG 408 ||||||||||||||| |||||||| |||||||| |||||||| |||| |||||||||||| Sbjct 114048 GGAGGCCATCAGTTTTGTGTGTGAGGCTGTGCCAGGTGCCAAGGGGGTGACAAGGAGGAG 114107 Query 409 AAAGCCTTGTAGCCGCCCACTCAGCTCCATCCTGGGGAGGAGTAACCTGAAGTTTGCTGG 468 |||||| |||| || ||||||||||| ||| |||| |||||||||||||| ||||||| Sbjct 114108 AAAGCCCTGTAACCATCCACTCAGCTCTATCTTGGGAAGGAGTAACCTGAAATTTGCTGC 114167 Query 469 AATGCCAATCACTCTCACTGTGTCTACCAGCAGCCTTAACCTCATGGCAGCCGACTGCAA 528 |||| ||||||||||||| | || ||||||||||| ||| |||||| || |||||||| Sbjct 114168 AATGACAATCACTCTCACCATCTCCACCAGCAGCCTCAACGTCATGGTTGCAGACTGCAA 114227 Query 529 ACAGATCATTGCCAACCATCACATGCAATCTATCTCT-TTCGCGTCCGGTGGGGATCCGG 587 |||||| || | ||||| || |||||||||||||| || || ||| |||||||||||| Sbjct 114228 ACAGATTATCACTAACCACCATATGCAATCTATCTCACTT-GCATCCAGTGGGGATCCGG 114286 Query 588 ACACAGCTGAGTATGTTGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCATA 647 ||||||| ||||||| ||| | ||||||||||||||||||| ||||| ||| ||||| | Sbjct 114287 ACACAGCCAAGTATGTCGCCAACGTTGCCAAAGACCCTGTGAGTCAGAAAGCATGCCACA 114346 Query 648 TCCTGGAGTGTCCTGAAGGGCTTGCTCAGGATGTCATCAGCACCATCGGGC-AGGCCTTT 706 | ||||||||||||||||||||||||||||||||||||||||||| | ||| ||||||| Sbjct 114347 TTCTGGAGTGTCCTGAAGGGCTTGCTCAGGATGTCATCAGCACCA-CTGGCCAGGCCTTC 114405 Query 707 GAGTTGCGCTTCAAACAGTATCTCAGGAATCCACCGAAGCTGGTCACCCCCCATGACAGG 766 |||||| ||| ||||| || ||||| || ||||| || ||||||||||||||||||||| Sbjct 114406 AAGTTGCACTTTAAACAATACCTCAGAAAACCACCCAAACTGGTCACCCCCCATGACAGG 114465 Query 767 ATGGCTGGCTTTGATGGCTCAGCTTGGGATGAGGAGGAAGAAGAGCCCCCTGACCATCAG 826 ||| ||||||||||||||| |||||||||||||||||| |||||||| |||| ||||||| Sbjct 114466 ATGACTGGCTTTGATGGCTTAGCTTGGGATGAGGAGGAGGAAGAGCCGCCTGGCCATCAG 114525 Query 827 TACTACAATGACTTTCCAGGGAAGGAACCCCCTCTT-GGTGGGGTGGTAGATATGAGGCT 885 |||| |||||||| || ||||||||| |||||||| || | ||||| | |||||||| Sbjct 114526 CACTATAATGACTT-CCTGGGAAGGAATCCCCTCTTTGGCATG-TGGTATACATGAGGCT 114583 Query 886 TCGGGAAGG-G--------G---CTGCTCGACCCACTCTGCCTAGTGCCCAGATGTCCAG 933 ||||||||| | | ||||||||||||||| || |||||||||| |||| Sbjct 114584 TCGGGAAGGAGCCACTCCAGGGGCTGCTCGACCCACTCCACCCAGTGCCCAGACCCCCAG 114643 Query 934 CCACTTGGGAGCTACACTGCCTATAGGGCAG-CATGCTGCAGGAGA-CCATGAAGTCCGT 991 |||||||||| ||||||||||| |||| ||| | || || ||||| ||| ||||| | Sbjct 114644 CCACTTGGGATCTACACTGCCTGTAGGACAGTC-TGTTGGGGGAGATCCA-GAAGTTTGC 114701 Query 992 AAACAGATGTTGCCTCCGCCGCCTTGCCCAGGCAGAGAACTCTTCGATGACCCCTCCTAT 1051 ||| ||||| ||||| || || || ||||||||||| ||||| ||||| |||||| || Sbjct 114702 AAATAGATGCCACCTCCACCACCCTGTCCAGGCAGAGAGCTCTTTGATGATCCCTCCAAT 114761 Query 1052 GTCAACATCCAGAATCTAGACAAGGCCCGGCAGGCTGGGGGTGGGGCTGGG-CCCCCAAA 1110 |||||| | ||||| ||||||||||||||||| || |||||||| |||||| ||||||| Sbjct 114762 GTCAACGTGCAGAACCTAGACAAGGCCCGGCAAGCAGGGGGTGGTGCTGGGACCCCCAA- 114820 Query 1111 TCCTTCTCTT-AATGGCAGTGCACCCCGAGACCTTTTTGACATGAAGCCCTTTGAAGATG 1169 |||| | | | |||||||| ||||| ||||||| ||||||||||||||||||||||| Sbjct 114821 TCCTGC-CATCAATGGCAGCACACCCTGAGACCTGTTTGACATGAAGCCCTTTGAAGACA 114879 Query 1170 CACTTCGGGTGCCACCCCCACCGCAGTCCATGTCCATGGCTGAGCAGCTGCA-AGGGGAG 1228 | |||| |||| || | || |||| ||||||||||| ||||||| | |||||| Sbjct 114880 CTCTTCACATGCCTCCTCTTCCCCAGTTGGTGTCCATGGCTAAGCAGCT-CTGAGGGGA- 114937 Query 1229 CCCTGGTTCCACGGGAAGCTGAGCCGG-AGGGAGGCCGAGGCGCTGCTGCAGCTCAATGG 1287 ||||||||||| |||||||||||| | |||| ||| ||||| ||||||||| ||||||| Sbjct 114938 CCCTGGTTCCAAGGGAAGCTGAGCTAGCAGGG-GGCTGAGGCACTGCTGCAGTTCAATGG 114996 Query 1288 TGACTTCTTGGTGCGAG-AGAGCACGACCACGCCTGGCCAGTATGTGCTCACTGGCCTGC 1346 |||||| |||||| || |||||| |||||| |||||||||||||||||||||||| ||| Sbjct 114997 GGACTTCCTGGTGC-AGGAGAGCATGACCACACCTGGCCAGTATGTGCTCACTGGCTTGC 115055 Query 1347 AGAGTGGGCAGCCCAAGCA-CTTGCTGCTGGTGGACCCTGAAGGTGTGGTTCGGACAAAG 1405 |||||||| || ||||||| || ||| |||||||||||||| ||||| |||||||||||| Sbjct 115056 AGAGTGGGGAGTCCAAGCATCT-GCTACTGGTGGACCCTGAGGGTGTAGTTCGGACAAAG 115114 Query 1406 GATCACCGCTTTGAGAGTGTCAGTCACCTGATCAGCTACCACATGGACAATCACTTGCCC 1465 ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| Sbjct 115115 GATCACCGCTTTGAGAGTGTCAGTCACCTCATCAGCTACCACATGGACAATCACTTGCCC 115174 Query 1466 ATCATCTCTGCGGGCAGCGAACTGTGCCTACAGCAACCCGTGGATCGGAAAGTGTGATCC 1525 |||| |||||| ||||| ||| |||| ||||||||||| ||||| | |||| ||||||| Sbjct 115175 ATCACCTCTGCTGGCAGTGAATTGTGTCTACAGCAACCTGTGGAGCAGAAACTGTGATC- 115233 Query 1526 TTCTC-AGC--T-TCT-CCA-ACAGGATGCTCTCCATTTCCGT-CT-CCCGTATTCTCTA 1577 | | | ||| | ||| ||| | || |||| ||||| || | | ||| ||||| ||| Sbjct 115234 TGCCCCAGCGCTCTCTTCCAGA-AG-ATGCCCTCCAACCCCTTTCCACCC-TATTCCCTA 115290 Query 1578 ACT-TGTGGGACCTC--T-G----T-TT-TGTGGGTC-TGGCCTTGGGTGGGAACTGGGA 1626 ||| | || ||||| | | | || |||||| | |||| ||| || || |||||| Sbjct 115291 ACTCTCAGG-ACCTCAGTTGGGAGTGTTCTGTGGG-CATGGCTTTGTGTCAGAGCTGGGA 115348 Query 1627 GCAACGAGGACA-TGGGTTT-AGTGCCCA-CTTGAGAGAGAGAAAAAGAGGGTTTCAGTA 1683 | | | ||||| ||||||| | | ||| || ||| ||||| | | ||| ||| Sbjct 115349 GTAGTGTGGACACTGGGTTTCA-TATCCAGCT-GAGTGAGAG-----G-G--TTTGAGTC 115398 Query 1684 AGGAGCCTGGGGTAGCATCCTGCCTCTGGCCAAAC-TT---CA--C--CAAAGTATTAAT 1735 || | | ||||| || || |||| ||| |||| | || || | |||||||||||| Sbjct 115399 AGAAACTTGGGGGAGAATACTGCTTCTCCCCAAGCATTAATCAATCATCAAAGTATTAAT 115458 Query 1736 GTGCAGAGTGGTCCCTTGTCTGGGCCTTGCCTGTGCCAACCTGATG-CCCTTcccccccA 1794 || |||||||| ||||| ||||||||| |||||||||||||||| ||||||||| | Sbjct 115459 GTACAGAGTGGCCCCTTACCTGGGCCTTTTCTGTGCCAACCTGATGTCCCTTCCCCAAGA 115518 Query 1795 AAGGGTGGGTTCTTATAATGGAAAATGCCCTGTGATGATAGGCCCAGTGGAGCAA-CTGC 1853 | || || || ||| | |||||||||| |||||| |||||||||||||||| || | | Sbjct 115519 A-GG-TGAGTGCTTGTCATGGAAAATGTCCTGTGGTGATAGGCCCAGTGGAACAGTCA-C 115575 Query 1854 CCTT-TGGGGGAAGGGA-AAT-AATTATACCTCTGG-TTT 1889 |||| |||| ||||| || ||| | |||||||| ||| Sbjct 115576 CCTTCTGGGC-AAGGGGGAACGAATCACACCTCTGGGTTT 115614 >ref|NG_001195.1| Gene info Homo sapiens SHC (Src homology 2 domain containing) transforming protein 1 pseudogene 1 (SHC1P1) on chromosome X emb|Y09846.1|HSSHCPS GeoGene info H.sapiens shc pseudogene, p66 isoform Length=3120 Score = 1519 bits (822), Expect = 0.0 Identities = 1484/1793 (82%), Gaps = 87/1793 (4%) Strand=Plus/Plus Query 109 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCT 168 |||||||||||||||||||||||| || ||| ||||||||| ||| |||||||||||||| Sbjct 379 GGACATGAACAAGCTGAGTGGAGGTGGTGGGTGCAGGACTCAGGTGGAAGGGGGCCAGCT 438 Query 169 GGGGGGCGAGGAGTGGACCAGACACGGGAGCTTTGTCAATAAGCCCACACGAGGCTGGCT 228 |||||| |||||||||||| | || |||||||||||||||||||||| | |||| ||| Sbjct 439 GGGGGGTGAGGAGTGGACCCGCCATGGGAGCTTTGTCAATAAGCCCATGTGGGGCTAGCT 498 Query 229 GCATCCCAACGACAAAGTCATGGGACCTGGGGTTTCCTACTTGGTTCGGTACATGGGCTG 288 ||||||||| |||||||||| | ||||||||||||||||||||||| ||||||||||||| Sbjct 499 GCATCCCAATGACAAAGTCACGAGACCTGGGGTTTCCTACTTGGTTTGGTACATGGGCTG 558 Query 289 TGTGGAGGTCTTACAGTCAATGCGAGCCCTTGACTTCAATACCCGGACTCAGGTCACCAG 348 |||||||||| | ||||||||| | ||||| |||||||| ||| |||||||||||||||| Sbjct 559 TGTGGAGGTCCTGCAGTCAATGAGTGCCCTGGACTTCAACACCTGGACTCAGGTCACCAG 618 Query 349 GGAGGCCATCAGTTTGGTGTGTGAAGCTGTGCCTGGTGCCAAAGGGGCGACAAGGAGGAG 408 ||||||||||||||| |||||||| |||||||| |||||||| |||| |||||||||||| Sbjct 619 GGAGGCCATCAGTTTTGTGTGTGAGGCTGTGCCAGGTGCCAAGGGGGTGACAAGGAGGAG 678 Query 409 AAAGCCTTGTAGCCGCCCACTCAGCTCCATCCTGGGGAGGAGTAACCTGAAGTTTGCTGG 468 |||||| |||| || ||||||||||| ||||||||||||||||||||||| ||||||| Sbjct 679 AAAGCCCTGTAACCATCCACTCAGCTCTATCCTGGGGAGGAGTAACCTGAAATTTGCTGC 738 Query 469 AATGCCAATCACTCTCACTGTGTCTACCAGCAGCCTTAACCTCATGGCAGCCGACTGCAA 528 |||| ||||||||||||| | || ||||||||||| ||| |||||| || |||||||| Sbjct 739 AATGACAATCACTCTCACCATCTCCACCAGCAGCCTCAACGTCATGGTTGCAGACTGCAA 798 Query 529 ACAGATCATTGCCAACCATCACATGCAATCTATCTCT-TTCGCGTCCGGTGGGGATCCGG 587 |||||| || ||||||| || |||||||||||||| || || ||| |||||||||||| Sbjct 799 ACAGATTATCACCAACCACCATATGCAATCTATCTCACTT-GCATCCAGTGGGGATCCGG 857 Query 588 ACACAGCTGAGTATGTTGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCATA 647 ||||||| ||||||| ||| | ||||||||||||||||||| ||||| ||| ||||| | Sbjct 858 ACACAGCCAAGTATGTCGCCAACGTTGCCAAAGACCCTGTGAGTCAGAAAGCATGCCACA 917 Query 648 TCCTGGAGTGTCCTGAAGGGCTTGCTCAGGATGTCATCAGCACCATCGGGC-AGGCCTTT 706 | ||||||||||||||||||||||||||||||||||||||||||| | ||| ||||||| Sbjct 918 TTCTGGAGTGTCCTGAAGGGCTTGCTCAGGATGTCATCAGCACCA-CTGGCCAGGCCTTC 976 Query 707 GAGTTGCGCTTCAAACAGTATCTCAGGAATCCACCGAAGCTGGTCACCCCCCATGACAGG 766 |||||| ||| ||||| || ||||| || ||||| || ||||||||||||||||||||| Sbjct 977 AAGTTGCACTTTAAACAATACCTCAGAAAACCACCCAAACTGGTCACCCCCCATGACAGG 1036 Query 767 ATGGCTGGCTTTGATGGCTCAGCTTGGGATGAGGAGGAAGAAGAGCCCCCTGACCATCAG 826 ||| ||||||||||||||| |||||||||||||||||| |||||||| |||| ||||||| Sbjct 1037 ATGACTGGCTTTGATGGCTTAGCTTGGGATGAGGAGGAGGAAGAGCCGCCTGGCCATCAG 1096 Query 827 TACTACAATGACTTTCCAGGG-AAGGAACCCCCTCTT-GGTGGGGTGGTAGATATGAGGC 884 |||| |||||||| || ||| |||||| |||||||| || | ||||| | ||||||| Sbjct 1097 CACTATAATGACTT-CCTGGGGAAGGAATCCCCTCTTTGGCATG-TGGTATACATGAGGC 1154 Query 885 TTCGGGAAGG-G--------G---CTGCTCGACCCACTCTGCCTAGTGCCCAGATGTCCA 932 |||||||||| | | ||||||||||||||| || |||||||||| ||| Sbjct 1155 TTCGGGAAGGAGCCACTCCAGGGGCTGCTCGACCCACTCCACCCAGTGCCCAGACCCCCA 1214 Query 933 GCCACTTGGGAGCTACACTGCCTATAGGGCAG-CATGCTGCAGGAGA-CCATGAAGTCCG 990 ||||||||||| ||||||||||| |||| ||| | || || ||||| ||| ||||| | Sbjct 1215 GCCACTTGGGATCTACACTGCCTGTAGGACAGTC-TGTTGGGGGAGATCCA-GAAGTTTG 1272 Query 991 TAAACAGATGTTGCCTCCGCCGCCTTGCCCAGGCAGAGAACTCTTCGATGACCCCTCCTA 1050 ||| ||||| ||||| || || || ||||||||||| ||||| ||||| |||||| | Sbjct 1273 CAAATAGATGCCACCTCCACCACCCTGTCCAGGCAGAGAGCTCTTTGATGATCCCTCCAA 1332 Query 1051 TGTCAACATCCAGAATCTAGACAAGGCCCGGCAGGCTGGGGGTGGGGCTGGG-CCCCCAA 1109 ||||||| | ||||| ||||||||||||||||| || |||||||| |||||| ||||||| Sbjct 1333 TGTCAACGTGCAGAACCTAGACAAGGCCCGGCAAGCAGGGGGTGGTGCTGGGACCCCCAA 1392 Query 1110 ATCCTTCTCTT-AATGGCAGTGCACCCCGAGACCTTTTTGACATGAAGCCCTTTGAAGAT 1168 |||| | | | |||||||| ||||| ||||||| ||||||||||||||||||||||| Sbjct 1393 -TCCTGC-CATCAATGGCAGCACACCCTGAGACCTGTTTGACATGAAGCCCTTTGAAGAC 1450 Query 1169 GCACTTCGGGTGCCACCCCCACCGCAGTCCATGTCCATGGCTGAGCAGCTGCA-AGGGGA 1227 | |||| |||| || | || |||| ||||||||||| ||||||| | |||||| Sbjct 1451 ACTCTTCACATGCCTCCTCTTCCCCAGTTGGTGTCCATGGCTAAGCAGCT-CTGAGGGGA 1509 Query 1228 GCCCTGGTTCCACGGGAAGCTGAGCCGG-AGGGAGGCCGAGGCGCTGCTGCAGCTCAATG 1286 ||||||||||| |||||||||||| | |||| ||| ||||| ||||||||| |||||| Sbjct 1510 CCCCTGGTTCCAAGGGAAGCTGAGCTAGCAGGG-GGCTGAGGCACTGCTGCAGTTCAATG 1568 Query 1287 GTGACTTCTTGGTGCGAG-AGAGCACGACCACGCCTGGCCAGTATGTGCTCACTGGCCTG 1345 | |||||| |||||| || |||||| |||||| |||||||||||||||||||||||| || Sbjct 1569 GGGACTTCCTGGTGC-AGGAGAGCATGACCACACCTGGCCAGTATGTGCTCACTGGCTTG 1627 Query 1346 CAGAGTGGGCAGCCCAAGCA-CTTGCTGCTGGTGGACCCTGAAGGTGTGGTTCGGACAAA 1404 ||||||||| || ||||||| || ||| |||||||||||||| ||||| ||||||||||| Sbjct 1628 CAGAGTGGGGAGTCCAAGCATCT-GCTACTGGTGGACCCTGAGGGTGTAGTTCGGACAAA 1686 Query 1405 GGATCACCGCTTTGAGAGTGTCAGTCACCTGATCAGCTACCACATGGACAATCACTTGCC 1464 |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| Sbjct 1687 GGATCACCGCTTTGAGAGTGTCAGTCACCTCATCAGCTACCACATGGACAATCACTTGCC 1746 Query 1465 CATCATCTCTGCGGGCAGCGAACTGTGCCTACAGCAACCCGTGGATCGGAAAGTGTGATC 1524 ||||| |||||| ||| ||| |||| ||||||||||| ||||| | |||| ||||||| Sbjct 1747 CATCACCTCTGCTCCCAGTGAATTGTGTCTACAGCAACCTGTGGAGCAGAAACTGTGATC 1806 Query 1525 CTTCTC-AGC--T-TCT-CCA-ACAGGATGCTCTCCATTTCCGT-CT-CCCGTATTCTCT 1576 | | | ||| | ||| ||| | || |||| ||||| ||| | | ||| ||||| || Sbjct 1807 -TGCCCCAGCGCTCTCTTCCAGA-AG-ATGCCCTCCAACTCCTTTCCACCC-TATTCCCT 1862 Query 1577 AACT-TGTGGGACCTC--T-G----T-TT-TGTGGGTC-TGGCCTTGGGTGGGAACTGGG 1625 |||| | || ||| | | | | || |||||| | |||| ||| || || ||||| Sbjct 1863 AACTCTCAGG-ACCCCAGTTGGGAGTGTTCTGTGGG-CATGGCTTTGTGTCAGAGCTGGG 1920 Query 1626 AGCAACGAGGACA-TGGGTTT-AGTGCCCA-CTTGAGAGAGAGAAAAAGAGGGTTTCAGT 1682 || | | ||||| ||||||| | | ||| || ||| ||||| | | ||| ||| Sbjct 1921 AGTAGTGTGGACACTGGGTTTCA-TATCCAGCT-GAGTGAGAG-----G-G--TTTGAGT 1970 Query 1683 AAGGAGCCTGGGGTAGCATCCTGCCTCTGGCCAAAC-TT---CA--C--CAAAGTATTAA 1734 || | | ||||| || || |||| ||| |||| | || || | ||||||||||| Sbjct 1971 CAGAAACTTGGGGGAGAATACTGCTTCTCCCCAAGCATTAATCAATCATCAAAGTATTAA 2030 Query 1735 TGTGCAGAGTGGTCCCTTGTCTGGGCCTTGCCTGTGCCAACCTGATG-CCCTTccccccc 1793 ||| |||||||| ||||| ||||||||| | ||||||||||||||| ||||||||| Sbjct 2031 TGTACAGAGTGGCCCCTTACCTGGGCCTTTC-TGTGCCAACCTGATGTCCCTTCCCCAAG 2089 Query 1794 AAAGGGTGGGTTCTTATAATGGAAAATGCCCTGTGA-TGATAGGCCCAGTGGA 1845 || || || || ||| | ||||||||||||||||| |||||||||||||||| Sbjct 2090 AA-GG-TGAGTGCTTGTCATGGAAAATGCCCTGTGGGTGATAGGCCCAGTGGA 2140 >gb|AC192165.3| Download subject sequence spanning the HSP Pan troglodytes BAC clone CH251-481L4 from chromosome x, complete sequence Length=196978 Score = 1517 bits (821), Expect = 0.0 Identities = 1718/2131 (80%), Gaps = 141/2131 (6%) Strand=Plus/Minus Query 109 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCT 168 |||||||||||||||||||||||| || ||| ||||||||| ||| |||||||||||||| Sbjct 177453 GGACATGAACAAGCTGAGTGGAGGTGGTGGGTGCAGGACTCAGGTGGAAGGGGGCCAGCT 177394 Query 169 GGGGGGCGAGGAGTGGACCAGACACGGGAGCTTTGTCAATAAGCCCACACGAGGCTGGCT 228 |||||| |||||||||||| | | |||||||||||||||||||||| | |||| ||| Sbjct 177393 GGGGGGTGAGGAGTGGACCCGCCGTGGGAGCTTTGTCAATAAGCCCATGTGGGGCTAGCT 177334 Query 229 GCATCCCAACGACAAAGTCATGGGACCTGGGGTTTCCTACTTGGTTCGGTACATGGGCTG 288 ||||||||| |||||||||| | |||||||||||||||||||| || ||||||||||||| Sbjct 177333 GCATCCCAATGACAAAGTCACGAGACCTGGGGTTTCCTACTTGATTTGGTACATGGGCTG 177274 Query 289 TGTGGAGGTCTTACAGTCAATGCGAGCCCTTGACTTCAATACCCGGACTCAGGTCACCAG 348 ||||||| || | ||||||||| | ||||| |||||||| ||| |||||||||||||||| Sbjct 177273 TGTGGAGATCCTGCAGTCAATGAGTGCCCTGGACTTCAACACCTGGACTCAGGTCACCAG 177214 Query 349 GGAGGCCATCAGT-TTGGTGTGTGAAGCTGTGCCTGGTGCCAAAGGGGCGACAAGGAGGA 407 ||||||||||||| || |||||||| |||||||| |||||||| |||| ||||||||||| Sbjct 177213 GGAGGCCATCAGTCTT-GTGTGTGAGGCTGTGCCAGGTGCCAAGGGGGTGACAAGGAGGA 177155 Query 408 GAAAGCCTTGTAGCCGCCCACTCAGCTCCATCCTGGGGAGGAGTAACCTGAAGTTTGCTG 467 ||||||| |||| || ||||||||||| |||||||| |||||||||||||| ||||||| Sbjct 177154 GAAAGCCCTGTAACCATCCACTCAGCTCTATCCTGGGAAGGAGTAACCTGAAATTTGCTG 177095 Query 468 GAATGCCAATCACTCTCACTGTGTCTACCAGCAGCCTTAACCTCATGGCAGCCGACTGCA 527 |||| ||||||||||||| | || ||||||||||| ||| |||||| || ||||||| Sbjct 177094 CAATGACAATCACTCTCACCATCTCCACCAGCAGCCTCAACGTCATGGTTGCAGACTGCA 177035 Query 528 AACAGATCATTGCCAACCATCACATGCAATCTATCTC-TTTCGCGTCCGGTGGGGATCCG 586 ||||||| || | ||||| || |||||||||||||| ||| | ||| |||||||||| Sbjct 177034 AACAGATTATCACTAACCACCATATGCAATCTATCTCATTT-ACATCCAGTGGGGATCCA 176976 Query 587 GACACAGCTGAGTATGTTGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCAT 646 |||||||| ||||||| ||| | ||||||||||||||||||| ||||| ||| ||||| Sbjct 176975 GACACAGCCAAGTATGTCGCCAACGTTGCCAAAGACCCTGTGAGTCAGAAAGCATGCCAC 176916 Query 647 ATCCTGGAGTGTCCTGAAGGGCTTGCTCAGGATGTCATCAGCACCATCGGGCAGGCCTTT 706 || |||||||||||||||||||||||||||||||||||||||||||| || |||||||| Sbjct 176915 ATTCTGGAGTGTCCTGAAGGGCTTGCTCAGGATGTCATCAGCACCATTGGCCAGGCCTTC 176856 Query 707 GAGTTGCGCTTCAAACAGTATCTCAGGAATCCACCGAAGCTGGTCACCCCCCATGACAGG 766 |||||| ||| ||||| || ||||| || ||||| || ||||||||||||||||||||| Sbjct 176855 AAGTTGCACTTTAAACAATACCTCAGAAAACCACCCAAACTGGTCACCCCCCATGACAGG 176796 Query 767 ATGGCTGGCTTTGATGGCTCAGCTTGGGATGAGGAGGAAGAAGAGCCCCCTGACCATCAG 826 ||| |||||||| |||||| |||||||||||||||||| |||||||| |||| ||||||| Sbjct 176795 ATGACTGGCTTTCATGGCTTAGCTTGGGATGAGGAGGAGGAAGAGCCACCTGGCCATCAG 176736 Query 827 TACTACAATGACTTTCCAGGGAAGGAACCCCCTCTT-GGTGGGGTGGTAGATATGAGGCT 885 |||| |||||||| || ||||||||| |||||||| || | ||||| | |||||||| Sbjct 176735 CACTATAATGACTT-CCTGGGAAGGAATCCCCTCTTTGGCATG-TGGTATACATGAGGCT 176678 Query 886 TCGGGAAGG-G--------G---CTGCTCGACCCACTCTGCCTAGTGCCCAGATGTCCAG 933 ||||||||| | | ||||||||||||||| || |||||||||| |||| Sbjct 176677 TCGGGAAGGAGCCACTCCAGGGGCTGCTCGACCCACTCCACCCAGTGCCCAGACCCCCAG 176618 Query 934 CCACTTGGGAGCTACACTGCCTATAGGGCAG-CATGCTGCAGGAGA-CCATGAAGTCCGT 991 |||||||||| ||||||||||| |||| ||| | || || ||||| ||| ||||| | Sbjct 176617 CCACTTGGGATCTACACTGCCTGTAGGACAGTC-TGTTGGGGGAGATCCA-GAAGTTTGC 176560 Query 992 AAACAGATGTTGCCTCCGCCGCCTTGCCCAGGCAGAGAACTCTTCGATGACCCCTCCTAT 1051 ||| ||||| ||||| || || || ||||||||||| ||||| ||||| |||||| || Sbjct 176559 AAATAGATGCCACCTCCACCACCCTGTCCAGGCAGAGAGCTCTTTGATGATCCCTCCAAT 176500 Query 1052 GTCAACATCCAGAATCTAGACAAGGCCCGGCAGGCTGGGGGTGGGGCTGGGC-CCCCAAA 1110 |||||| | ||||| ||||||||||||||||| || |||||||| |||||| |||||| Sbjct 176499 GTCAACGTGCAGAACCTAGACAAGGCCCGGCAAGCAGGGGGTGGTGCTGGGAGCCCCAA- 176441 Query 1111 TCCTTCTCTT-AATGGCAGTGCACCCCGAGACCTTTTTGACATGAAGCCCTTTGAAGATG 1169 |||| | | | |||||||| ||||| ||||||| ||||||||||||||||||||||||| Sbjct 176440 TCCTGC-CATCAATGGCAGCACACCCTGAGACCTGTTTGACATGAAGCCCTTTGAAGATG 176382 Query 1170 CACTTCGGGTGCCACCCCCACCGCAGTCCATGTCCATGGCTGAGCAGCTGCA-AGGGGAG 1228 | |||| |||| || || || |||| ||||||||| | ||||||| | |||||| Sbjct 176381 CTCTTCACATGCCTCCTCCTCCCCAGTTGGTGTCCATGGTTAAGCAGCT-CTGAGGGGA- 176324 Query 1229 CCCTGGTTCCACGGGAAGCTGAGCCGG-AGGGAGGCCGAGGCGCTGCTGCAGCTCAATGG 1287 ||||||||||| ||||||||||| | ||| |||| ||||| |||||||||||||| || Sbjct 176323 CCCTGGTTCCATGGGAAGCTGAGTTAGCAGG-AGGCTGAGGCACTGCTGCAGCTCAACGG 176265 Query 1288 TGACTTCTTGGTGCGAG-AGAGCACGACCACGCCTGGCCAGTATGTGCTCACTGGCCTGC 1346 |||||| |||||| || |||||| |||||| |||||||||||||||||||||||| ||| Sbjct 176264 GGACTTCCTGGTGC-AGGAGAGCATGACCACACCTGGCCAGTATGTGCTCACTGGCTTGC 176206 Query 1347 AGAGTGGGCAGCCCAAGCA-CTTGCTGCTGGTGGACCCTGAAGGTGTGGTTCGGACAAAG 1405 |||||||| || ||||||| || ||| |||||||||||||| ||||| |||||||||||| Sbjct 176205 AGAGTGGGGAGTCCAAGCATCT-GCTACTGGTGGACCCTGAGGGTGTAGTTCGGACAAAG 176147 Query 1406 GATCACCGCTTTGAGAGTGTCAGTCACCTGATCAGCTACCACATGGACAATCACTTGCCC 1465 ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| Sbjct 176146 GATCACCGCTTTGAGAGTGTCAGTCACCTCATCAGCTACCACATGGACAATCACTTGCCC 176087 Query 1466 ATCATCTCTGCGGGCAGCGAACTGTGCCTACAGCAACCCGTGGATCGGAAAGTGTGATCC 1525 |||| |||||| ||||| |||||||| ||||||||||| ||||| | |||| ||||||| Sbjct 176086 ATCACCTCTGCTGGCAGTGAACTGTGTCTACAGCAACCTGTGGAGCAGAAACTGTGATC- 176028 Query 1526 TTCTC-AGC--T-TCT-CCA-ACAGGATGCTCTCCATTTCCGT-CT-CCCGTATTCTCTA 1577 | | | ||| | ||| ||| | || |||| ||||| || | | ||| ||||| ||| Sbjct 176027 TGCCCCAGCGCTCTCTTCCAGA-AG-ATGCCCTCCAACCCCTTTCCACCC-TATTCCCTA 175971 Query 1578 ACT-TGTGGGACCTC--T-G----T-TT-TGTGGGTC-TGGCCTTGGGTGGGAACTGGGA 1626 ||| | || ||||| | | | || |||||| | |||||||| || || ||| || Sbjct 175970 ACTCTCAGG-ACCTCAGTTGGGAGTGTTCTGTGGG-CATGGCCTTGTGTCAGAGCTGAGA 175913 Query 1627 GCAACGAGGACA-TGGGTTT-AGTGCCCA-CTTGAGAGAGAGAAAAAGAGGGTTTCAGTA 1683 | | | ||||| ||||||| | | ||| || ||| ||||| | | ||| ||| Sbjct 175912 GTAGTGTGGACACTGGGTTTCA-TATCCAGCT-GAGTGAGAG-----G-G--TTTGAGTC 175863 Query 1684 AGGAGCCTGGGGTAGCATCCTGCCTCTGGCCAAAC-TT---CA--C--CAAAGTATTAAT 1735 || | | ||||| || || |||| ||| |||| | || || | |||||||||||| Sbjct 175862 AGAAACTTGGGGGAGAATACTGCTTCTCCCCAAGCATTAATCAATCATCAAAGTATTAAT 175803 Query 1736 GTGCAGAGTGGTCCCTTGTCTGGGCCTTGCCTGTGCCAACCTGATGCCC-TTcccccccA 1794 || |||||||| ||||| ||||||||| ||||||||||||||||||| |||||| | Sbjct 175802 GTACAGAGTGGCCCCTTACCTGGGCCTTTTCTGTGCCAACCTGATGCCCCTTCCCCAAGA 175743 Query 1795 AAGGGTGGGTTCTTATAATGGAAAATGCCCTGTGATGATAGGCCCAGTGGAGCAA-CTGC 1853 | || || || ||| | |||||||||| |||||| |||||||||||||||| || | | Sbjct 175742 A-GG-TGAGTGCTTGTCATGGAAAATGTCCTGTGGTGATAGGCCCAGTGGAACAGTCA-C 175686 Query 1854 CCTT-TGGGGGAAGGGA-AAT-AATTATACCTCTGGTTTACTCCTGGGTCTTCAGGGTAC 1910 |||| |||| ||||| || ||| | |||||||| | | |||||||||| Sbjct 175685 CCTTCTGGGC-AAGGGGGAACGAATCACACCTCTGG---------G--T-TTCAGGGTAC 175639 Query 1911 CCCAGATCCCGCAT-AACATATCCCACTCCCTCTGCTTCCCCTTAAACTTTGTGCCTTTG 1969 |||||| ||| | | |||| |||||| ||| || || | |||||||||||||||| Sbjct 175638 CCCAGACCCCTC-TCAACAC-TCCCACCCCCA-TG-TT----T-AAACTTTGTGCCTTTG 175588 Query 1970 ACTATCA-T-AGGTCTGCAGATACTTAATGCA--GAGTTCTCAGGCCCTTCACGTG---T 2022 || ||| | ||||||| ||||| || ||||| ||||| | || |||| | || | Sbjct 175587 ACCATCTCTTAGGTCTGAAGATATTTTATGCAAAGAGTTTTTGGGACCTTGA-GTTCAAT 175529 Query 2023 GGACAGGGGTTACTGCCACCTT---GGCTTCTGGAGCCCTGTC--CTA-TT-C--AGCAC 2073 | |||||| | | | ||||| ||||||||| | |||||| || || | ||||| Sbjct 175528 G-ACAGGGATGCCAAC-ACCTTCTTGGCTTCTGG-GACCTGTCTTCTCCTTGCTCAGCAC 175472 Query 2074 CC-CTTCCTGTGTC--TAGGGAGAATAG-GGACAGGAGTGGCCGCTATCTGCTCTGCCTT 2129 || || || || | | ||||||| || || |||||||||| ||| ||| |||| ||| Sbjct 175471 CCTCT-CCAGTTTGGGTTGGGAGAACAGAGG-CAGGAGTGGCAGCTGTCTCCTCTCCCTG 175414 Query 2130 TCGGATGTGCAGCCCTTAAGAGATTGCCCCA 2160 |||| || | |||||| |||||||||||| Sbjct 175413 G-GGATATGTAACCCTTA-GAGATTGCCCCA 175385 >ref|XR_024057.1| Gene info PREDICTED: Pan troglodytes similar to SHC (Src homology 2 domain containing) transforming protein 1 (LOC473641), mRNA Length=3509 Score = 1517 bits (821), Expect = 0.0 Identities = 1718/2131 (80%), Gaps = 141/2131 (6%) Strand=Plus/Plus Query 109 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCT 168 |||||||||||||||||||||||| || ||| ||||||||| ||| |||||||||||||| Sbjct 547 GGACATGAACAAGCTGAGTGGAGGTGGTGGGTGCAGGACTCAGGTGGAAGGGGGCCAGCT 606 Query 169 GGGGGGCGAGGAGTGGACCAGACACGGGAGCTTTGTCAATAAGCCCACACGAGGCTGGCT 228 |||||| |||||||||||| | | |||||||||||||||||||||| | |||| ||| Sbjct 607 GGGGGGTGAGGAGTGGACCCGCCGTGGGAGCTTTGTCAATAAGCCCATGTGGGGCTAGCT 666 Query 229 GCATCCCAACGACAAAGTCATGGGACCTGGGGTTTCCTACTTGGTTCGGTACATGGGCTG 288 ||||||||| |||||||||| | |||||||||||||||||||| || ||||||||||||| Sbjct 667 GCATCCCAATGACAAAGTCACGAGACCTGGGGTTTCCTACTTGATTTGGTACATGGGCTG 726 Query 289 TGTGGAGGTCTTACAGTCAATGCGAGCCCTTGACTTCAATACCCGGACTCAGGTCACCAG 348 ||||||| || | ||||||||| | ||||| |||||||| ||| |||||||||||||||| Sbjct 727 TGTGGAGATCCTGCAGTCAATGAGTGCCCTGGACTTCAACACCTGGACTCAGGTCACCAG 786 Query 349 GGAGGCCATCAGT-TTGGTGTGTGAAGCTGTGCCTGGTGCCAAAGGGGCGACAAGGAGGA 407 ||||||||||||| ||| ||||||| |||||||| |||||||| |||| ||||||||||| Sbjct 787 GGAGGCCATCAGTCTTG-TGTGTGAGGCTGTGCCAGGTGCCAAGGGGGTGACAAGGAGGA 845 Query 408 GAAAGCCTTGTAGCCGCCCACTCAGCTCCATCCTGGGGAGGAGTAACCTGAAGTTTGCTG 467 ||||||| |||| || ||||||||||| |||||||| |||||||||||||| ||||||| Sbjct 846 GAAAGCCCTGTAACCATCCACTCAGCTCTATCCTGGGAAGGAGTAACCTGAAATTTGCTG 905 Query 468 GAATGCCAATCACTCTCACTGTGTCTACCAGCAGCCTTAACCTCATGGCAGCCGACTGCA 527 |||| ||||||||||||| | || ||||||||||| ||| |||||| || ||||||| Sbjct 906 CAATGACAATCACTCTCACCATCTCCACCAGCAGCCTCAACGTCATGGTTGCAGACTGCA 965 Query 528 AACAGATCATTGCCAACCATCACATGCAATCTATCTC-TTTCGCGTCCGGTGGGGATCCG 586 ||||||| || | ||||| || |||||||||||||| ||| | ||| |||||||||| Sbjct 966 AACAGATTATCACTAACCACCATATGCAATCTATCTCATTTA-CATCCAGTGGGGATCCA 1024 Query 587 GACACAGCTGAGTATGTTGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCAT 646 |||||||| ||||||| ||| | ||||||||||||||||||| ||||| ||| ||||| Sbjct 1025 GACACAGCCAAGTATGTCGCCAACGTTGCCAAAGACCCTGTGAGTCAGAAAGCATGCCAC 1084 Query 647 ATCCTGGAGTGTCCTGAAGGGCTTGCTCAGGATGTCATCAGCACCATCGGGCAGGCCTTT 706 || |||||||||||||||||||||||||||||||||||||||||||| || |||||||| Sbjct 1085 ATTCTGGAGTGTCCTGAAGGGCTTGCTCAGGATGTCATCAGCACCATTGGCCAGGCCTTC 1144 Query 707 GAGTTGCGCTTCAAACAGTATCTCAGGAATCCACCGAAGCTGGTCACCCCCCATGACAGG 766 |||||| ||| ||||| || ||||| || ||||| || ||||||||||||||||||||| Sbjct 1145 AAGTTGCACTTTAAACAATACCTCAGAAAACCACCCAAACTGGTCACCCCCCATGACAGG 1204 Query 767 ATGGCTGGCTTTGATGGCTCAGCTTGGGATGAGGAGGAAGAAGAGCCCCCTGACCATCAG 826 ||| |||||||| |||||| |||||||||||||||||| |||||||| |||| ||||||| Sbjct 1205 ATGACTGGCTTTCATGGCTTAGCTTGGGATGAGGAGGAGGAAGAGCCACCTGGCCATCAG 1264 Query 827 TACTACAATGACTTTCCAGGGAAGGAACCCCCTCTT-GGTGGGGTGGTAGATATGAGGCT 885 |||| |||||||| || ||||||||| |||||||| || | ||||| | |||||||| Sbjct 1265 CACTATAATGACTT-CCTGGGAAGGAATCCCCTCTTTGGCATG-TGGTATACATGAGGCT 1322 Query 886 TCGGGAAGG-G--------G---CTGCTCGACCCACTCTGCCTAGTGCCCAGATGTCCAG 933 ||||||||| | | ||||||||||||||| || |||||||||| |||| Sbjct 1323 TCGGGAAGGAGCCACTCCAGGGGCTGCTCGACCCACTCCACCCAGTGCCCAGACCCCCAG 1382 Query 934 CCACTTGGGAGCTACACTGCCTATAGGGCAG-CATGCTGCAGGAGA-CCATGAAGTCCGT 991 |||||||||| ||||||||||| |||| ||| | || || ||||| ||| ||||| | Sbjct 1383 CCACTTGGGATCTACACTGCCTGTAGGACAGTC-TGTTGGGGGAGATCCA-GAAGTTTGC 1440 Query 992 AAACAGATGTTGCCTCCGCCGCCTTGCCCAGGCAGAGAACTCTTCGATGACCCCTCCTAT 1051 ||| ||||| ||||| || || || ||||||||||| ||||| ||||| |||||| || Sbjct 1441 AAATAGATGCCACCTCCACCACCCTGTCCAGGCAGAGAGCTCTTTGATGATCCCTCCAAT 1500 Query 1052 GTCAACATCCAGAATCTAGACAAGGCCCGGCAGGCTGGGGGTGGGGCTGGGC-CCCCAAA 1110 |||||| | ||||| ||||||||||||||||| || |||||||| |||||| |||||| Sbjct 1501 GTCAACGTGCAGAACCTAGACAAGGCCCGGCAAGCAGGGGGTGGTGCTGGGAGCCCCAA- 1559 Query 1111 TCCTTCTCTT-AATGGCAGTGCACCCCGAGACCTTTTTGACATGAAGCCCTTTGAAGATG 1169 |||| | | | |||||||| ||||| ||||||| ||||||||||||||||||||||||| Sbjct 1560 TCCTGC-CATCAATGGCAGCACACCCTGAGACCTGTTTGACATGAAGCCCTTTGAAGATG 1618 Query 1170 CACTTCGGGTGCCACCCCCACCGCAGTCCATGTCCATGGCTGAGCAGCTGCA-AGGGGAG 1228 | |||| |||| || || || |||| ||||||||| | ||||||| | |||||| Sbjct 1619 CTCTTCACATGCCTCCTCCTCCCCAGTTGGTGTCCATGGTTAAGCAGCT-CTGAGGGGA- 1676 Query 1229 CCCTGGTTCCACGGGAAGCTGAGCCGG-AGGGAGGCCGAGGCGCTGCTGCAGCTCAATGG 1287 ||||||||||| ||||||||||| | ||| |||| ||||| |||||||||||||| || Sbjct 1677 CCCTGGTTCCATGGGAAGCTGAGTTAGCAGG-AGGCTGAGGCACTGCTGCAGCTCAACGG 1735 Query 1288 TGACTTCTTGGTGCGAG-AGAGCACGACCACGCCTGGCCAGTATGTGCTCACTGGCCTGC 1346 |||||| |||||| || |||||| |||||| |||||||||||||||||||||||| ||| Sbjct 1736 GGACTTCCTGGTGC-AGGAGAGCATGACCACACCTGGCCAGTATGTGCTCACTGGCTTGC 1794 Query 1347 AGAGTGGGCAGCCCAAGCA-CTTGCTGCTGGTGGACCCTGAAGGTGTGGTTCGGACAAAG 1405 |||||||| || ||||||| || ||| |||||||||||||| ||||| |||||||||||| Sbjct 1795 AGAGTGGGGAGTCCAAGCATCT-GCTACTGGTGGACCCTGAGGGTGTAGTTCGGACAAAG 1853 Query 1406 GATCACCGCTTTGAGAGTGTCAGTCACCTGATCAGCTACCACATGGACAATCACTTGCCC 1465 ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| Sbjct 1854 GATCACCGCTTTGAGAGTGTCAGTCACCTCATCAGCTACCACATGGACAATCACTTGCCC 1913 Query 1466 ATCATCTCTGCGGGCAGCGAACTGTGCCTACAGCAACCCGTGGATCGGAAAGTGTGATCC 1525 |||| |||||| ||||| |||||||| ||||||||||| ||||| | |||| ||||||| Sbjct 1914 ATCACCTCTGCTGGCAGTGAACTGTGTCTACAGCAACCTGTGGAGCAGAAACTGTGATC- 1972 Query 1526 TTCTC-AGC--T-TCT-CCA-ACAGGATGCTCTCCATTTCCGT-CT-CCCGTATTCTCTA 1577 | | | ||| | ||| ||| | || |||| ||||| || | | ||| ||||| ||| Sbjct 1973 TGCCCCAGCGCTCTCTTCCAGA-AG-ATGCCCTCCAACCCCTTTCCACCC-TATTCCCTA 2029 Query 1578 ACT-TGTGGGACCTC--T-G----T-TT-TGTGGGTC-TGGCCTTGGGTGGGAACTGGGA 1626 ||| | || ||||| | | | || |||||| | |||||||| || || ||| || Sbjct 2030 ACTCTCAGG-ACCTCAGTTGGGAGTGTTCTGTGGG-CATGGCCTTGTGTCAGAGCTGAGA 2087 Query 1627 GCAACGAGGACA-TGGGTTT-AGTGCCCA-CTTGAGAGAGAGAAAAAGAGGGTTTCAGTA 1683 | | | ||||| ||||||| | | ||| || ||| ||||| | | ||| ||| Sbjct 2088 GTAGTGTGGACACTGGGTTTCA-TATCCAGCT-GAGTGAGAG-----G-G--TTTGAGTC 2137 Query 1684 AGGAGCCTGGGGTAGCATCCTGCCTCTGGCCAAAC-TT---CA--C--CAAAGTATTAAT 1735 || | | ||||| || || |||| ||| |||| | || || | |||||||||||| Sbjct 2138 AGAAACTTGGGGGAGAATACTGCTTCTCCCCAAGCATTAATCAATCATCAAAGTATTAAT 2197 Query 1736 GTGCAGAGTGGTCCCTTGTCTGGGCCTTGCCTGTGCCAACCTGATGCCC-TTcccccccA 1794 || |||||||| ||||| ||||||||| ||||||||||||||||||| |||||| | Sbjct 2198 GTACAGAGTGGCCCCTTACCTGGGCCTTTTCTGTGCCAACCTGATGCCCCTTCCCCAAGA 2257 Query 1795 AAGGGTGGGTTCTTATAATGGAAAATGCCCTGTGATGATAGGCCCAGTGGAGCAA-CTGC 1853 | || || || ||| | |||||||||| |||||| |||||||||||||||| || | | Sbjct 2258 A-GG-TGAGTGCTTGTCATGGAAAATGTCCTGTGGTGATAGGCCCAGTGGAACAGTCA-C 2314 Query 1854 CCTT-TGGGGGAAGGGA-AAT-AATTATACCTCTGGTTTACTCCTGGGTCTTCAGGGTAC 1910 |||| |||| ||||| || ||| | |||||||| | | |||||||||| Sbjct 2315 CCTTCTGGGC-AAGGGGGAACGAATCACACCTCTGG---------G--T-TTCAGGGTAC 2361 Query 1911 CCCAGATCCCGCAT-AACATATCCCACTCCCTCTGCTTCCCCTTAAACTTTGTGCCTTTG 1969 |||||| ||| | | |||| |||||| ||| || || | |||||||||||||||| Sbjct 2362 CCCAGACCCCTC-TCAACAC-TCCCACCCCCA-TG-TT----T-AAACTTTGTGCCTTTG 2412 Query 1970 ACTATCA-T-AGGTCTGCAGATACTTAATGCA--GAGTTCTCAGGCCCTTCACGTG---T 2022 || ||| | ||||||| ||||| || ||||| ||||| | || |||| | || | Sbjct 2413 ACCATCTCTTAGGTCTGAAGATATTTTATGCAAAGAGTTTTTGGGACCTTGA-GTTCAAT 2471 Query 2023 GGACAGGGGTTACTGCCACCTT---GGCTTCTGGAGCCCTGTC--CTA-TT-C--AGCAC 2073 | |||||| | | | ||||| ||||||||| | |||||| || || | ||||| Sbjct 2472 G-ACAGGGATGCCAAC-ACCTTCTTGGCTTCTGG-GACCTGTCTTCTCCTTGCTCAGCAC 2528 Query 2074 CC-CTTCCTGTGTC--TAGGGAGAATAG-GGACAGGAGTGGCCGCTATCTGCTCTGCCTT 2129 || || || || | | ||||||| || || |||||||||| ||| ||| |||| ||| Sbjct 2529 CCTCT-CCAGTTTGGGTTGGGAGAACAGAGG-CAGGAGTGGCAGCTGTCTCCTCTCCCTG 2586 Query 2130 TCGGATGTGCAGCCCTTAAGAGATTGCCCCA 2160 |||| || | |||||| |||||||||||| Sbjct 2587 G-GGATATGTAACCCTTA-GAGATTGCCCCA 2615 >dbj|AK130014.1| UniGene infoGene info Homo sapiens cDNA FLJ26504 fis, clone KDN07054, highly similar to SHC transforming protein Length=1755 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 1434 bits (776), Expect = 0.0 Identities = 1248/1465 (85%), Gaps = 75/1465 (5%) Strand=Plus/Plus Query 430 CAGCTCCATCCTGGGGAGGAGTAACCTGAAGTTTGCTGGAATGCCAATCACTCTCACTGT 489 |||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| || Sbjct 202 CAGCTCTATCCTGGGGAGGAGTAACCTGAAATTTGCTGGAATGCCAATCACTCTCACCGT 261 Query 490 GTCTACCAGCAGCCTTAACCTCATGGCAGCCGACTGCAAACAGATCATTGCCAACCATCA 549 || ||||||||||| ||||||||||| || ||||||||||||||||| |||||||| || Sbjct 262 CTCCACCAGCAGCCTCAACCTCATGGCCGCAGACTGCAAACAGATCATCGCCAACCACCA 321 Query 550 CATGCAATCTATCTC-TTTCGCGTCCGGTGGGGATCCGGACACAGCTGAGTATGTTGCCT 608 ||||||||||||||| ||| || ||||| ||||||||||||||||| |||||||| |||| Sbjct 322 CATGCAATCTATCTCATTT-GCATCCGGCGGGGATCCGGACACAGCCGAGTATGTCGCCT 380 Query 609 ATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCATATCCTGGAGTGTCCTGAAGGGC 668 ||||||||||||||||||||||||||||||||||||| || ||||||||||| ||||||| Sbjct 381 ATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCACATTCTGGAGTGTCCCGAAGGGC 440 Query 669 TTGCTCAGGATGTCATCAGCACCATCGGGCAGGCCTTTGAGTTGCGCTTCAAACAGTATC 728 |||| |||||||||||||||||||| || |||||||| ||||||||||||||||| || | Sbjct 441 TTGCCCAGGATGTCATCAGCACCATTGGCCAGGCCTTCGAGTTGCGCTTCAAACAATACC 500 Query 729 TCAGGAATCCACCGAAGCTGGTCACCCCCCATGACAGGATGGCTGGCTTTGATGGCTCAG 788 ||||||| ||||| || ||||||||||| ||||||||||||||||||||||||||||||| Sbjct 501 TCAGGAACCCACCCAAACTGGTCACCCCTCATGACAGGATGGCTGGCTTTGATGGCTCAG 560 Query 789 CTTGGGATGAGGAGGAAGAAGAGCCCCCTGACCATCAGTACTACAATGACTTTCCAGGGA 848 | |||||||||||||| |||||||| ||||||||||||||||| |||||||| || |||| Sbjct 561 CATGGGATGAGGAGGAGGAAGAGCCACCTGACCATCAGTACTATAATGACTTCCCGGGGA 620 Query 849 AGGAACCCCCTCTT-GGTGGGGTGGTAGATATGAGGCTTC--G--GGA--------AGGG 895 |||||||||| ||| || ||||||||||| |||||||||| | ||| |||| Sbjct 621 AGGAACCCCC-CTTGGGGGGGGTGGTAGACATGAGGCTTCGGGAAGGAGCCGCTCCAGGG 679 Query 896 GCTGCTCGACCCACT-CTGCCTAGTGCCCAGATGTCCAGCCACTTGGGAGCTACACTGCC 954 ||||||||||||||| | || | |||||||| |||||||||||||||||||| |||| Sbjct 680 GCTGCTCGACCCACTGC-ACCCAATGCCCAGACCCCCAGCCACTTGGGAGCTACATTGCC 738 Query 955 TATAGGGCAGCATGCTGCAGGAGA-CCATGAAGTCCGTAAACAGATGTTGCCTCCGCCGC 1013 | |||| |||| || || ||||| ||| |||||||| ||||||||| ||||| || | Sbjct 739 TGTAGGACAGCCTGTTGGGGGAGATCCA-GAAGTCCGCAAACAGATGCCACCTCCACCAC 797 Query 1014 CTTG-CC--CAGGCAGAGAACTCTTCGATGACCCCTCCTATGTCAACATCCAGAATCTAG 1070 | || || |||||||||| || || ||||| ||||||||||||||| ||||||| |||| Sbjct 798 CCTGTCCAGCAGGCAGAGAGCTTTTTGATGATCCCTCCTATGTCAACGTCCAGAACCTAG 857 Query 1071 ACAAGGCCCGGCAGGCTGGGGGTGGGGCTGGGCCCCCAAATCCTTCTCTTAATGGCAGTG 1130 ||||||||||||| || | |||||| ||||||||||| |||||| || | |||||||||| Sbjct 858 ACAAGGCCCGGCAAGCAGTGGGTGGTGCTGGGCCCCCCAATCCTGCTATCAATGGCAGTG 917 Query 1131 CACCCCGAGACCTTTTTGACATGAAGCCCTTTGAAGATGCACTTCGGGTGCCACCCCCAC 1190 ||||||| ||||| ||||||||||||||||| |||||||| ||||| ||||| || || | Sbjct 918 CACCCCGGGACCTGTTTGACATGAAGCCCTTCGAAGATGCTCTTCGCGTGCCTCCACCTC 977 Query 1191 CGCAGTCCATGTCCATGGCTGAGCAGCTGCAAGGGGAGCCCTGGTTCCACGGGAAGCTGA 1250 | ||||| ||||||||||||||||||| | |||||||||||||||||| |||||||||| Sbjct 978 CCCAGTCGGTGTCCATGGCTGAGCAGCTCCGAGGGGAGCCCTGGTTCCATGGGAAGCTGA 1037 Query 1251 GCCGGAGGGAGGCCGAGGCGCTGCTGCAGCTCAATGGTGACTTCTTGGTGCGAGAGAGCA 1310 ||||| ||||||| ||||| ||||||||||||||||| |||||| |||| || ||||||| Sbjct 1038 GCCGGCGGGAGGCTGAGGCACTGCTGCAGCTCAATGGGGACTTCCTGGTACGGGAGAGCA 1097 Query 1311 CGACCACGCCTGGCCAGTATGTGCTCACTGGCCTGCAGAGTGGGCAGCCCAAGCACTTGC 1370 ||||||| |||||||||||||||||||||||| |||||||||||||||| ||||| |||| Sbjct 1098 CGACCACACCTGGCCAGTATGTGCTCACTGGCTTGCAGAGTGGGCAGCCTAAGCATTTGC 1157 Query 1371 TGCTGGTGGACCCTGAAGGTGTGGTTCGGACAAAGGATCACCGCTTTGAGAGTGTCAGTC 1430 | |||||||||||||| |||||||||||||| ||||||||||||||||| |||||||||| Sbjct 1158 TACTGGTGGACCCTGAGGGTGTGGTTCGGACTAAGGATCACCGCTTTGAAAGTGTCAGTC 1217 Query 1431 ACCTGATCAGCTACCACATGGACAATCACTTGCCCATCATCTCTGCGGGCAGCGAACTGT 1490 |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1218 ACCTTATCAGCTACCACATGGACAATCACTTGCCCATCATCTCTGCGGGCAGCGAACTGT 1277 Query 1491 GCCTACAGCAACCCGTGGATCGGAAAGTGTGATCCTTCTC-AGC--T-TCT-CCA-ACAG 1544 | ||||||||||| ||||| |||||| ||||||| | | | ||| | ||| ||| | || Sbjct 1278 GTCTACAGCAACCTGTGGAGCGGAAACTGTGATC-TGCCCTAGCGCTCTCTTCCAGA-AG 1335 Query 1545 GATGCTCTCCATTTCCGT-CT-CCCGTATTCTCTAACT-TGTGGGACCTC-T--G----T 1594 |||| ||||| | || | | ||| ||||| |||||| | |||||||| | | | Sbjct 1336 -ATGCCCTCCAAT-CCTTTCCACCC-TATTCCCTAACTCTC-GGGACCTCGTTTGGGAGT 1391 Query 1595 -TT-TGTGGGTCT-GGCCTTGGGTGGGAACTGGGAGCAACGA-GGACA-TGGGTTT-AGT 1648 || |||||| || ||||||| || || ||||||| | | | |||| ||||||| | | Sbjct 1392 GTTCTGTGGG-CTTGGCCTTGTGTCAGAGCTGGGAGTAGC-ATGGACTCTGGGTTTCA-T 1448 Query 1649 GCCCA-CTTGAGAGAGAGAAAAAGAGGGTTTCAGT-AAGGAGCCTGGG-GTAGCATCCTG 1705 ||| || ||| ||||| | | ||| ||| || |||||||| | || |||||| Sbjct 1449 ATCCAGCT-GAGTGAGAG-----G-G--TTTGAGTCAAA-AGCCTGGGTG-AGAATCCTG 1497 Query 1706 CCTCTGGCCAAAC-TT---CACCAAAGTATTAATGTGCAGAGTGGTCCCTTGTCTGGGCC 1761 ||||| |||||| || ||||||||||||||||| |||||||| |||| ||||||| Sbjct 1498 CCTCTCCCCAAACATTAATCACCAAAGTATTAATGTACAGAGTGGCCCCTCACCTGGGCC 1557 Query 1762 TTGCCTGTGCCAACCTGATGCCC-TTcccccccAAAGGGTGGGTTCTTATAATGGAAAAT 1820 || |||||||||||||||||||| |||||| || || || || ||| | ||||||||| Sbjct 1558 TTTCCTGTGCCAACCTGATGCCCCTTCCCCAAGAA-GG-TGAGTGCTTGTCATGGAAAAT 1615 Query 1821 GCCCTGTGATGATAGGCCCAGTGGA 1845 | |||||| ||| |||||||||||| Sbjct 1616 GTCCTGTGGTGACAGGCCCAGTGGA 1640 Score = 222 bits (120), Expect = 6e-54 Identities = 147/160 (91%), Gaps = 1/160 (0%) Strand=Plus/Plus Query 9 GGGTCCTGGGGTGAAAGTTGGGGCGGTGACTTAAGCAGACAGTTGCGTGATCCGGAACCA 68 ||| || |||| ||||||||| ||||| || ||||| | |||| ||||||||||| |||| Sbjct 48 GGG-CCCGGGGAGAAAGTTGGAGCGGTAACCTAAGCTGGCAGTGGCGTGATCCGGCACCA 106 Query 69 GATCGGCCCGCGGTGCGGTGCGGAGACTCCATGAGACCCTGGACATGAACAAGCTGAGTG 128 |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| Sbjct 107 AATCGGCCCGCGGTGCGGTGCGGAGACTCCATGAGGCCCTGGACATGAACAAGCTGAGTG 166 Query 129 GAGGCGGCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCT 168 ||||||||||||||||||||||||| |||||||||||||| Sbjct 167 GAGGCGGCGGGCGCAGGACTCGGGTGGAAGGGGGCCAGCT 206 >gb|BC033925.1| UniGene infoGene info Homo sapiens SHC (Src homology 2 domain containing) transforming protein 1, mRNA (cDNA clone MGC:39145 IMAGE:4896385), complete cds Length=2899 Score = 1423 bits (770), Expect = 0.0 Identities = 1234/1448 (85%), Gaps = 72/1448 (4%) Strand=Plus/Plus Query 444 GGAGGAGTAACCTGAAGTTTGCTGGAATGCCAATCACTCTCACTGTGTCTACCAGCAGCC 503 |||||||||||||||| |||||||||||||||||||||||||| || || |||||||||| Sbjct 285 GGAGGAGTAACCTGAAATTTGCTGGAATGCCAATCACTCTCACCGTCTCCACCAGCAGCC 344 Query 504 TTAACCTCATGGCAGCCGACTGCAAACAGATCATTGCCAACCATCACATGCAATCTATCT 563 | ||||||||||| || ||||||||||||||||| |||||||| |||||||||||||||| Sbjct 345 TCAACCTCATGGCCGCAGACTGCAAACAGATCATCGCCAACCACCACATGCAATCTATCT 404 Query 564 C-TTTCGCGTCCGGTGGGGATCCGGACACAGCTGAGTATGTTGCCTATGTTGCCAAAGAC 622 | ||| || ||||| ||||||||||||||||| |||||||| |||||||||||||||||| Sbjct 405 CATTT-GCATCCGGCGGGGATCCGGACACAGCCGAGTATGTCGCCTATGTTGCCAAAGAC 463 Query 623 CCTGTGAATCAGAGAGCCTGCCATATCCTGGAGTGTCCTGAAGGGCTTGCTCAGGATGTC 682 ||||||||||||||||||||||| || ||||||||||| ||||||||||| ||||||||| Sbjct 464 CCTGTGAATCAGAGAGCCTGCCACATTCTGGAGTGTCCCGAAGGGCTTGCCCAGGATGTC 523 Query 683 ATCAGCACCATCGGGCAGGCCTTTGAGTTGCGCTTCAAACAGTATCTCAGGAATCCACCG 742 ||||||||||| || |||||||| ||||||||||||||||| || |||||||| ||||| Sbjct 524 ATCAGCACCATTGGCCAGGCCTTCGAGTTGCGCTTCAAACAATACCTCAGGAACCCACCC 583 Query 743 AAGCTGGTCACCCCCCATGACAGGATGGCTGGCTTTGATGGCTCAGCTTGGGATGAGGAG 802 || ||||||||||| |||||||||||||||||||||||||||||||| |||||||||||| Sbjct 584 AAACTGGTCACCCCTCATGACAGGATGGCTGGCTTTGATGGCTCAGCATGGGATGAGGAG 643 Query 803 GAAGAAGAGCCCCCTGACCATCAGTACTACAATGACTTTCCAGGGAAGGAACCCCCTCTT 862 || |||||||| ||||||||||||||||| |||||||| || |||||||||||||| ||| Sbjct 644 GAGGAAGAGCCACCTGACCATCAGTACTATAATGACTTCCCGGGGAAGGAACCCCC-CTT 702 Query 863 -GGTGGGGTGGTAGATATGAGGCTTC--G--GGA--------AGGGGCTGCTCGACCCAC 909 || ||||||||||| |||||||||| | ||| |||||||||||||||||| Sbjct 703 GGGGGGGGTGGTAGACATGAGGCTTCGGGAAGGAGCCGCTCCAGGGGCTGCTCGACCCAC 762 Query 910 T-CTGCCTAGTGCCCAGATGTCCAGCCACTTGGGAGCTACACTGCCTATAGGGCAGCATG 968 | | || | |||||||| |||||||||||||||||||| ||||| |||| |||| || Sbjct 763 TGC-ACCCAATGCCCAGACCCCCAGCCACTTGGGAGCTACATTGCCTGTAGGACAGCCTG 821 Query 969 CTGCAGGAGA-CCATGAAGTCCGTAAACAGATGTTGCCTCCGCCGCCTTGCCCAGGCAGA 1027 || ||||| ||| |||||||| ||||||||| ||||| || || || ||||||||| Sbjct 822 TTGGGGGAGATCCA-GAAGTCCGCAAACAGATGCCACCTCCACCACCCTGTCCAGGCAGA 880 Query 1028 GAACTCTTCGATGACCCCTCCTATGTCAACATCCAGAATCTAGACAAGGCCCGGCAGGCT 1087 || || || ||||| ||||||||||||||| ||||||| ||||||||||||||||| || Sbjct 881 GAGCTTTTTGATGATCCCTCCTATGTCAACGTCCAGAACCTAGACAAGGCCCGGCAAGCA 940 Query 1088 GGGGGTGGGGCTGGGCCCCCAAATCCTTCTCTTAATGGCAGTGCACCCCGAGACCTTTTT 1147 | |||||| ||||||||||| |||||| || | ||||||||||||||||| ||||| ||| Sbjct 941 GTGGGTGGTGCTGGGCCCCCCAATCCTGCTATCAATGGCAGTGCACCCCGGGACCTGTTT 1000 Query 1148 GACATGAAGCCCTTTGAAGATGCACTTCGGGTGCCACCCCCACCGCAGTCCATGTCCATG 1207 |||||||||||||| |||||||| ||||| ||||| || || || ||||| |||||||| Sbjct 1001 GACATGAAGCCCTTCGAAGATGCTCTTCGCGTGCCTCCACCTCCCCAGTCGGTGTCCATG 1060 Query 1208 GCTGAGCAGCTGCAAGGGGAGCCCTGGTTCCACGGGAAGCTGAGCCGGAGGGAGGCCGAG 1267 ||||||||||| | |||||||||||||||||| ||||||||||||||| ||||||| ||| Sbjct 1061 GCTGAGCAGCTCCGAGGGGAGCCCTGGTTCCATGGGAAGCTGAGCCGGCGGGAGGCTGAG 1120 Query 1268 GCGCTGCTGCAGCTCAATGGTGACTTCTTGGTGCGAGAGAGCACGACCACGCCTGGCCAG 1327 || ||||||||||||||||| |||||| |||| || |||||||||||||| ||||||||| Sbjct 1121 GCACTGCTGCAGCTCAATGGGGACTTCCTGGTACGGGAGAGCACGACCACACCTGGCCAG 1180 Query 1328 TATGTGCTCACTGGCCTGCAGAGTGGGCAGCCCAAGCACTTGCTGCTGGTGGACCCTGAA 1387 ||||||||||||||| |||||||||||||||| ||||| ||||| |||||||||||||| Sbjct 1181 TATGTGCTCACTGGCTTGCAGAGTGGGCAGCCTAAGCATTTGCTACTGGTGGACCCTGAG 1240 Query 1388 GGTGTGGTTCGGACAAAGGATCACCGCTTTGAGAGTGTCAGTCACCTGATCAGCTACCAC 1447 |||||||||||||| ||||||||||||||||| |||||||||||||| |||||||||||| Sbjct 1241 GGTGTGGTTCGGACTAAGGATCACCGCTTTGAAAGTGTCAGTCACCTTATCAGCTACCAC 1300 Query 1448 ATGGACAATCACTTGCCCATCATCTCTGCGGGCAGCGAACTGTGCCTACAGCAACCCGTG 1507 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||| Sbjct 1301 ATGGACAATCACTTGCCCATCATCTCTGCGGGCAGCGAACTGTGTCTACAGCAACCTGTG 1360 Query 1508 GATCGGAAAGTGTGATCCTTCTC-AGC--T-TCT-CCA-ACAGGATGCTCTCCATTTCCG 1561 || |||||| ||||||| | | | ||| | ||| ||| | || |||| ||||| | || Sbjct 1361 GAGCGGAAACTGTGATC-TGCCCTAGCGCTCTCTTCCAGA-AG-ATGCCCTCCAAT-CCT 1416 Query 1562 T-CT-CCCGTATTCTCTAACT-TGTGGGACCTC-T--G----T-TT-TGTGGGTCT-GGC 1608 | | ||| ||||| |||||| | |||||||| | | | || |||||| || ||| Sbjct 1417 TTCCACCC-TATTCCCTAACTCTC-GGGACCTCGTTTGGGAGTGTTCTGTGGG-CTTGGC 1473 Query 1609 CTTGGGTGGGAACTGGGAGCAACGA-GGACA-TGGGTTT-AGTGCCCA-CTTGAGAGAGA 1664 |||| || || ||||||| | | | |||| ||||||| | | ||| || ||| |||| Sbjct 1474 CTTGTGTCAGAGCTGGGAGTAGC-ATGGACTCTGGGTTTCA-TATCCAGCT-GAGTGAGA 1530 Query 1665 GAAAAAGAGGGTTTCAGT-AAGGAGCCTGGG-GTAGCATCCTGCCTCTGGCCAAAC-TT- 1720 | | | ||| ||| || |||||||| | || ||||||||||| |||||| || Sbjct 1531 G-----G-G--TTTGAGTCAAA-AGCCTGGGTG-AGAATCCTGCCTCTCCCCAAACATTA 1580 Query 1721 --CACCAAAGTATTAATGTGCAGAGTGGTCCCTTGTCTGGGCCTTGCCTGTGCCAACCTG 1778 ||||||||||||||||| |||||||| |||| ||||||||| |||||||||||||| Sbjct 1581 ATCACCAAAGTATTAATGTACAGAGTGGCCCCTCACCTGGGCCTTTCCTGTGCCAACCTG 1640 Query 1779 ATGCCC-TTcccccccAAAGGGTGGGTTCTTATAATGGAAAATGCCCTGTGATGATAGGC 1837 |||||| |||||| || || || || ||| | |||||||||| |||||| ||| |||| Sbjct 1641 ATGCCCCTTCCCCAAGAA-GG-TGAGTGCTTGTCATGGAAAATGTCCTGTGGTGACAGGC 1698 Query 1838 CCAGTGGA 1845 |||||||| Sbjct 1699 CCAGTGGA 1706 >emb|AL772404.5| Download subject sequence spanning the HSP Mouse DNA sequence from clone RP23-374O4 on chromosome 2, complete sequence Length=157345 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 1282 bits (694), Expect = 0.0 Identities = 861/934 (92%), Gaps = 42/934 (4%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGG-AGGA-AT-T--G- 2224 |||||||||| |||||||||| |||||||| |||||| ||| |||| | || | | | Sbjct 44321 TGGTGGCGCAAGCCTTTAATCCCAGCACTCGGGAGGCGGAGGCAGGTA-GATTTCTGAGT 44263 Query 2225 -TGAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAG 2282 |||||||| || | ||| ||||||||||||||||||||||||||||||||||||||| Sbjct 44262 TTGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAG 44206 Query 2283 AACCTGTCTCCAAAAACCAAAAAGAGCGATTACCCCAGAGCCTTCTTCCTGATGGTAGCG 2342 |||||||||||||||||||||||||| |||||||||||||| |||||||||||||| | Sbjct 44205 AACCTGTCTCCAAAAACCAAAAAGAGTAATTACCCCAGAGCCGCCTTCCTGATGGTAGTG 44146 Query 2343 GGGAGGGGCAGGACTGGACC---CATCTTGCTCAGTGCCTCCTGACCTCAATGCCTTTCC 2399 |||| ||||||||||||||| | | ||||||||||||||||||||||||||||||||| Sbjct 44145 GGGAAGGGCAGGACTGGACCTGTCTTGTTGCTCAGTGCCTCCTGACCTCAATGCCTTTCC 44086 Query 2400 TCCAAGGGGTCTGTATACATTTCTCAAGCCTGCTCCTCCCATGTTTGCATGTGTGTTATA 2459 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 44085 TCCAAGGGGTCTGTATACATTTCTCAAGCCTGCTCCTCCCATGTTTGCATGTGTGTTATA 44026 Query 2460 GTCTACAGCCAAAGTATAGCCCTCACTGTAACCCCATCCTGCCTCCCTCCTTTGGGATAG 2519 ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| | Sbjct 44025 GTCTACAGCCAAAGTATAGCCCTCACTGTAACCCCATCCCGCCTCCCTCCTTTGGGATGG 43966 Query 2520 GTGTGTGCGTCTGACTTGGGCCTCCAGGGTGTGTACAGTCAGTGTGGGTTTTGTGGAGGC 2579 |||||||||||||||||||| || | ||||||||||||||||||||||||||||| Sbjct 43965 GTGTGTGCGTCTGACTTGGG---CC----T-TGTACAGTCAGTGTGGGTTTTGTGGAGGC 43914 Query 2580 AATAAGACTGAAGCAGTAGACAATCCCCAATACCATTTGCAGGTCTGGAACTGCACTCTC 2639 ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| Sbjct 43913 AATAAGACTGAAGTAGTAGACAATCCCCAATACCATTTGCAGGTCTGGAACTGCACTCTC 43854 Query 2640 TTTTTTAAAAAACATGTATACATTTTAGGGCTGTAGATTTATTTTCCTGGTTTTGTTTTT 2699 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct 43853 TTTTTTAAAAAACATGTATACATTTTAGGGCTGTAGATTTATTTTCCTGGTTTTATTTTT 43794 Query 2700 CATTGCTGACTTTTGAGCACAGAATTATGATAATCAATTACATTTATACATCACCTCGAT 2759 |||||||||||||||||||||||||||||||||||||||| |||||||||||||||| || Sbjct 43793 CATTGCTGACTTTTGAGCACAGAATTATGATAATCAATTAAATTTATACATCACCTC-AT 43735 Query 2760 -GACTTTTCCAAACTTTTAtttttttttttAAACAACTGTTGGGATTTTACTCCCTGGCC 2818 || |||||||||||||| ||||||| |||||||| ||||||||||||||||||||| Sbjct 43734 TGATTTTTCCAAACTTTT-TTTTTTT----AAACAACTTTTGGGATTTTACTCCCTGGCC 43680 Query 2819 TTAACTAGGACAGGATTGTACCCCACTCCTccccccccccTTTTTCTTTTTCGCCAAGAC 2878 || ||||||||||||||||||||||| || | |||||||||||| ||||||| Sbjct 43679 TTGACTAGGACAGGATTGTACCCCAC-CC-C---------TTTTTCTTTTTCACCAAGAC 43631 Query 2879 AACTGAGCAGAAATTTGGCTGAGCAGTGTTGTGGGACTATGATGTGATAGTTTTAGATCC 2938 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| Sbjct 43630 AACTGAGCAGAAATTTGGCTGAGCAGTGTTGTGGGACTATGATGTGATAGTTTTA-ATCC 43572 Query 2939 TACCTTCTGCTTTCGGGCAGCTGCAGCCAGCACAGAAACCTTGCAAGCTCACTCTGTGTG 2998 |||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || Sbjct 43571 TACCTTCTGCTTTCGGGCAGCTGCGGCCAGCACAGAAACCTTGCAAGCTCACTCTGTATG 43512 Query 2999 TAGGCTTTCTGGACAAGGAATGGTCGCCAAATTTTTGGTTTGGATGTCTTATACCAAAGG 3058 || ||||||||||||||| ||||||||||||||||| ||||||||||||||||| ||||| Sbjct 43511 TAAGCTTTCTGGACAAGGGATGGTCGCCAAATTTTTAGTTTGGATGTCTTATACGAAAGG 43452 Query 3059 GAAATAGTCTTCATTAAAGTTCGTATTTCTTTTA 3092 |||||||||||||||||||||||||||||||||| Sbjct 43451 GAAATAGTCTTCATTAAAGTTCGTATTTCTTTTA 43418 Score = 121 bits (65), Expect = 2e-23 Identities = 118/141 (83%), Gaps = 13/141 (9%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G-T 2225 ||||||||| ||||||||||| ||||||||||||||||||| |||| ||| | | | | Sbjct 12180 TGGTGGCGCGCGCCTTTAATCCCAGCACTCAGGAGGCAGAGGCAGGTGGATTTCTGAGTT 12239 Query 2226 -GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 ||||||| || | ||| ||||||||||||||||||||||||||||||| ||||| | Sbjct 12240 CGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGA-A 12295 Query 2284 ACCTGTCTCCAAAAACCAAAA 2304 || |||||| |||||| |||| Sbjct 12296 AC-TGTCTCGAAAAAC-AAAA 12314 Score = 108 bits (58), Expect = 2e-19 Identities = 117/143 (81%), Gaps = 14/143 (9%) Strand=Plus/Plus Query 2172 GGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGG-AGGA-AT-T--G-T 2225 |||| | ||||||||||||| |||||||| |||||||||| |||| | || | | | | Sbjct 85321 GGTGCCTCACGCCTTTAATCCCAGCACTCGGGAGGCAGAGGCAGGCA-GATTTCTGAGTT 85379 Query 2226 -GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 ||||||| || | ||| ||||||||||||||||||||||||||||||| ||||| | Sbjct 85380 CGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGA-A 85435 Query 2284 ACC-TGTCTCCAAAAACCAAAAA 2305 ||| ||||| |||||||||||| Sbjct 85436 ACCCTGTCTTGAAAAACCAAAAA 85458 Score = 89.8 bits (48), Expect = 6e-14 Identities = 101/124 (81%), Gaps = 13/124 (10%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAG-AGACAGGAGGA-AT-T--G- 2224 ||||||||||||||||||||| |||||||| |||| ||| || |||| ||| | | | Sbjct 100602 TGGTGGCGCACGCCTTTAATCCCAGCACTCGGGAGACAGAAG-CAGGTGGATTTCTGAGT 100660 Query 2225 T-GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAG 2282 | ||||||| || | ||| |||||||||||||||||||||||||||||| ||||| Sbjct 100661 TCGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA- 100716 Query 2283 AACC 2286 |||| Sbjct 100717 AACC 100720 Score = 82.4 bits (44), Expect = 1e-11 Identities = 57/63 (90%), Gaps = 2/63 (3%) Strand=Plus/Minus Query 2244 ACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAACC-TGTCTCCAAAAACCAA 2302 |||||||||||||||||||||||||||||| ||||| |||| |||||| ||||||||| Sbjct 129153 ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA-AACCCTGTCTCGAAAAACCAA 129095 Query 2303 AAA 2305 ||| Sbjct 129094 AAA 129092 Score = 73.1 bits (39), Expect = 6e-09 Identities = 96/121 (79%), Gaps = 14/121 (11%) Strand=Plus/Minus Query 2194 AGCACTCAGGAGGCAGAGACAGG-AGGA-AT-T--G-T-GAGGCCATCC-GATCTACAAC 2245 |||||| ||||||||||||||| | || | | | | ||||||| || | ||| || Sbjct 47442 AGCACTTGGGAGGCAGAGACAGGCA-GATTTCTGAGTTCGAGGCCAGCCTGGTCT---AC 47387 Query 2246 AGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAACC-TGTCTCCAAAAACCAAAA 2304 |||||||||||||||||||||||||||| ||||| |||| |||||| ||||| |||| Sbjct 47386 AGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA-AACCCTGTCTCAAAAAAAAAAAA 47328 Query 2305 A 2305 | Sbjct 47327 A 47327 Score = 69.4 bits (37), Expect = 8e-08 Identities = 50/56 (89%), Gaps = 2/56 (3%) Strand=Plus/Minus Query 2244 ACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAACC-TGTCTCCAAAAA 2298 |||||||||||||||||||||||||||||| ||||| |||| |||||| ||||| Sbjct 62912 ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA-AACCCTGTCTCGAAAAA 62858 >ref|XM_001366442.1| Gene info PREDICTED: Monodelphis domestica similar to SHC (Src homology 2 domain containing) transforming protein 1 (LOC100016090), mRNA Length=1734 Score = 1182 bits (640), Expect = 0.0 Identities = 1162/1408 (82%), Gaps = 60/1408 (4%) Strand=Plus/Plus Query 132 GCGGCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCTGGGGGGCGAGGAGTGGAC-CAGA 190 |||||||||| ||||||||||| |||||||||||||||||||| ||||| ||||| | | Sbjct 344 GCGGCGGGCGGAGGACTCGGGTGGAAGGGGGCCAGCTGGGGGGTGAGGAATGGACTC-GG 402 Query 191 CACGGGAGCTTTGTCAATAAGCCCACACGAGGCTGGCTGCATCCCAACGACAAAGTCATG 250 ||||||||||||||||| ||||| || || || ||| |||||||||||||||| |||||| Sbjct 403 CACGGGAGCTTTGTCAACAAGCCAACTCGGGGTTGGTTGCATCCCAACGACAAGGTCATG 462 Query 251 GGACCTGGGGTTTCCTA-CTTGGTTCGGTACATGGGCTGTGTGGAGGT-CTTACAGTCAA 308 ||||||||||||||||| ||| |||||||||||||| |||||||| || | | ||||||| Sbjct 463 GGACCTGGGGTTTCCTACCTT-GTTCGGTACATGGGTTGTGTGGAAGTGC-TCCAGTCAA 520 Query 309 TGCGAGCCCTT-GACTTCAATACCCGGACTCAGGTCACCAGGGAGGCCATCAGTTTGGTG 367 || | | | || || |||||||| || || ||||||||||| || ||||||||| ||||| Sbjct 521 TGAG-GGCTTTGGATTTCAATACTCGAACACAGGTCACCAGAGAAGCCATCAGTCTGGTG 579 Query 368 TGTGAAGCTGTGCCTGGTGCCAAAGGGGC-GACAAGGAGGAGAAAGCCTTGTAGCCGCCC 426 ||||| |||||||| || ||||| ||||| | || ||||||||||||| ||||| ||||| Sbjct 580 TGTGAGGCTGTGCCAGGGGCCAAGGGGGCTG-CACGGAGGAGAAAGCCCTGTAGTCGCCC 638 Query 427 ACTCAGCTCCATCCTGGGGAGGAGTAACCTGAAGTTTGCTGGAATGCCAATCACTCTCAC 486 ||||||||||| |||||||||||||| || ||||||||||| ||||| || || || || Sbjct 639 GCTCAGCTCCATACTGGGGAGGAGTAATCTAAAGTTTGCTGGCATGCCCATAACCCTAAC 698 Query 487 TGTGTCTACCAGCAGCCTTAACCTCATGGCAGCCGACTGCAAACAGATCATTGCCAACCA 546 ||| |||||||||||||| ||||||||||| || ||||| ||||||||||| ||||| || Sbjct 699 TGTTTCTACCAGCAGCCTCAACCTCATGGCTGCAGACTGTAAACAGATCATCGCCAATCA 758 Query 547 TCACATGCAATCTATCTCTTTCGCGTCCGGTGGGGATCCGGACACAGCTGAGTATGTTGC 606 ||||||||||| ||||| ||||| || ||||||||||||||||| || || |||||||| Sbjct 759 CCACATGCAATCAATCTCATTCGCATCTGGTGGGGATCCGGACACTGCCGAATATGTTGC 818 Query 607 CTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCATATCCTGGAGTGTCCTGAAGG 666 |||||||||||||||||||| ||||||||||||||||| |||||||||||||| | ||| Sbjct 819 TTATGTTGCCAAAGACCCTGTCAATCAGAGAGCCTGCCACATCCTGGAGTGTCCAG-AGG 877 Query 667 G-CTTGCTCAGGATGTCATCAGCACCATCGGGCAGGCCTTTGAGTTGCGCTTCAAACAGT 725 | || || |||||||||||||||||||| || |||||||||||| ||||||||||||| | Sbjct 878 GACTAGCACAGGATGTCATCAGCACCATTGGCCAGGCCTTTGAGCTGCGCTTCAAACAAT 937 Query 726 ATCTCAGGAATCCACCGAAGCTGGTCACCCCCCATGACAGGATGGCTGGCTTTGATGGCT 785 | |||||||| ||||| ||||| ||||| |||||||||||||||||||| |||||||||| Sbjct 938 ACCTCAGGAACCCACCCAAGCTTGTCACTCCCCATGACAGGATGGCTGGTTTTGATGGCT 997 Query 786 CAGCTTGGGATGAGGAGGAAGAAGAGCCCCCTGACCATCAGTACTACAATGACTTTCCAG 845 ||||||||||||||||||||||||| || ||||||||||| |||||||||||||| |||| Sbjct 998 CAGCTTGGGATGAGGAGGAAGAAGATCCACCTGACCATCAATACTACAATGACTTCCCAG 1057 Query 846 GGAAGGAACCCCCTCTTGGTGGGGTGGTAGATATGAGGCTTCGGGAAGGGGCTGCTC--G 903 ||||||| ||||| ||||||||||| ||||| |||||||||||||| || |||| | | Sbjct 1058 GGAAGGAGCCCCCCCTTGGTGGGGTAGTAGACATGAGGCTTCGGGATGGACCTGCCCCAG 1117 Query 904 --A--CC----C-ACTCTG-CCTAGTGCCCAGATGTCCAGCCACTTGGGAGCTACACT-G 952 | || | || | || | |||||| ||| |||| | ||||| || || | Sbjct 1118 GGAGTCCTTGGCCACCCACACCCAACACCCAGACCACCAACCACCTAGGAGCCAC-CTTG 1176 Query 953 CCTATAGGGCAGC-ATGCTGCAGGAGACCATGA-AGTCCGTAAACAGATGTTGCCTCCGC 1010 || | || |||| | |||| || |||| ||| | || | |||||| | | ||| | | Sbjct 1177 CCCGTTGGACAGCTA-GCTGGTGGGGACCCTGATATTC-GAAAACAG-T-T-GCCAACTC 1231 Query 1011 CGCCTTGCCCAGGCAGAGAACTCTTCGATGACCCCTCCTATGTCAACATCCAGAATCTAG 1070 | | | ||||| |||||||| || || || || ||||||||||| ||||||| || | Sbjct 1232 C---TGGACCAGGTAGAGAACTATTTGACGATCCTTCCTATGTCAATGTCCAGAACCTGG 1288 Query 1071 ACAAGGCCCGGCAGGCTGGGGGTGGGGCTGGGCCCCCAAATCCTTCT-CTTAATGGCAGT 1129 | || | |||||| | | | ||| ||| || | || ||| || | ||||||||| Sbjct 1289 AAAAAGTCCGGCAAG--GAGC-TGG---TGGTCCTTCGAACCCTACTACC-AATGGCAGT 1341 Query 1130 GCACCCCGAGACCTTTTTGACATGAAGCCCTTTGAAGATGCACTTCGGGTGCCACCC-CC 1188 || || || ||||| ||||| |||||||| ||||||||||| |||||||| || ||| || Sbjct 1342 GCTCCACGTGACCTCTTTGATATGAAGCCATTTGAAGATGCGCTTCGGGTCCC-CCCACC 1400 Query 1189 A-CCGC-AGTCCATGTCCA-TGGCTGAGCAGCTGCAAGGG--GAGCCCTGGTTCCACGGG 1243 | || | | ||| ||| |||||||||| || | ||| ||||||||||| || || Sbjct 1401 ATCCCCTACACCA---CCAATGGCTGAGCAACTCC--GGGCAGAGCCCTGGTTTCATGGC 1455 Query 1244 AAGCTGAGCCGGAGGGAGGCCGA-GGCGCTGCTGCAG-CTCAATGGTGACTTCTTGGTGC 1301 ||| ||| ||||||| || || || | |||| || |||||||| |||||| |||| | Sbjct 1456 AAGTTGAATAGGAGGGAAGCAGAAGGA-CAGCTG-AGGCTCAATGGGGACTTCCTGGTTC 1513 Query 1302 GAGAGAGCACGACCACGCCTGGCCAGTATGTGCTCACTGGCCTGCAGAGTGGGCAGCCCA 1361 | ||||| || ||||| || ||||||||||| || ||||||||||||||||| ||||||| Sbjct 1514 GGGAGAGTACAACCACTCCAGGCCAGTATGTCCTTACTGGCCTGCAGAGTGGCCAGCCCA 1573 Query 1362 AGCACTTGCTGCTGGTGGACCCTGAAGGTGTGGTTCGGACAAAGGATCACCGCTTTGAGA 1421 | || |||||||| || ||||||||||||||||||||||||||||||||||| ||||||| Sbjct 1574 AACATTTGCTGCTTGTCGACCCTGAAGGTGTGGTTCGGACAAAGGATCACCGATTTGAGA 1633 Query 1422 GTGTCAGTCACCTGATCAGCTACCACATGGACAATCACTTGCCCATCATCTCTGCGGGCA 1481 ||||||||||||| |||||||||||||||||||||||| | |||||||||||||| |||| Sbjct 1634 GTGTCAGTCACCTTATCAGCTACCACATGGACAATCACCTCCCCATCATCTCTGCAGGCA 1693 Query 1482 GCGAACTGTGCCTACAGCAACCCGTGGA 1509 |||| || || || ||||| || ||||| Sbjct 1694 GCGAGCTATGTCTTCAGCAGCCTGTGGA 1721 >dbj|AB208849.1| UniGene infoGene info Homo sapiens mRNA for SHC (Src homology 2 domain containing) transforming protein 1 isoform p66Shc variant protein Length=4205 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 1129 bits (611), Expect = 0.0 Identities = 851/966 (88%), Gaps = 20/966 (2%) Strand=Plus/Plus Query 446 AGGAGTAACCTGAAGTTTGCTGGAATGCCAATCACTCTCACTGTGTCTACCAGCAGCCTT 505 |||||||||||||| |||||||||||||||||||||||||| || || ||||||||||| Sbjct 2 AGGAGTAACCTGAAATTTGCTGGAATGCCAATCACTCTCACCGTCTCCACCAGCAGCCTC 61 Query 506 AACCTCATGGCAGCCGACTGCAAACAGATCATTGCCAACCATCACATGCAATCTATCTC- 564 ||||||||||| || ||||||||||||||||| |||||||| ||||||||||||||||| Sbjct 62 AACCTCATGGCCGCAGACTGCAAACAGATCATCGCCAACCACCACATGCAATCTATCTCA 121 Query 565 TTTCGCGTCCGGTGGGGATCCGGACACAGCTGAGTATGTTGCCTATGTTGCCAAAGACCC 624 ||| || ||||| ||||||||||||||||| |||||||| |||||||||||||||||||| Sbjct 122 TTT-GCATCCGGCGGGGATCCGGACACAGCCGAGTATGTCGCCTATGTTGCCAAAGACCC 180 Query 625 TGTGAATCAGAGAGCCTGCCATATCCTGGAGTGTCCTGAAGGGCTTGCTCAGGATGTCAT 684 ||||||||||||||||||||| || ||||||||||| ||||||||||| ||||||||||| Sbjct 181 TGTGAATCAGAGAGCCTGCCACATTCTGGAGTGTCCCGAAGGGCTTGCCCAGGATGTCAT 240 Query 685 CAGCACCATCGGGCAGGCCTTTGAGTTGCGCTTCAAACAGTATCTCAGGAATCCACCGAA 744 ||||||||| || |||||||| ||||||||||||||||| || |||||||| ||||| || Sbjct 241 CAGCACCATTGGCCAGGCCTTCGAGTTGCGCTTCAAACAATACCTCAGGAACCCACCCAA 300 Query 745 GCTGGTCACCCCCCATGACAGGATGGCTGGCTTTGATGGCTCAGCTTGGGATGAGGAGGA 804 ||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||| Sbjct 301 ACTGGTCACCCCTCATGACAGGATGGCTGGCTTTGATGGCTCAGCATGGGATGAGGAGGA 360 Query 805 AGAAGAGCCCCCTGACCATCAGTACTACAATGACTTTCCAGGGAAGGAACCCCCTCTTGG 864 |||||||| ||||||||||||||||| |||||||| || |||||||||||||| ||||| Sbjct 361 GGAAGAGCCACCTGACCATCAGTACTATAATGACTTCCCGGGGAAGGAACCCCC-CTTGG 419 Query 865 TGGGG-TGGTAGATATGAGGCTTCGGGAAGG-G--GCT---G---CT-C--GACCCACT- 910 |||| ||||||| ||||||||||||||||| | ||| | || | |||||||| Sbjct 420 GGGGGGTGGTAGACATGAGGCTTCGGGAAGGAGCCGCTCCAGGGGCTGCTCGACCCACTG 479 Query 911 CTGCCTAGTGCCCAGATGTCCAGCCACTTGGGAGCTACACTGCCTATAGGGCAGCATGCT 970 | || | |||||||| |||||||||||||||||||| ||||| |||| |||| || | Sbjct 480 CACCCAA-TGCCCAGACCCCCAGCCACTTGGGAGCTACATTGCCTGTAGGACAGCCTGTT 538 Query 971 GCAGGAGA-CCATGAAGTCCGTAAACAGATGTTGCCTCCGCCGCCTTGCCCAGGCAGAGA 1029 | ||||| ||| |||||||| ||||||||| ||||| || || || ||||||||||| Sbjct 539 GGGGGAGATCCA-GAAGTCCGCAAACAGATGCCACCTCCACCACCCTGTCCAGGCAGAGA 597 Query 1030 ACTCTTCGATGACCCCTCCTATGTCAACATCCAGAATCTAGACAAGGCCCGGCAGGCTGG 1089 || || ||||| ||||||||||||||| ||||||| ||||||||||||||||| || | Sbjct 598 GCTTTTTGATGATCCCTCCTATGTCAACGTCCAGAACCTAGACAAGGCCCGGCAAGCAGT 657 Query 1090 GGGTGGGGCTGGGCCCCCAAATCCTTCTCTTAATGGCAGTGCACCCCGAGACCTTTTTGA 1149 |||||| ||||||||||| |||||| || | ||||||||||||||||| ||||| ||||| Sbjct 658 GGGTGGTGCTGGGCCCCCCAATCCTGCTATCAATGGCAGTGCACCCCGGGACCTGTTTGA 717 Query 1150 CATGAAGCCCTTTGAAGATGCACTTCGGGTGCCACCCCCACCGCAGTCCATGTCCATGGC 1209 |||||||||||| |||||||| ||||| ||||| || || || |||||| |||||||||| Sbjct 718 CATGAAGCCCTTCGAAGATGCTCTTCGCGTGCCTCCACCTCCCCAGTCCGTGTCCATGGC 777 Query 1210 TGAGCAGCTGCAAGGGGAGCCCTGGTTCCACGGGAAGCTGAGCCGGAGGGAGGCCGAGGC 1269 ||||||||| | |||||||||||||||||| ||||||||||||||| ||||||| ||||| Sbjct 778 TGAGCAGCTCCGAGGGGAGCCCTGGTTCCATGGGAAGCTGAGCCGGCGGGAGGCTGAGGC 837 Query 1270 GCTGCTGCAGCTCAATGGTGACTTCTTGGTGCGAGAGAGCACGACCACGCCTGGCCAGTA 1329 ||||||||||||||||| |||||| |||| || |||||||||||||| ||||||||||| Sbjct 838 ACTGCTGCAGCTCAATGGGGACTTCCTGGTACGGGAGAGCACGACCACACCTGGCCAGTA 897 Query 1330 TGTGCTCACTGGCCTGCAGAGTGGGCAGCCCAAGCACTTGCTGCTGGTGGACCCTGAAGG 1389 ||||||||||||| |||||||||||||||| ||||| ||||| |||||||||||||| || Sbjct 898 TGTGCTCACTGGCTTGCAGAGTGGGCAGCCTAAGCATTTGCTACTGGTGGACCCTGAGGG 957 Query 1390 TGTGGT 1395 |||||| Sbjct 958 TGTGGT 963 Score = 302 bits (163), Expect = 7e-78 Identities = 385/483 (79%), Gaps = 52/483 (10%) Strand=Plus/Plus Query 1393 GGTTCGGACAAAGGATCACCGCTTTGAGAGTGTCAGTCACCTGATCAGCTACCACATGGA 1452 ||||||||| ||||||||||||||||| |||||||||||||| ||||||||||||||||| Sbjct 2572 GGTTCGGACTAAGGATCACCGCTTTGAAAGTGTCAGTCACCTTATCAGCTACCACATGGA 2631 Query 1453 CAATCACTTGCCCATCATCTCTGCGGGCAGCGAACTGTGCCTACAGCAACCCGTGGATCG 1512 ||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| || Sbjct 2632 CAATCACTTGCCCATCATCTCTGCGGGCAGCGAACTGTGTCTACAGCAACCTGTGGAGCG 2691 Query 1513 GAAAGTGTGATCCTTCTC-AGC--T-TCT-CCA-ACAGGATGCTCTCCATTTCCGT-CT- 1564 |||| ||||||| | | | ||| | ||| ||| | || |||| ||||| | || | | Sbjct 2692 GAAACTGTGATC-TGCCCTAGCGCTCTCTTCCAGA-AG-ATGCCCTCCAAT-CCTTTCCA 2747 Query 1565 CCCGTATTCTCTAACT-TGTGGGACCTC-T--G----T-TT-TGTGGGTCT-GGCCTTGG 1613 ||| ||||| |||||| | |||||||| | | | || |||||| || ||||||| Sbjct 2748 CCC-TATTCCCTAACTCTC-GGGACCTCGTTTGGGAGTGTTCTGTGGG-CTTGGCCTTGT 2804 Query 1614 GTGGGAACTGGGAGCAACGA-GGACA-TGGGTTT-AGTGCCCA-CTTGAGAGAGAGAAAA 1669 || || ||||||| | | | |||| ||||||| | | ||| || ||| ||||| Sbjct 2805 GTCAGAGCTGGGAGTAGC-ATGGACTCTGGGTTTCA-TATCCAGCT-GAGTGAGAG---- 2857 Query 1670 AGAGGGTTTCAGT-AAGGAGCCTGGG-GTAGCATCCTGCCTCTGGCCAAAC-TT---CAC 1723 | | ||| ||| || |||||||| | || ||||||||||| |||||| || ||| Sbjct 2858 -G-G--TTTGAGTCAAA-AGCCTGGGTG-AGAATCCTGCCTCTCCCCAAACATTAATCAC 2911 Query 1724 CAAAGTATTAATGTGCAGAGTGGTCCCTTGTCTGGGCCTTGCCTGTGCCAACCTGATGCC 1783 |||||||||||||| |||||||| |||| ||||||||| ||||||||||||||||||| Sbjct 2912 CAAAGTATTAATGTACAGAGTGGCCCCTCACCTGGGCCTTTCCTGTGCCAACCTGATGCC 2971 Query 1784 C-TTcccccccAAAGGGTGGGTTCTTATAATGGAAAATGCCCTGTGATGATAGGCCCAGT 1842 | |||||| || || || || ||| | |||||||||| |||||| ||| ||||||||| Sbjct 2972 CCTTCCCCAAGAA-GG-TGAGTGCTTGTCATGGAAAATGTCCTGTGGTGACAGGCCCAGT 3029 Query 1843 GGA 1845 ||| Sbjct 3030 GGA 3032 >ref|XM_860082.1| UniGene infoGene info PREDICTED: Canis familiaris similar to src homology 2 domain-containing transforming protein C, transcript variant 4 (LOC490439), mRNA Length=2860 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 904 bits (489), Expect = 0.0 Identities = 604/660 (91%), Gaps = 6/660 (0%) Strand=Plus/Plus Query 109 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCT 168 |||||||||||||||||||||||| |||||||||||||| ||||| |||||||||||||| Sbjct 423 GGACATGAACAAGCTGAGTGGAGGAGGCGGGCGCAGGACGCGGGTGGAAGGGGGCCAGCT 482 Query 169 GGGGGGCGAGGAGTGGACCAGACACGGGAGCTTTGTCAATAAGCCCACACGAGGCTGGCT 228 ||||||||||||||||||| | ||||||||||| ||||||||||||||||| |||||||| Sbjct 483 GGGGGGCGAGGAGTGGACCCGCCACGGGAGCTTCGTCAATAAGCCCACACGGGGCTGGCT 542 Query 229 GCATCCCAACGACAAAGTCATGGGACCTGGGGTTTCCTACTTGGTTCGGTACATGGGCTG 288 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 543 ACATCCCAACGACAAAGTCATGGGACCTGGGGTTTCCTACTTGGTTCGGTACATGGGCTG 602 Query 289 TGTGGAGGTCTTACAGTCAATGCGAGCCCTTG-ACTTCAATACCCGGACTCAGGTCACCA 347 |||||||||| | ||||||||||| ||| ||| ||||||| ||||| || || ||||||| Sbjct 603 TGTGGAGGTCCTGCAGTCAATGCGTGCC-TTGGACTTCAACACCCGCACCCAAGTCACCA 661 Query 348 GGGAGGCCATCAGTTTGGTGTGTGAAGCTGTGCCTGGTGCCAAAGGGGCGACAAGGAGGA 407 |||||||||||||| |||||||||| |||||||| |||||||| ||||| ||||| |||| Sbjct 662 GGGAGGCCATCAGTCTGGTGTGTGAGGCTGTGCCCGGTGCCAAGGGGGCTACAAGAAGGA 721 Query 408 GAAAGCCTTGTAGCCGCCCACTCAGCT-CCATCCTGGGGAGGAGTAACCTGAAGTTTGCT 466 ||||||| ||||||||||||||||| | ||||||||||||||||||| ||||| ||||| Sbjct 722 GAAAGCCCTGTAGCCGCCCACTCAG-TGCCATCCTGGGGAGGAGTAATCTGAAATTTGCG 780 Query 467 GGAATGCCAATCACTCTCACTGTGTCTACCAGCAGCCTTAACCTCATGGCAGCCGACTGC 526 |||||||||||||||||||| || || ||||||||||| ||||| ||||| || |||||| Sbjct 781 GGAATGCCAATCACTCTCACCGTCTCCACCAGCAGCCTCAACCTTATGGCCGCAGACTGC 840 Query 527 AAACAGATCATTGCCAACCATCACATGCAATCTATCTC-TTTCGCGTCCGGTGGGGATCC 585 ||||||||||| |||||||| |||||||| |||||||| ||| |||||||||||||| || Sbjct 841 AAACAGATCATCGCCAACCACCACATGCAGTCTATCTCCTTT-GCGTCCGGTGGGGACCC 899 Query 586 GGACACAGCTGAGTATGTTGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCA 645 ||||||||||||||| || |||||||||||||||||||| ||||||||||||||||| || Sbjct 900 GGACACAGCTGAGTACGTCGCCTATGTTGCCAAAGACCCGGTGAATCAGAGAGCCTGTCA 959 Query 646 TATCCTGGAGTGTCCTGAAGGGCTTGCTCAGGATGTCATCAGCACCATCGGGCAGGCCTT 705 ||||||||| ||||| ||||||||||||||||||||||||||||||||||| |||||||| Sbjct 960 TATCCTGGAATGTCCCGAAGGGCTTGCTCAGGATGTCATCAGCACCATCGGCCAGGCCTT 1019 Query 706 TGAGTTGCGCTTCAAACAGTATCTCAGGAATCCACCGAAGCTGGTCACCCCCCATGACAG 765 ||||||||||||||||| || |||||||| || || |||||||||||||| |||||||| Sbjct 1020 CGAGTTGCGCTTCAAACAATACCTCAGGAACCCGCCCAAGCTGGTCACCCCTCATGACAG 1079 Score = 414 bits (224), Expect = 9e-112 Identities = 283/312 (90%), Gaps = 2/312 (0%) Strand=Plus/Plus Query 1222 AGGGGAGCCCTGGTTCCACGGGAAGCTGAGCCGGAGGGAGGCCGAGGCGCTGCTGCAGCT 1281 |||||||||||||||||| ||||||||||||||| ||||||||||||| ||||||||||| Sbjct 1146 AGGGGAGCCCTGGTTCCATGGGAAGCTGAGCCGGCGGGAGGCCGAGGCCCTGCTGCAGCT 1205 Query 1282 CAATGGTGACTTCTTGGTGCGAGAGAGCACGACCACGCCTGGCCAGTATGTGCTCACTGG 1341 |||||| |||||| ||||||| |||||||||||||| || |||||||| ||||||||||| Sbjct 1206 CAATGGGGACTTCCTGGTGCGGGAGAGCACGACCACACCCGGCCAGTACGTGCTCACTGG 1265 Query 1342 CCTGCAGAGTGGGCAGCCCAAGCACTTGCTGCTGGTGGACCCTGAAGGTGTGGTTCGGAC 1401 | ||||||||||||||||||||||| |||||||||||||||| || ||||||||||| || Sbjct 1266 CTTGCAGAGTGGGCAGCCCAAGCACCTGCTGCTGGTGGACCCGGAGGGTGTGGTTCGAAC 1325 Query 1402 AAAGGATCACCGCTTTGAGAGTGTCAGTCACCTGATCAGCTACCACATGGACAATCACTT 1461 ||||||||||||||||||||||||||| ||||| |||||||||||| ||||||||||||| Sbjct 1326 AAAGGATCACCGCTTTGAGAGTGTCAGCCACCTCATCAGCTACCACGTGGACAATCACTT 1385 Query 1462 GCCCATCATCTCTGCGGGCAGCGAACTGTGCCTACAGCAACCCGTGGATCGGAAAG-TGT 1520 ||| ||||||||||||||||| ||||| || || || || || ||||| ||||| | ||| Sbjct 1386 GCCTATCATCTCTGCGGGCAGTGAACTCTGTCTCCAACAGCCTGTGGAGCGGAA-GCTGT 1444 Query 1521 GATCCTTCTCAG 1532 ||||| |||||| Sbjct 1445 GATCCATCTCAG 1456 >gb|AF197017.1|AF197017 Pan troglodytes adaptor protein (Shc) pseudogene, partial sequence Length=961 Score = 867 bits (469), Expect = 0.0 Identities = 771/914 (84%), Gaps = 32/914 (3%) Strand=Plus/Plus Query 632 CAGAGAGCCTGCCATATCCTGGAGTGTCCTGAAGGGCTTGCTCAGGATGTCATCAGCACC 691 |||| ||| ||||| || |||||||||||||||||||||||||||||||||||||||||| Sbjct 1 CAGAAAGCATGCCACATTCTGGAGTGTCCTGAAGGGCTTGCTCAGGATGTCATCAGCACC 60 Query 692 ATCGGGCAGGCCTTTGAGTTGCGCTTCAAACAGTATCTCAGGAATCCACCGAAGCTGGTC 751 || || |||||||| |||||| ||| ||||| || ||||| || ||||| || |||||| Sbjct 61 ATTGGCCAGGCCTTCAAGTTGCACTTTAAACAATACCTCAGAAAACCACCCAAACTGGTC 120 Query 752 ACCCCCCATGACAGGATGGCTGGCTTTGATGGCTCAGCTTGGGATGAGGAGGAAGAAGAG 811 |||||||||||||||||| |||||||| |||||| |||||||||||||||||| |||||| Sbjct 121 ACCCCCCATGACAGGATGACTGGCTTTCATGGCTTAGCTTGGGATGAGGAGGAGGAAGAG 180 Query 812 CCCCCTGACCATCAGTACTACAATGACTTTCCAGGGAAGGAACCCCCTC-TTGGTGGGGT 870 || |||| ||||||| |||| |||||| |||| ||||||||| |||||| |||| || Sbjct 181 CCACCTGGCCATCAGCACTATAATGAC-TTCCTGGGAAGGAATCCCCTCTTTGG-CATGT 238 Query 871 GGTAGATATGAGGCTTC-----GG-G--A----AGGGGCTGCTCGACCCACTCTGCCTAG 918 |||| | |||||||||| || | | |||||||||||||||||||| || || Sbjct 239 GGTATACATGAGGCTTCGGGAAGGAGCCACTCCAGGGGCTGCTCGACCCACTCCACCCAG 298 Query 919 TGCCCAGATGTCCAGCCACTTGGGAGCTACACTGCCTATAGGGCAG-CATGCTGCAGGAG 977 |||||||| |||||||||||||| ||||||||||| |||| ||| | || || |||| Sbjct 299 TGCCCAGACCCCCAGCCACTTGGGATCTACACTGCCTGTAGGACAGTC-TGTTGGGGGAG 357 Query 978 A-CCATGAAGTCCGTAAACAGATGTTGCCTCCGCCGCCTTGCCCAGGCAGAGAACTCTTC 1036 | ||| ||||| | ||| ||||| ||||| || || || ||||||||||| ||||| Sbjct 358 ATCCA-GAAGTTTGCAAATAGATGCCACCTCCACCACCCTGTCCAGGCAGAGAGCTCTTT 416 Query 1037 GATGACCCCTCCTATGTCAACATCCAGAATCTAGACAAGGCCCGGCAGGCTGGGGGTGGG 1096 ||||| |||||| |||||||| | ||||| ||||||||||||||||| || |||| ||| Sbjct 417 GATGATCCCTCCAATGTCAACGTGCAGAACCTAGACAAGGCCCGGCAAGCAGGGGTTGGT 476 Query 1097 GCTGGG-CCCCCAAATCCTTCTC-TTAATGGCAGTGCACCCCGAGACCTTTTTGACATGA 1154 |||||| ||||| |||||| | | | |||||||| ||||| ||||||| |||||||||| Sbjct 477 GCTGGGACCCCC-AATCCTGC-CATCAATGGCAGCACACCCTGAGACCTGTTTGACATGA 534 Query 1155 AGCCCTTTGAAGATGCACTTCGGGTGCCACCCCCACCGCAGTCCATGTCCATGGCTGAGC 1214 |||||||||||||||| |||| |||| || || || |||| ||||||||| | ||| Sbjct 535 AGCCCTTTGAAGATGCTCTTCACATGCCTCCTCCTCCCCAGTTGGTGTCCATGGTTAAGC 594 Query 1215 AGCTGC-AAGGGGAGCCCTGGTTCCACGGGAAGCTGAG-CCGGAGGGAGGCCGAGGCGCT 1272 |||| | |||||| ||||||||||| ||||||||||| | | |||||| ||||| || Sbjct 595 AGCT-CTGAGGGGA-CCCTGGTTCCATGGGAAGCTGAGTTAGCA-GGAGGCTGAGGCACT 651 Query 1273 GCTGCAGCTCAATGGTGACTTCTTGGTGCGA-GAGAGCACGACCACGCCTGGCCAGTATG 1331 |||||||||||| || |||||| |||||| | ||||||| |||||| ||||||||||||| Sbjct 652 GCTGCAGCTCAACGGGGACTTCCTGGTGC-AGGAGAGCATGACCACACCTGGCCAGTATG 710 Query 1332 TGCTCACTGGCCTGCAGAGTGGGCAGCCCAAGCACT-TGCTGCTGGTGGACCCTGAAGGT 1390 ||||||||||| ||||||||||| || ||||||| | |||| |||||||||||||| ||| Sbjct 711 TGCTCACTGGCTTGCAGAGTGGGGAGTCCAAGCA-TCTGCTACTGGTGGACCCTGAGGGT 769 Query 1391 GTGGTTCGGACAAAGGATCACCGCTTTGAGAGTGTCAGTCACCTGATCAGCTACCACATG 1450 || ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct 770 GTAGTTCGGACAAAGGATCACCGCTTTGAGAGTGTCAGTCACCTCATCAGCTACCACATG 829 Query 1451 GACAATCACTTGCCCATCATCTCTGCGGGCAGCGAACTGTGCCTACAGCAACCCGTGGAT 1510 ||||||||||||||||||| |||||| ||||| |||||||| ||||||||||| ||||| Sbjct 830 GACAATCACTTGCCCATCACCTCTGCTGGCAGTGAACTGTGTCTACAGCAACCTGTGGAG 889 Query 1511 CGGAAAGTGTGATC 1524 | |||| ||||||| Sbjct 890 CAGAAACTGTGATC 903 >gb|AF196996.1|AF196996 Homo sapiens adaptor protein pseudogene, partial sequence Length=961 Score = 861 bits (466), Expect = 0.0 Identities = 771/915 (84%), Gaps = 34/915 (3%) Strand=Plus/Plus Query 632 CAGAGAGCCTGCCATATCCTGGAGTGTCCTGAAGGGCTTGCTCAGGATGTCATCAGCACC 691 |||| ||| ||||| || |||||||||||||||||||||||||||||||||||||||||| Sbjct 1 CAGAAAGCATGCCACATTCTGGAGTGTCCTGAAGGGCTTGCTCAGGATGTCATCAGCACC 60 Query 692 ATC-GGGCAGGCCTTTGAGTTGCGCTTCAAACAGTATCTCAGGAATCCACCGAAGCTGGT 750 | | || |||||||| |||||| ||| ||||| || ||||| || ||||| || ||||| Sbjct 61 A-CTGGCCAGGCCTTCAAGTTGCACTTTAAACAATACCTCAGAAAACCACCCAAACTGGT 119 Query 751 CACCCCCCATGACAGGATGGCTGGCTTTGATGGCTCAGCTTGGGATGAGGAGGAAGAAGA 810 ||||||||||||||||||| ||||||||||||||| |||||||||||||||||| ||||| Sbjct 120 CACCCCCCATGACAGGATGACTGGCTTTGATGGCTTAGCTTGGGATGAGGAGGAGGAAGA 179 Query 811 GCCCCCTGACCATCAGTACTACAATGACTTTCCAGGGAAGGAACCCCCTC-TTGGTGGGG 869 ||| |||| ||||||| |||| |||||| |||| ||||||||| |||||| |||| | Sbjct 180 GCCGCCTGGCCATCAGCACTATAATGAC-TTCCTGGGAAGGAATCCCCTCTTTGG-CATG 237 Query 870 TGGTAGATATGAGGCTTC-----GG-G--A----AGGGGCTGCTCGACCCACTCTGCCTA 917 ||||| | |||||||||| || | | |||||||||||||||||||| || | Sbjct 238 TGGTATACATGAGGCTTCGGGAAGGAGCCACTCCAGGGGCTGCTCGACCCACTCCACCCA 297 Query 918 GTGCCCAGATGTCCAGCCACTTGGGAGCTACACTGCCTATAGGGCAG-CATGCTGCAGGA 976 ||||||||| |||||||||||||| ||||||||||| |||| ||| | || || ||| Sbjct 298 GTGCCCAGACCCCCAGCCACTTGGGATCTACACTGCCTGTAGGACAGTC-TGTTGGGGGA 356 Query 977 GA-CCATGAAGTCCGTAAACAGATGTTGCCTCCGCCGCCTTGCCCAGGCAGAGAACTCTT 1035 || ||| ||||| | ||| ||||| ||||| || || || ||||||||||| ||||| Sbjct 357 GATCCA-GAAGTTTGCAAATAGATGCCACCTCCACCACCCTGTCCAGGCAGAGAGCTCTT 415 Query 1036 CGATGACCCCTCCTATGTCAACATCCAGAATCTAGACAAGGCCCGGCAGGCTGGGGGTGG 1095 ||||| |||||| |||||||| | ||||| ||||||||||||||||| || |||||||| Sbjct 416 TGATGATCCCTCCAATGTCAACGTGCAGAACCTAGACAAGGCCCGGCAAGCAGGGGGTGG 475 Query 1096 GGCTGGG-CCCCCAAATCCTTCTC-TTAATGGCAGTGCACCCCGAGACCTTTTTGACATG 1153 |||||| ||||| |||||| | | | |||||||| ||||| ||||||| ||||||||| Sbjct 476 TGCTGGGACCCCC-AATCCTGC-CATCAATGGCAGCACACCCTGAGACCTGTTTGACATG 533 Query 1154 AAGCCCTTTGAAGATGCACTTCGGGTGCCACCCCCACCGCAGTCCATGTCCATGGCTGAG 1213 |||||||||||||| | |||| |||| || | || |||| ||||||||||| || Sbjct 534 AAGCCCTTTGAAGACACTCTTCACATGCCTCCTCTTCCCCAGTTGGTGTCCATGGCTAAG 593 Query 1214 CAGCTGC-AAGGGGAGCCCTGGTTCCACGGGAAGCTGAGC-CGGAGGGAGGCCGAGGCGC 1271 ||||| | |||||| ||||||||||| |||||||||||| | |||| ||| ||||| | Sbjct 594 CAGCT-CTGAGGGGA-CCCTGGTTCCAAGGGAAGCTGAGCTAGCAGGG-GGCTGAGGCAC 650 Query 1272 TGCTGCAGCTCAATGGTGACTTCTTGGTGCGA-GAGAGCACGACCACGCCTGGCCAGTAT 1330 |||||||| ||||||| |||||| |||||| | ||||||| |||||| |||||||||||| Sbjct 651 TGCTGCAGTTCAATGGGGACTTCCTGGTGC-AGGAGAGCATGACCACACCTGGCCAGTAT 709 Query 1331 GTGCTCACTGGCCTGCAGAGTGGGCAGCCCAAGCACT-TGCTGCTGGTGGACCCTGAAGG 1389 |||||||||||| ||||||||||| || ||||||| | |||| |||||||||||||| || Sbjct 710 GTGCTCACTGGCTTGCAGAGTGGGGAGTCCAAGCA-TCTGCTACTGGTGGACCCTGAGGG 768 Query 1390 TGTGGTTCGGACAAAGGATCACCGCTTTGAGAGTGTCAGTCACCTGATCAGCTACCACAT 1449 ||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct 769 TGTAGTTCGGACAAAGGATCACCGCTTTGAGAGTGTCAGTCACCTCATCAGCTACCACAT 828 Query 1450 GGACAATCACTTGCCCATCATCTCTGCGGGCAGCGAACTGTGCCTACAGCAACCCGTGGA 1509 |||||||||||||||||||| |||||| ||||| ||| |||| ||||||||||| ||||| Sbjct 829 GGACAATCACTTGCCCATCACCTCTGCTGGCAGTGAATTGTGTCTACAGCAACCTGTGGA 888 Query 1510 TCGGAAAGTGTGATC 1524 | |||| ||||||| Sbjct 889 GCAGAAACTGTGATC 903 >ref|XR_008689.1| UniGene infoGene info PREDICTED: Rattus norvegicus similar to src homology 2 domain-containing transforming protein C (LOC500206), mRNA Length=1215 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 776 bits (420), Expect = 0.0 Identities = 492/527 (93%), Gaps = 4/527 (0%) Strand=Plus/Plus Query 277 GTACATGGGCTGTGTGGAGGTCTTACAGTCAATGCGAGCCCTTGACTTCAATACCCGGAC 336 ||||||| | || ||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 125 GTACATGAGTTGCGTGGAGGTCTTACAGTCAATGCGAGCCCTTGACTTCAATACCCGGAC 184 Query 337 TCAGGTCACCAGGGAGGCCATCAGTTTGGTGTGTGAAGCTGTGCCTGGTGCCAAAGGGGC 396 |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct 185 TCAGGTCACCAGGGAGGCCATCGGTTTGGTGTGTGAAGCTGTGCCTGGTGCCAAAGGGGC 244 Query 397 GACAAGGAGGAGAAAG-CCTTGTAGCCGCCCACTCAGCTCCATCCTGGGGAGGAGTAACC 455 ||| | |||||||||| ||| | ||||||||||||||||| ||||||||||||||||||| Sbjct 245 GACGACGAGGAGAAAGTCCT-GCAGCCGCCCACTCAGCTCTATCCTGGGGAGGAGTAACC 303 Query 456 TGAAGTTTGCTGGAATGCCAATCACTCTCACTGTGTCTACCAGCAGCCTTAACCTCATGG 515 |||||||||||||| |||| |||| |||||||| ||||||||||||||| |||||||||| Sbjct 304 TGAAGTTTGCTGGAGTGCCGATCATTCTCACTGCGTCTACCAGCAGCCT-AACCTCATGG 362 Query 516 CAGCCGACTGCAAACAGATCATTGCCAACCATCACATGCAATCTATCTCTTTCGCGTCCG 575 |||| ||| |||| ||||||||||||||||||||||||||||||||| | |||||||| | Sbjct 363 CAGCAGACCGCAAGCAGATCATTGCCAACCATCACATGCAATCTATCCCATTCGCGTCTG 422 Query 576 GTGGGGATCCGGACACAGCTGAGTATGTTGCCTATGTTGCCAAAGACCCTGTGAATCAGA 635 ||||| ||| ||||||| ||||||| ||||||||||||||||||||||||| |||||||| Sbjct 423 GTGGGAATCTGGACACAACTGAGTACGTTGCCTATGTTGCCAAAGACCCTGCGAATCAGA 482 Query 636 GAGCCTGCCATATCCTGGAGTGTCCTGAAGGGCTTGCTCAGGATGTCATCAGCACCATCG 695 ||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||| Sbjct 483 GAGCCTGCCATATCCTGGAGTGTCCTGAAGGACTTGCTCAGGACGTCATCAGCACCATCG 542 Query 696 GGCAGGCCTTTGAGTTGCGCTTCAAACAGTATCTCAGGAATCCACCGAAGCTGGTCACCC 755 ||||||||||||||||||||||||||||||||||||||||| | || | | |||||||| Sbjct 543 GGCAGGCCTTTGAGTTGCGCTTCAAACAGTATCTCAGGAATTC-CCTATGAAGGTCACCC 601 Query 756 CCCATGACAGGATGGCTGGCTTTGATGGCTCAGCTTGGGATGAGGAG 802 ||||||||||||||||||||||||||| ||||||||||||||||||| Sbjct 602 CCCATGACAGGATGGCTGGCTTTGATGACTCAGCTTGGGATGAGGAG 648 Score = 749 bits (405), Expect = 0.0 Identities = 514/568 (90%), Gaps = 2/568 (0%) Strand=Plus/Plus Query 956 ATAGGGCAGCATGCTGCAGGAGACCATGAAGTCCGTAAACAGATGTTGCCTCCGCCGCCT 1015 ||||||||||||| | ||||||||||||||||||||||||||||| |||| || || || Sbjct 649 ATAGGGCAGCATGTTACAGGAGACCATGAAGTCCGTAAACAGATGCTGCCCCCACCACCG 708 Query 1016 TGCCCAGGCAGAGAACTCTTCGATGACCCCTCCTATGTCAACATCCAGAATCTAGACAAG 1075 ||||||||||||||| |||||||||| || | |||||||||||| ||||||||||||||| Sbjct 709 TGCCCAGGCAGAGAATTCTTCGATGATCCTTTCTATGTCAACATACAGAATCTAGACAAG 768 Query 1076 GCCCGGCAGGCTGGGGGTGGGGCTGGGCCCCCAAATCCTTCTCTTAATGGCAGTGCACCC 1135 |||||||| ||||| |||||||| || |||||||||||||| ||||||||||||||||| Sbjct 769 GCCCGGCAAGCTGGTGGTGGGGCCGGATCCCCAAATCCTTCTATTAATGGCAGTGCACCC 828 Query 1136 CGAGACCTTTTTGACATGAAGCCCTTTGAAGATGCACTTCGGGTGCCACCCCCACCGCAG 1195 |||||||| |||||||||||||||||||||||| |||| || ||||| || | || ||| Sbjct 829 CGAGACCTCTTTGACATGAAGCCCTTTGAAGATACACTCCGTGTGCCGCCAGCTCCCCAG 888 Query 1196 TCCATGTCCATGGCTGAGCAGCTGCAAGGGGAGCCCTGGTTCCACGGGAAGCTGAGCCGG 1255 ||||||||||||||||||||||| ||||||||| ||||||| || ||||| || |||||| Sbjct 889 TCCATGTCCATGGCTGAGCAGCTCCAAGGGGAGTCCTGGTTTCATGGGAAACTCAGCCGG 948 Query 1256 -AGGGAGGCCGAGGCGCTGCTGCAGCTCAATGGTGACTTCTTGGTGCGAGAGAGCACGAC 1314 ||| || | || ||||||||||||||||| ||||||||||||||||||||||| || || Sbjct 949 CAGG-AGTCTGAAGCGCTGCTGCAGCTCAACGGTGACTTCTTGGTGCGAGAGAGTACAAC 1007 Query 1315 CACGCCTGGCCAGTATGTGCTCACTGGCCTGCAGAGTGGGCAGCCCAAGCACTTGCTGCT 1374 ||| ||||||||||| |||||||||||||||||||| |||||||||||||||||||| || Sbjct 1008 CACACCTGGCCAGTACGTGCTCACTGGCCTGCAGAGGGGGCAGCCCAAGCACTTGCTTCT 1067 Query 1375 GGTGGACCCTGAAGGTGTGGTTCGGACAAAGGATCACCGCTTTGAGAGTGTCAGTCACCT 1434 ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| Sbjct 1068 GGTGGACCCTGAAGGTGTGGTTCAGACAAAGGATCACCGCTTTGAGAGTGTCAGTCACCT 1127 Query 1435 GATCAGCTACCACATGGACAATCACTTGCCCATCATCTCTGCGGGCAGCGAACTGTGCCT 1494 ||||||||||||||||||||||||||| |||||||||||||| |||||||| ||| | || Sbjct 1128 GATCAGCTACCACATGGACAATCACTTACCCATCATCTCTGCAGGCAGCGAGCTGCGTCT 1187 Query 1495 ACAGCAACCCGTGGATCGGAAAGTGTGA 1522 ||||||||| |||||| |||||||||| Sbjct 1188 ACAGCAACCTTTGGATCTGAAAGTGTGA 1215 Score = 154 bits (83), Expect = 2e-33 Identities = 95/101 (94%), Gaps = 0/101 (0%) Strand=Plus/Plus Query 16 GGGGTGAAAGTTGGGGCGGTGACTTAAGCAGACAGTTGCGTGATCCGGAACCAGATCGGC 75 ||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||| Sbjct 32 GGGGTGAAAGTTGGGGCGGTGACTTAAGCAGACAGTTGCATGACCCGGAACCAGATCGGC 91 Query 76 CCGCGGTGCGGTGCGGAGACTCCATGAGACCCTGGACATGA 116 |||||||| | |||||||| |||||||||||||| |||||| Sbjct 92 CCGCGGTGTGATGCGGAGATTCCATGAGACCCTGTACATGA 132 >gb|AC003102.1|AC003102 Download subject sequence spanning the HSP Homo sapiens chromosome 17, clone hRPC.882_C_2, complete sequence Length=30980 Score = 767 bits (415), Expect = 0.0 Identities = 719/862 (83%), Gaps = 35/862 (4%) Strand=Plus/Minus Query 586 GGACACAGCTGAGTATGTTGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCA 645 ||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||| Sbjct 9854 GGACACAGCTGAGGATGTTGCCTACGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCA 9795 Query 646 TATCCTGGAGTGTCCTGAAGGGCTTGCTCAGGATGTCATCAGCACCATCGGGCAGGCCTT 705 || ||||||||||| |||| | | | ||||||||||| |||||||| || |||||||| Sbjct 9794 CATTCTGGAGTGTCCCAAAGGCCCT-CCCAGGATGTCATTAGCACCATTGGCCAGGCCTT 9736 Query 706 TGAGTTGCGCTTCAAACAGTATCTCAGGAATCCA-CCGAAGCTGGTCACCCCCCATGACA 764 |||||| |||||||||| || |||| ||| ||| || || ||| ||| |||||| |||| Sbjct 9735 CGAGTTGTGCTTCAAACAATACCTCACGAACCCACCCCAA-CTGCTCA-CCCCCAAGACA 9678 Query 765 GGATGGCTGGCTTTGATGGCTCAGCTTGGGATGAGGAGGAAGAAGAGCCCCCTGACCATC 824 ||||||||||||||||||| |||||||||||||||||||| |||||||| ||||||||| Sbjct 9677 GGATGGCTGGCTTTGATGGATCAGCTTGGGATGAGGAGGAGGAAGAGCCACCTGACCATT 9618 Query 825 AGTACTACAATGACTTTCCAGGGAAGGAACCCCCTCTTGGTGG-GGTGGTAGATATGAGG 883 ||||||| |||||| | || ||||||||||| ||||||| || | ||||||| |||||| Sbjct 9617 AGTACTATAATGACGTCCCTGGGAAGGAACCTTCTCTTGG-GGAGTTGGTAGACATGAGG 9559 Query 884 CTTCGGG-A--AG--------G-GGCTGCTCGACCCACTCTGCCTAGTGCCCAGATGTCC 931 ||||||| | || | ||||||| ||||||||| || |||| | || || Sbjct 9558 CTTCGGGAAGGAGCCACTTCAGAGGCTGCTTGACCCACTCCACCCAGTGTCTGGACCCCC 9499 Query 932 AGCCACTTGGGAGCTACACTGCCTATAGGG-CAGCATGCTGCAGGAGA-CCATGAAGTCC 989 |||||||||||||||||||||||| | ||| ||| ||||| ||||| ||| ||||||| Sbjct 9498 AGCCACTTGGGAGCTACACTGCCTGT-GGGATAGCCTGCTGGGGGAGATCCA-GAAGTCC 9441 Query 990 GTAAACAGATGTTGCCTCCGCCGCCTTG-CC--CAGGCAGAGAACTCTTCGATGACCCCT 1046 | ||||||||| ||||| || || || || |||||||||| |||||| |||| | Sbjct 9440 GCAAACAGATGCCACCTCCACCACCCTGTCCAGCAGGCAGAGAGCTCTTCAATGA--TC- 9384 Query 1047 CCTATGTCAACATCCAGAATCTAGACAAGGCCCGGCAGGCTGGGGGTGGGGCTGGGCCCC 1106 ||||| ||||| ||||||| ||||||||||||||||| || | ||||| ||| |||||| Sbjct 9383 CCTATATCAACGTCCAGAACCTAGACAAGGCCCGGCAAGCAGAAGGTGGTGCTAGGCCCC 9324 Query 1107 CAAATCCTTCTC-TTAATGGCAGTGCACCCCGAGACCTTTTTGACATGAAGCCCTTTGAA 1165 | ||||| | | | ||| ||||||||||| | ||||| |||||||||||||||||| || Sbjct 9323 CCCATCCTGC-CATCAATCGCAGTGCACCCTGGGACCTCTTTGACATGAAGCCCTTTAAA 9265 Query 1166 GATGCACTTCGGGTGCCACCCCCACCGCAGTCCATGTCCATGGCTGAGCAGCTGCAAGGG 1225 ||||| ||| ||||||| ||||| || |||| | ||||||||||||||||| |||||| Sbjct 9264 GATGCTCTTTGGGTGCCTCCCCCTCCCCAGT-GGTTTCCATGGCTGAGCAGCTCCAAGGG 9206 Query 1226 GAGCCCTGGTTCCACGGGAAGCTGAGCCGGAGGGAGGCCGAGGCGCTGCTGCAGCTCAAT 1285 |||||||||||||||||||||||||||| | | ||||| ||||| ||||||||||| || Sbjct 9205 GAGCCCTGGTTCCACGGGAAGCTGAGCCAGCGAGAGGCTGAGGCATTGCTGCAGCTCCAT 9146 Query 1286 GGTGACTTCTTGGTGCGAGAGAGCACGACCACGCCTGGCCAGTATGTGCTCACTGGCCTG 1345 || |||||| ||||||| ||||||| ||||| | | |||||||||||| |||||| || Sbjct 9145 GGCGACTTCCTGGTGCGGGAGAGCATGACCAAG---G-CCAGTATGTGCTTACTGGCTTG 9090 Query 1346 CAGAGTGGGCAGCCCAAGCACTTGCTGCTGGTGGACCCTGAAGGTGTGGTTCGGACAAAG 1405 |||||||||| ||| |||||| |||| |||||||||||||||| ||||| |||||||| Sbjct 9089 CAGAGTGGGCTGCCTAAGCACCTGCTATTGGTGGACCCTGAAGGACTGGTTTGGACAAAG 9030 Query 1406 GATCACCGCTTTGAGAGTGTCA 1427 |||||| ||||||||||||||| Sbjct 9029 GATCACTGCTTTGAGAGTGTCA 9008 >dbj|AK182226.1| UniGene infoGene info Mus musculus cDNA, clone:Y0G0121E02, strand:plus, reference:ENSEMBL:Mouse-Transcript-ENST:ENSMUST00000039110, based on BLAT search Length=430 Score = 760 bits (411), Expect = 0.0 Identities = 422/427 (98%), Gaps = 4/427 (0%) Strand=Plus/Plus Query 585 CGGACACAGCTGAGTATGTTGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCC 644 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1 CGGACACAGCTGAGTATGTTGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCC 60 Query 645 ATATCCTGGAGTGTCCTGAAGGGCTTGCTCAGGATGTCATCAGCACCATCGGGCAGGCCT 704 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 61 ATATCCTGGAGTGTCCTGAAGGGCTTGCTCAGGATGTCATCAGCACCATCGGGCAGGCCT 120 Query 705 TTGAGTTGCGCTTCAAACAGTATCTCAGGAATCCACCGAAGCTGGTCACCCCCCATGACA 764 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 121 TTGAGTTGCGCTTCAAACAGTATCTCAGGAATCCACCGAAGCTGGTCACCCCCCATGACA 180 Query 765 GGATGGCTGGCTTTGATGGCTCAGCTTGGGATGAGGAGGAAGAAGAGCCCCCTGACCATC 824 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 181 GGATGGCTGGCTTTGATGGCTCAGCTTGGGATGAGGAGGAAGAAGAGCCCCCTGACCATC 240 Query 825 AGTACTACAATGACTTTCCAGGGAAGGAACCCCCTCTTGGTGGGGTGGTAGATATGAGGC 884 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 241 AGTACTACAATGACTTTCCAGGGAAGGAACCCCCTCTTGGTGGGGTGGTAGATATGAGGC 300 Query 885 TTCGGGAAGGGGCTGCTCGACCC-ACTCTGCCTAGTGCCCAGATGTCCAGCCACTTGGGA 943 ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| Sbjct 301 TTCGGGAAGGGGCTGCTCGACCCCACTCTGCCTAGTGCCCAGATGTCCAGCCACTTGGGA 360 Query 944 GCTACACTGCCTATAGGGCAGCATGCTGCAGGAGACCATGAAG-TCCGTAAACAGATGTT 1002 |||||||||||||||||| |||||||||||||||||||||||| || |||| |||||||| Sbjct 361 GCTACACTGCCTATAGGGNAGCATGCTGCAGGAGACCATGAAGCTC-GTAA-CAGATGTT 418 Query 1003 GCCTCCG 1009 ||||||| Sbjct 419 GCCTCCG 425 >dbj|AK190954.1| UniGene info Mus musculus cDNA, clone:Y1G0104F15, strand:plus, reference:ENSEMBL:Mouse-Transcript-ENST:ENSMUST00000039110, based on BLAT search Length=404 Score = 699 bits (378), Expect = 0.0 Identities = 394/403 (97%), Gaps = 0/403 (0%) Strand=Plus/Plus Query 2341 CGGGGAGGGGCAGGACTGGACCCATCTTGCTCAGTGCCTCCTGACCTCAATGCCTTTCCT 2400 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1 CGGGGAGGGGCAGGACTGGACCCATCTTGCTCAGTGCCTCCTGACCTCAATGCCTTTCCT 60 Query 2401 CCAAGGGGTCTGTATACATTTCTCAAGCCTGCTCCTCCCATGTTTGCATGTGTGTTATAG 2460 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 61 CCAAGGGGTCTGTATACATTTCTCAAGCCTGCTCCTCCCATGTTTGCATGTGTGTTATAG 120 Query 2461 TCTACAGCCAAAGTATAGCCCTCACTGTAACCCCATCCTGCCTCCCTCCTTTGGGATAGG 2520 ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| Sbjct 121 TCTACAGCCAAAGTATAGCCCTCACTGTAACCCCATCCTGCCTCCCTCCTTTGCGATAGG 180 Query 2521 TGTGTGCGTCTGACTTGGGCCTCCAGGGTGTGTACAGTCAGTGTGGGTTTTGTGGAGGCA 2580 ||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||| Sbjct 181 TGTGTGCGTCTGANTTGGGCCTCCAGGGTGTGTACAGTCAGTGTGGGTTTGGTGGAGGCA 240 Query 2581 ATAAGACTGAAGCAGTAGACAATCCCCAATACCATTTGCAGGTCTGGAACTGCACTCTCT 2640 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 241 ATAAGACTGAAGCAGTAGACAATCCCCAATACCATTTGCAGGTCTGGAACTGCACTCTCT 300 Query 2641 TTTTTAAAAAACATGTATACATTTTAGGGCTGTAGATTTATTTTCCTGGTTTTGTTTTTC 2700 |||||||||||||||||||||||||||||||||| ||| |||||||||| |||||||||| Sbjct 301 TTTTTAAAAAACATGTATACATTTTAGGGCTGTACATTCATTTTCCTGGCTTTGTTTTTC 360 Query 2701 ATTGCTGACTTTTGAGCACAGAATTATGATAATCAATTACATT 2743 || ||||||||| |||||||| ||||||||||||||||||||| Sbjct 361 ATCGCTGACTTTNGAGCACAGGATTATGATAATCAATTACATT 403 >dbj|AK195140.1| UniGene info Mus musculus cDNA, clone:Y1G0117I05, strand:plus, reference:ENSEMBL:Mouse-Transcript-ENST:ENSMUST00000039110, based on BLAT search Length=391 Score = 697 bits (377), Expect = 0.0 Identities = 386/391 (98%), Gaps = 0/391 (0%) Strand=Plus/Plus Query 2341 CGGGGAGGGGCAGGACTGGACCCATCTTGCTCAGTGCCTCCTGACCTCAATGCCTTTCCT 2400 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1 CGGGGAGGGGCAGGACTGGACCCATCTTGCTCAGTGCCTCCTGACCTCAATGCCTTTCCT 60 Query 2401 CCAAGGGGTCTGTATACATTTCTCAAGCCTGCTCCTCCCATGTTTGCATGTGTGTTATAG 2460 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 61 CCAAGGGGTCTGTATACATTTCTCAAGCCTGCTCCTCCCATGTTTGCATGTGTGTTATAG 120 Query 2461 TCTACAGCCAAAGTATAGCCCTCACTGTAACCCCATCCTGCCTCCCTCCTTTGGGATAGG 2520 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 121 TCTACAGCCAAAGTATAGCCCTCACTGTAACCCCATCCTGCCTCCCTCCTTTGGGATAGG 180 Query 2521 TGTGTGCGTCTGACTTGGGCCTCCAGGGTGTGTACAGTCAGTGTGGGTTTTGTGGAGGCA 2580 |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| Sbjct 181 TGTGTGCGTCTGACTTGGGCCTCCAGGGTGTGTACAGTCAGTGTGGGTTTGGTGGAGGCA 240 Query 2581 ATAAGACTGAAGCAGTAGACAATCCCCAATACCATTTGCAGGTCTGGAACTGCACTCTCT 2640 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 241 ATAAGACTGAAGCAGTAGACAATCCCCAATACCATTTGCAGGTCTGGAACTGCACTCTCT 300 Query 2641 TTTTTAAAAAACATGTATACATTTTAGGGCTGTAGATTTATTTTCCTGGTTTTGTTTTTC 2700 |||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||| Sbjct 301 TTTTTAAAAAACATGTATACATTTCAGGGCTGTAGATTTATTTTCCTGGTTTGGTTTTTC 360 Query 2701 ATTGCTGACTTTTGAGCACAGAATTATGATA 2731 || ||||||||| |||||||||||||||||| Sbjct 361 ATGGCTGACTTTNGAGCACAGAATTATGATA 391 >dbj|AK194449.1| UniGene info Mus musculus cDNA, clone:Y1G0115F22, strand:minus, reference:ENSEMBL:Mouse-Transcript-ENST:ENSMUST00000039110, based on BLAT search Length=385 Score = 695 bits (376), Expect = 0.0 Identities = 382/385 (99%), Gaps = 0/385 (0%) Strand=Plus/Plus Query 1537 TCCAACAGGATGCTCTCCATTTCCGTCTCCCGTATTCTCTAACTTGTGGGACCTCTGTTT 1596 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1 TCCAACAGGATGCTCTCCATTTCCGTCTCCCGTATTCTCTAACTTGTGGGACCTCTGTTT 60 Query 1597 TGTGGGTCTGGCCTTGGGTGGGAACTGGGAGCAACGAGGACATGGGTTTAGTGCCCACTT 1656 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 61 TGTGGGTCTGGCCTTGGGTGGGAACTGGGAGCAACGAGGACATGGGTTTAGTGCCCACTT 120 Query 1657 GAGAGAGAGAAAAAGAGGGTTTCAGTAAGGAGCCTGGGGTAGCATCCTGCCTCTGGCCAA 1716 ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 121 GAGGGAGAGAAAAAGAGGGTTTCAGTAAGGAGCCTGGGGTAGCATCCTGCCTCTGGCCAA 180 Query 1717 ACTTCACCAAAGTATTAATGTGCAGAGTGGTCCCTTGTCTGGGCCTTGCCTGTGCCAACC 1776 ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| Sbjct 181 ACTTCACCAAAGTATTAATGTGCAGAGTGGTCCCTCGTCTGGGCCTTGCCTGTGCCAACC 240 Query 1777 TGATGCCCTTcccccccAAAGGGTGGGTTCTTATAATGGAAAATGCCCTGTGATGATAGG 1836 ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Sbjct 241 TGATGCCCTTCCCCCCCGAAGGGTGGGTTCTTATAATGGAAAATGCCCTGTGATGATAGG 300 Query 1837 CCCAGTGGAGCAACTGCCCTTTGGGGGAAGGGAAATAATTATACCTCTGGTTTACTCCTG 1896 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 301 CCCAGTGGAGCAACTGCCCTTTGGGGGAAGGGAAATAATTATACCTCTGGTTTACTCCTG 360 Query 1897 GGTCTTCAGGGTACCCCAGATCCCG 1921 ||||||||||||||||||||||||| Sbjct 361 GGTCTTCAGGGTACCCCAGATCCCG 385 >dbj|AK199216.1| UniGene infoGene info Mus musculus cDNA, clone:Y1G0130I08, strand:plus, reference:ENSEMBL:Mouse-Transcript-ENST:ENSMUST00000039110, based on BLAT search Length=389 Score = 693 bits (375), Expect = 0.0 Identities = 385/389 (98%), Gaps = 3/389 (0%) Strand=Plus/Plus Query 1476 CGGGCAGCGAACTGTGCCTACAGCAACCCGTGGATCGGAAAGTGTGATCCTTCTCAGCTT 1535 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1 CGGGCAGCGAACTGTGCCTACAGCAACCCGTGGATCGGAAAGTGTGATCCTTCTCAGCTT 60 Query 1536 CTCCAACAGGATGCTCTCCATTTCCGTCTCCCGTATTCTCTAACTTGTGGGACCTCTGTT 1595 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 61 CTCCAACAGGATGCTCTCCATTTCCGTCTCCCGTATTCTCTAACTTGTGGGACCTCTGTT 120 Query 1596 TTGTGGGTCTGGCCTTGGGTGGGAACTGGGAGCAACGAGGACATGGGTTTAGTGCCCACT 1655 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 121 TTGTGGGTCTGGCCTTGGGTGGGAACTGGGAGCAACGAGGACATGGGTTTAGTGCCCACT 180 Query 1656 TGAGAGAGAGAAAAAGAGGGTTTCAGTAAGGAGCC-TGGGGTAGCATCCTGCCTCTGGCC 1714 ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||| Sbjct 181 TGAGAGAGAGAAAAAGAGGGTTTCAGTAAGGAGCCCTGGGGTACCATCCTGCCTCTGGCC 240 Query 1715 AAACTTCACCAAAGTATTAATGTGCAGAGTGGTCCCTTGTCTGGGCCTTGCC-TGTGCCA 1773 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| Sbjct 241 AAACTTCACCAAAGTATTAATGTGCAGAGTGGTCCCTTGTCTGGGCCTTGCCCTGTGCCA 300 Query 1774 ACCTGATGCCC-TTcccccccAAAGGGTGGGTTCTTATAATGGAAAATGCCCTGTGATGA 1832 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 301 ACCTGATGCCCCTTCCCCCCCAAAGGGTGGGTTCTTATAATGGAAAATGCCCTGTGATGA 360 Query 1833 TAGGCCCAGTGGAGCAACTGCCCTTTGGG 1861 ||||||||||||||||||||||||||||| Sbjct 361 TAGGCCCAGTGGAGCAACTGCCCTTTGGG 389 >dbj|D83015.1| UniGene infoGeoGene info Rattus norvegicus shc mRNA for shc transforming protein, partial cds Length=416 Score = 691 bits (374), Expect = 0.0 Identities = 402/416 (96%), Gaps = 0/416 (0%) Strand=Plus/Plus Query 227 CTGCATCCCAACGACAAAGTCATGGGACCTGGGGTTTCCTACTTGGTTCGGTACATGGGC 286 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1 CTGCATCCCAACGACAAAGTCATGGGACCTGGGGTTTCCTACTTGGTTCGGTACATGGGT 60 Query 287 TGTGTGGAGGTCTTACAGTCAATGCGAGCCCTTGACTTCAATACCCGGACTCAGGTCACC 346 || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 61 TGCGTGGAGGTCTTACAGTCAATGCGAGCCCTTGACTTCAATACCCGGACTCAGGTCACC 120 Query 347 AGGGAGGCCATCAGTTTGGTGTGTGAAGCTGTGCCTGGTGCCAAAGGGGCGACAAGGAGG 406 |||||||| ||||||||||||||||||||||||||||||||||||||||| || |||||| Sbjct 121 AGGGAGGCTATCAGTTTGGTGTGTGAAGCTGTGCCTGGTGCCAAAGGGGCAACGAGGAGG 180 Query 407 AGAAAGCCTTGTAGCCGCCCACTCAGCTCCATCCTGGGGAGGAGTAACCTGAAGTTTGCT 466 |||||||| || ||||||||||||||||| |||||||| ||||||||||||||||||||| Sbjct 181 AGAAAGCCCTGCAGCCGCCCACTCAGCTCTATCCTGGGAAGGAGTAACCTGAAGTTTGCT 240 Query 467 GGAATGCCAATCACTCTCACTGTGTCTACCAGCAGCCTTAACCTCATGGCAGCCGACTGC 526 |||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||| Sbjct 241 GGAATGCCGATCACTCTCACTGTGTCTACCAGCAGCCTTAACCTCATGGCAGCAGACTGC 300 Query 527 AAACAGATCATTGCCAACCATCACATGCAATCTATCTCTTTCGCGTCCGGTGGGGATCCG 586 |||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||| Sbjct 301 AAACAGATCATTGCCAACCATCACATGCAATCTATCTCATTCGCGTCTGGTGGGGATCCG 360 Query 587 GACACAGCTGAGTATGTTGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTG 642 |||||||||||||| ||||||||||||||||||||||||||||||||||||||||| Sbjct 361 GACACAGCTGAGTACGTTGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTG 416 >ref|XM_860059.1| UniGene infoGene info PREDICTED: Canis familiaris similar to src homology 2 domain-containing transforming protein C, transcript variant 3 (LOC490439), mRNA Length=780 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 689 bits (373), Expect = 0.0 Identities = 472/520 (90%), Gaps = 6/520 (1%) Strand=Plus/Plus Query 16 GGGGTGAAAGTTGGGGCGGTGACTTAAGCAGACAGTTGCGTGATCCGGAACCAGATCG-G 74 |||| ||||||||| ||| ||| |||| || |||| |||||||||||||||| |||| | Sbjct 81 GGGGAGAAAGTTGGAACGGCGACCTAAGGAGGCAGTGGCGTGATCCGGAACCAAATCGAG 140 Query 75 CCCGCGGTGCGGTGCGGAGACTCCATGAGACCCTGGACATGAACAAGCTGAGTGGAGGCG 134 |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| | Sbjct 141 -CCGCGGTGCGGTGCGGAGACTCCATGAGGCCCTGGACATGAACAAGCTGAGTGGAGGAG 199 Query 135 GCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCTGGGGGGCGAGGAGTGGACCAGACACG 194 ||||||||||||| ||||| ||||||||||||||||||||||||||||||||| | |||| Sbjct 200 GCGGGCGCAGGACGCGGGTGGAAGGGGGCCAGCTGGGGGGCGAGGAGTGGACCCGCCACG 259 Query 195 GGAGCTTTGTCAATAAGCCCACACGAGGCTGGCTGCATCCCAACGACAAAGTCATGGGAC 254 ||||||| ||||||||||||||||| |||||||| ||||||||||||||||||||||||| Sbjct 260 GGAGCTTCGTCAATAAGCCCACACGGGGCTGGCTACATCCCAACGACAAAGTCATGGGAC 319 Query 255 CTGGGGTTTCCTACTTGGTTCGGTACATGGGCTGTGTGGAGGTCTTACAGTCAATGCGAG 314 |||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| | Sbjct 320 CTGGGGTTTCCTACTTGGTTCGGTACATGGGCTGTGTGGAGGTCCTGCAGTCAATGCGTG 379 Query 315 CCCTTG-ACTTCAATACCCGGACTCAGGTCACCAGGGAGGCCATCAGTTTGGTGTGTGAA 373 || ||| ||||||| ||||| || || ||||||||||||||||||||| |||||||||| Sbjct 380 CC-TTGGACTTCAACACCCGCACCCAAGTCACCAGGGAGGCCATCAGTCTGGTGTGTGAG 438 Query 374 GCTGTGCCTGGTGCCAAAGGGGCGACAAGGAGGAGAAAGCCTTGTAGCCGCCCACTCAGC 433 |||||||| |||||||| ||||| ||||| ||||||||||| ||||||||||||||||| Sbjct 439 GCTGTGCCCGGTGCCAAGGGGGCTACAAGAAGGAGAAAGCCCTGTAGCCGCCCACTCAG- 497 Query 434 T-CCATCCTGGGGAGGAGTAACCTGAAGTTTGCTGGAATGCCAATCACTCTCACTGTGTC 492 | ||||||||||||||||||| ||||| ||||| |||||||||||||||||||| || || Sbjct 498 TGCCATCCTGGGGAGGAGTAATCTGAAATTTGCGGGAATGCCAATCACTCTCACCGTCTC 557 Query 493 TACCAGCAGCCTTAACCTCATGGCAGCCGACTGCAAACAG 532 ||||||||||| ||||| ||||| || |||||||||||| Sbjct 558 CACCAGCAGCCTCAACCTTATGGCCGCAGACTGCAAACAG 597 Score = 257 bits (139), Expect = 2e-64 Identities = 167/181 (92%), Gaps = 0/181 (0%) Strand=Plus/Plus Query 586 GGACACAGCTGAGTATGTTGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCA 645 ||||||||||||||| || |||||||||||||||||||| ||||||||||||||||| || Sbjct 597 GGACACAGCTGAGTACGTCGCCTATGTTGCCAAAGACCCGGTGAATCAGAGAGCCTGTCA 656 Query 646 TATCCTGGAGTGTCCTGAAGGGCTTGCTCAGGATGTCATCAGCACCATCGGGCAGGCCTT 705 ||||||||| ||||| ||||||||||||||||||||||||||||||||||| |||||||| Sbjct 657 TATCCTGGAATGTCCCGAAGGGCTTGCTCAGGATGTCATCAGCACCATCGGCCAGGCCTT 716 Query 706 TGAGTTGCGCTTCAAACAGTATCTCAGGAATCCACCGAAGCTGGTCACCCCCCATGACAG 765 ||||||||||||||||| || |||||||| || || |||||||||||||| |||||||| Sbjct 717 CGAGTTGCGCTTCAAACAATACCTCAGGAACCCGCCCAAGCTGGTCACCCCTCATGACAG 776 Query 766 G 766 | Sbjct 777 G 777 >ref|NM_001090464.1| Gene info Xenopus laevis src homology collagen (Shc1), mRNA ref|NM_001090463.1| Gene info Xenopus laevis src homology collagen (Shc1), mRNA gb|AY027793.1| UniGene infoGeoGene info Xenopus laevis src homology collagen mRNA, complete cds Length=3979 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 647 bits (350), Expect = 0.0 Identities = 632/766 (82%), Gaps = 28/766 (3%) Strand=Plus/Plus Query 149 CGGGTAGAAGGGGGCCAGCTGGGGGGCGAGGAGTGGACCAGACACGGGAGCTTTGTCAAT 208 ||||| ||||| || || |||| || || || ||||||||||||||||||||||||||| Sbjct 155 CGGGTGGAAGGAGGACAACTGGCTGGTGATGAATGGACCAGACACGGGAGCTTTGTCAAT 214 Query 209 AAGCCCACACGAGGCTGGCTGCATCCCAACGACAAAGTCATGGGACCTGGGGTTTCCTA- 267 || ||||| |||||||||||||| ||| ||||||| |||||||| || || ||| |||| Sbjct 215 AAACCCACCCGAGGCTGGCTGCACCCCGACGACAAGGTCATGGGCCCCGGAGTTCCCTAT 274 Query 268 CTTGGTTC-GGTACATGGGCTGTGTGGAGGT-CTTACAGTCAATGCGAGCCCTTG-ACTT 324 || ||| | |||||||||| ||||||||||| || ||||||||| ||||| ||| | || Sbjct 275 CT-GGT-CAGGTACATGGGATGTGTGGAGGTTCTG-CAGTCAATGAGAGCC-TTGGATTT 330 Query 325 CAATACCCGGACTCAGGTCACCAGGGAGGCCATCAGTTTGGTGTGTGAAGCTGTGCCTGG 384 ||| |||||||| || ||||| ||||| ||||| ||| |||||||||| ||||| || || Sbjct 331 CAACACCCGGACACAAGTCACAAGGGAAGCCATAAGTCTGGTGTGTGATGCTGTCCCAGG 390 Query 385 TGCCAAAGGGGCGACAA-G-GA-GGAGAAAGCCTTGTAGCCGCCCACTCAG-CTCCATCC 440 || ||||||| | ||| | || |||||||| |||| | ||| | || | |||||||| Sbjct 391 AGC-AAAGGGG-G-CAATGCGAAGGAGAAAGACTTGCGGACGCTC-CTTAAACTCCATCC 446 Query 441 TGGGGAGGAGTAACCTGAAGTTTGCTGGAATGCCAATCACTCTCACTGTGTCTACCAGCA 500 | |||| ||| |||||||||||||| || ||||||||||| || || ||||| || || | Sbjct 447 TAGGGAAGAGCAACCTGAAGTTTGCAGGCATGCCAATCACACTGACCGTGTCCACTAGTA 506 Query 501 GCCTTAACCTCATGGCAGCCGACTGCAAACAGATCATTGCCAACCATCACATGCAATCTA 560 |||| ||||||||||| ||||||||||||||||||| |||||||| |||||||| || | Sbjct 507 GCCTCAACCTCATGGCTTCCGACTGCAAACAGATCATCGCCAACCACCACATGCAGTCAA 566 Query 561 TCTCTTTCGCGTCCGGTGGG-GATCCGGACACAGCTGAGTATGTTGCCTATGTTGCCAAA 619 | ||||| || || || ||| |||||||||||||||||||||||||| ||||| |||||| Sbjct 567 TATCTTTTGCTTCTGG-GGGAGATCCGGACACAGCTGAGTATGTTGCGTATGTGGCCAAA 625 Query 620 GACCCTGTGAATCAGAGAGCCTGCCATATCCTGGAGTGTCCTGAAGGGC-TTGCTCAGGA 678 || || || ||||||||||||||||||||| ||||||| || || |||| |||||||||| Sbjct 626 GATCCAGTCAATCAGAGAGCCTGCCATATCTTGGAGTGCCCAGA-GGGCCTTGCTCAGGA 684 Query 679 TGTCATCAGCACCATCGGGCAGGCCTTTGAG-TTGCGCTTCAAACAGTATCTCAGGAATC 737 || |||||||| || || ||||| ||||| || |||||||| || || |||| |||| Sbjct 685 CGTGATCAGCACAATAGGACAGGCTTTTGAACTT-CGCTTCAAGCAATACCTCAAAAATC 743 Query 738 CACCGAAGCTGGTCACCCCCCATGACAGGATGGCTGGCTTTGATGGCTCAGCTTGGGATG 797 | || || |||||||||||||||||||| |||||||| |||||||| || || ||||| | Sbjct 744 CCCCCAAACTGGTCACCCCCCATGACAGAATGGCTGGTTTTGATGGGTCGGCGTGGGACG 803 Query 798 AGGAGGAAGAAGAGCCCCCTGACCAT-CAGTACTACAATGACTTTCC-AGGGAAGGAACC 855 |||| || || |||| ||| ||||| | || |||||||| ||||| |||||| || || Sbjct 804 AGGAAGAGGAGGAGCTCCCAGACCACGCC-TATTACAATGA-TTTCCCAGGGAAAGAGCC 861 Query 856 CCCTCTTGGTGGG-GTGGTAGATATGAGGCTTCGGGAAGGGGCTGC 900 |||| |||| ||| || |||||||||||||| || || |||||||| Sbjct 862 CCCTATTGG-GGGAGTAGTAGATATGAGGCTGCGAGATGGGGCTGC 906 Score = 274 bits (148), Expect = 2e-69 Identities = 255/306 (83%), Gaps = 10/306 (3%) Strand=Plus/Plus Query 1214 CAGCTGCAAG-GGGAGCCCTGGTTCCACGGG-AAGCTGAGCCGGAGGGAGGCCG-AGGCG 1270 |||||| ||| |||||||||||| ||| ||| ||| ||||||| | ||| || | | | | Sbjct 1214 CAGCTG-AAGCGGGAGCCCTGGTACCA-GGGTAAGATGAGCCGCAAGGAAGCAGAAAG-G 1270 Query 1271 CTGCTG-CAGCTCAATGGTGACTTCTTGGTGCGAGAGAGCACGACCACGCCTGGCCAGTA 1329 |||||| || | ||||| |||||| ||||||| ||||| || ||||| || || || || Sbjct 1271 CTGCTGAAAG-TGAATGGAGACTTCCTGGTGCGGGAGAGTACCACCACCCCGGGGCAATA 1329 Query 1330 TGTGCTCACTGGCCTGCAGAGTGGGCAGCCCAAGCACTTGCTGCTGGTGGACCCTGAAGG 1389 || || || ||||||||| |||| |||||||| ||||||||||| |||||||||||||| Sbjct 1330 CGTACTGACCGGCCTGCAGTGTGGCCAGCCCAAACACTTGCTGCTTGTGGACCCTGAAGG 1389 Query 1390 TGTGGTTCGGA-CAAAGGATCACCGCTTTGAGAGTGTCAGTCACCTGATCAGCTACCACA 1448 |||||||| | |||| || ||| | ||||||||||||||||||||||||||||| |||| Sbjct 1390 GGTGGTTCGAACCAAA-GACCACAGGTTTGAGAGTGTCAGTCACCTGATCAGCTATCACA 1448 Query 1449 TGGACAATCACTTGCCCATCATCTCTGCGGGCAGCGAACTGTGCCTACAGCAACCCGTGG 1508 ||||||||||||||||||||||||| || ||||| || || ||||| ||||| || |||| Sbjct 1449 TGGACAATCACTTGCCCATCATCTCCGCTGGCAGTGAGCTCTGCCTTCAGCAGCCGGTGG 1508 Query 1509 ATCGGA 1514 | |||| Sbjct 1509 AGCGGA 1514 >gb|BC089178.1| UniGene infoGene info Xenopus laevis src homology collagen, mRNA (cDNA clone MGC:98812 IMAGE:3400241), complete cds Length=3909 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 647 bits (350), Expect = 0.0 Identities = 632/766 (82%), Gaps = 28/766 (3%) Strand=Plus/Plus Query 149 CGGGTAGAAGGGGGCCAGCTGGGGGGCGAGGAGTGGACCAGACACGGGAGCTTTGTCAAT 208 ||||| ||||| || || |||| || || || ||||||||||||||||||||||||||| Sbjct 90 CGGGTGGAAGGAGGACAACTGGCTGGTGATGAATGGACCAGACACGGGAGCTTTGTCAAT 149 Query 209 AAGCCCACACGAGGCTGGCTGCATCCCAACGACAAAGTCATGGGACCTGGGGTTTCCTA- 267 || ||||| |||||||||||||| ||| ||||||| |||||||| || || ||| |||| Sbjct 150 AAACCCACCCGAGGCTGGCTGCACCCCGACGACAAGGTCATGGGCCCCGGAGTTCCCTAT 209 Query 268 CTTGGTTC-GGTACATGGGCTGTGTGGAGGT-CTTACAGTCAATGCGAGCCCTTG-ACTT 324 || ||| | |||||||||| ||||||||||| || ||||||||| ||||| ||| | || Sbjct 210 CT-GGT-CAGGTACATGGGATGTGTGGAGGTTCTG-CAGTCAATGAGAGCC-TTGGATTT 265 Query 325 CAATACCCGGACTCAGGTCACCAGGGAGGCCATCAGTTTGGTGTGTGAAGCTGTGCCTGG 384 ||| |||||||| || ||||| ||||| ||||| ||| |||||||||| ||||| || || Sbjct 266 CAACACCCGGACACAAGTCACAAGGGAAGCCATAAGTCTGGTGTGTGATGCTGTCCCAGG 325 Query 385 TGCCAAAGGGGCGACAA-G-GA-GGAGAAAGCCTTGTAGCCGCCCACTCAG-CTCCATCC 440 || ||||||| | ||| | || |||||||| |||| | ||| | || | |||||||| Sbjct 326 AGC-AAAGGGG-G-CAATGCGAAGGAGAAAGACTTGCGGACGCTC-CTTAAACTCCATCC 381 Query 441 TGGGGAGGAGTAACCTGAAGTTTGCTGGAATGCCAATCACTCTCACTGTGTCTACCAGCA 500 | |||| ||| |||||||||||||| || ||||||||||| || || ||||| || || | Sbjct 382 TAGGGAAGAGCAACCTGAAGTTTGCAGGCATGCCAATCACACTGACCGTGTCCACTAGTA 441 Query 501 GCCTTAACCTCATGGCAGCCGACTGCAAACAGATCATTGCCAACCATCACATGCAATCTA 560 |||| ||||||||||| ||||||||||||||||||| |||||||| |||||||| || | Sbjct 442 GCCTCAACCTCATGGCTTCCGACTGCAAACAGATCATCGCCAACCACCACATGCAGTCAA 501 Query 561 TCTCTTTCGCGTCCGGTGGG-GATCCGGACACAGCTGAGTATGTTGCCTATGTTGCCAAA 619 | ||||| || || || ||| |||||||||||||||||||||||||| ||||| |||||| Sbjct 502 TATCTTTTGCTTCTGG-GGGAGATCCGGACACAGCTGAGTATGTTGCGTATGTGGCCAAA 560 Query 620 GACCCTGTGAATCAGAGAGCCTGCCATATCCTGGAGTGTCCTGAAGGGC-TTGCTCAGGA 678 || || || ||||||||||||||||||||| ||||||| || || |||| |||||||||| Sbjct 561 GATCCAGTCAATCAGAGAGCCTGCCATATCTTGGAGTGCCCAGA-GGGCCTTGCTCAGGA 619 Query 679 TGTCATCAGCACCATCGGGCAGGCCTTTGAG-TTGCGCTTCAAACAGTATCTCAGGAATC 737 || |||||||| || || ||||| ||||| || |||||||| || || |||| |||| Sbjct 620 CGTGATCAGCACAATAGGACAGGCTTTTGAACTT-CGCTTCAAGCAATACCTCAAAAATC 678 Query 738 CACCGAAGCTGGTCACCCCCCATGACAGGATGGCTGGCTTTGATGGCTCAGCTTGGGATG 797 | || || |||||||||||||||||||| |||||||| |||||||| || || ||||| | Sbjct 679 CCCCCAAACTGGTCACCCCCCATGACAGAATGGCTGGTTTTGATGGGTCGGCGTGGGACG 738 Query 798 AGGAGGAAGAAGAGCCCCCTGACCAT-CAGTACTACAATGACTTTCC-AGGGAAGGAACC 855 |||| || || |||| ||| ||||| | || |||||||| ||||| |||||| || || Sbjct 739 AGGAAGAGGAGGAGCTCCCAGACCACGCC-TATTACAATGA-TTTCCCAGGGAAAGAGCC 796 Query 856 CCCTCTTGGTGGG-GTGGTAGATATGAGGCTTCGGGAAGGGGCTGC 900 |||| |||| ||| || |||||||||||||| || || |||||||| Sbjct 797 CCCTATTGG-GGGAGTAGTAGATATGAGGCTGCGAGATGGGGCTGC 841 Score = 279 bits (151), Expect = 3e-71 Identities = 256/306 (83%), Gaps = 10/306 (3%) Strand=Plus/Plus Query 1214 CAGCTGCAAG-GGGAGCCCTGGTTCCACGGG-AAGCTGAGCCGGAGGGAGGCCG-AGGCG 1270 |||||| ||| |||||||||||| ||| ||| ||| ||||||| | ||| || | | | | Sbjct 1149 CAGCTG-AAGCGGGAGCCCTGGTACCA-GGGTAAGATGAGCCGCAAGGAAGCAGAAAG-G 1205 Query 1271 CTGCTG-CAGCTCAATGGTGACTTCTTGGTGCGAGAGAGCACGACCACGCCTGGCCAGTA 1329 |||||| || | ||||| |||||| ||||||| ||||| || ||||| || || || || Sbjct 1206 CTGCTGAAAG-TGAATGGAGACTTCCTGGTGCGGGAGAGTACCACCACCCCGGGGCAATA 1264 Query 1330 TGTGCTCACTGGCCTGCAGAGTGGGCAGCCCAAGCACTTGCTGCTGGTGGACCCTGAAGG 1389 || || |||||||||||| |||| |||||||| ||||||||||| |||||||||||||| Sbjct 1265 CGTACTGACTGGCCTGCAGTGTGGCCAGCCCAAACACTTGCTGCTTGTGGACCCTGAAGG 1324 Query 1390 TGTGGTTCGGA-CAAAGGATCACCGCTTTGAGAGTGTCAGTCACCTGATCAGCTACCACA 1448 |||||||| | |||| || ||| | ||||||||||||||||||||||||||||| |||| Sbjct 1325 GGTGGTTCGAACCAAA-GACCACAGGTTTGAGAGTGTCAGTCACCTGATCAGCTATCACA 1383 Query 1449 TGGACAATCACTTGCCCATCATCTCTGCGGGCAGCGAACTGTGCCTACAGCAACCCGTGG 1508 ||||||||||||||||||||||||| || ||||| || || ||||| ||||| || |||| Sbjct 1384 TGGACAATCACTTGCCCATCATCTCCGCTGGCAGTGAGCTCTGCCTTCAGCAGCCGGTGG 1443 Query 1509 ATCGGA 1514 | |||| Sbjct 1444 AGCGGA 1449 >gb|DQ125497.1| UniGene infoGene info Bos taurus src homology 2 domain-containing transforming protein C1 mRNA, partial cds Length=454 Score = 632 bits (342), Expect = 2e-177 Identities = 407/439 (92%), Gaps = 2/439 (0%) Strand=Plus/Plus Query 127 TGGAGGCGGCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCTGGGGGGCGAGGAGTGGAC 186 ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| Sbjct 15 TGGAGGCGGCGGGCGCAGGACTCGGGTGGAAGGGGGCCAGCTGGGGGGCGAGGAGTGGAC 74 Query 187 -CAGACACGGGAGCTTTGTCAATAAGCCCACACGAGGCTGGCTGCATCCCAACGACAAAG 245 | | |||||||||||||||||||||||||| || ||||||||||||||||||||||||| Sbjct 75 TC-GCCACGGGAGCTTTGTCAATAAGCCCACGCGGGGCTGGCTGCATCCCAACGACAAAG 133 Query 246 TCATGGGACCTGGGGTTTCCTACTTGGTTCGGTACATGGGCTGTGTGGAGGTCTTACAGT 305 |||||||||| |||||||||||||||||||||||||||||||||||||||||| | |||| Sbjct 134 TCATGGGACCCGGGGTTTCCTACTTGGTTCGGTACATGGGCTGTGTGGAGGTCCTGCAGT 193 Query 306 CAATGCGAGCCCTTGACTTCAATACCCGGACTCAGGTCACCAGGGAGGCCATCAGTTTGG 365 ||||||| |||||||||||||| ||||||||||||||||||||||||||||||||| ||| Sbjct 194 CAATGCGCGCCCTTGACTTCAACACCCGGACTCAGGTCACCAGGGAGGCCATCAGTCTGG 253 Query 366 TGTGTGAAGCTGTGCCTGGTGCCAAAGGGGCGACAAGGAGGAGAAAGCCTTGTAGCCGCC 425 ||||||| |||||||| ||||| || ||||| ||||||||||||||||| |||||||| | Sbjct 254 TGTGTGAGGCTGTGCCGGGTGCTAAGGGGGCAACAAGGAGGAGAAAGCCCTGTAGCCGTC 313 Query 426 CACTCAGCTCCATCCTGGGGAGGAGTAACCTGAAGTTTGCTGGAATGCCAATCACTCTCA 485 ||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| | Sbjct 314 CACTCAGCTCCATTCTGGGGAGGAGTAACCTGAAATTTGCTGGAATGCCAATCACTCTGA 373 Query 486 CTGTGTCTACCAGCAGCCTTAACCTCATGGCAGCCGACTGCAAACAGATCATTGCCAACC 545 | || || ||||||||||| ||||||||||| || ||||||||||||||||| ||||||| Sbjct 374 CCGTCTCCACCAGCAGCCTCAACCTCATGGCCGCAGACTGCAAACAGATCATCGCCAACC 433 Query 546 ATCACATGCAATCTATCTC 564 | |||||||| || ||||| Sbjct 434 ACCACATGCAGTCCATCTC 452 >dbj|AK205229.1| UniGene infoGene info Mus musculus cDNA, clone:Y2G0101B02, strand:plus, reference:ENSEMBL:Mouse-Transcript-ENST:ENSMUST00000039110, based on BLAT search Length=335 Score = 610 bits (330), Expect = 1e-170 Identities = 333/335 (99%), Gaps = 0/335 (0%) Strand=Plus/Plus Query 1079 CGGCAGGCTGGGGGTGGGGCTGGGCCCCCAAATCCTTCTCTTAATGGCAGTGCACCCCGA 1138 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1 CGGCAGGCTGGGGGTGGGGCTGGGCCCCCAAATCCTTCTCTTAATGGCAGTGCACCCCGA 60 Query 1139 GACCTTTTTGACATGAAGCCCTTTGAAGATGCACTTCGGGTGCCACCCCCACCGCAGTCC 1198 |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| Sbjct 61 GACCTTTTTGACATGAAGCCCTTTGAAGATGCACTTCGGGTGCCACCCCCGCCGCAGTCC 120 Query 1199 ATGTCCATGGCTGAGCAGCTGCAAGGGGAGCCCTGGTTCCACGGGAAGCTGAGCCGGAGG 1258 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 121 ATGTCCATGGCTGAGCAGCTGCAAGGGGAGCCCTGGTTCCACGGGAAGCTGAGCCGGAGG 180 Query 1259 GAGGCCGAGGCGCTGCTGCAGCTCAATGGTGACTTCTTGGTGCGAGAGAGCACGACCACG 1318 |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| Sbjct 181 GAGGCCGAGGCGCTGCTGCAGCTCAATGGTGANTTCTTGGTGCGAGAGAGCACGACCACG 240 Query 1319 CCTGGCCAGTATGTGCTCACTGGCCTGCAGAGTGGGCAGCCCAAGCACTTGCTGCTGGTG 1378 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 241 CCTGGCCAGTATGTGCTCACTGGCCTGCAGAGTGGGCAGCCCAAGCACTTGCTGCTGGTG 300 Query 1379 GACCCTGAAGGTGTGGTTCGGACAAAGGATCACCG 1413 ||||||||||||||||||||||||||||||||||| Sbjct 301 GACCCTGAAGGTGTGGTTCGGACAAAGGATCACCG 335 >gb|AF440201.1|AF440201 Synthetic construct EGF-receptor reporter mRNA, complete cds Length=1761 Score = 507 bits (274), Expect = 1e-139 Identities = 276/277 (99%), Gaps = 0/277 (0%) Strand=Plus/Plus Query 1232 TGGTTCCACGGGAAGCTGAGCCGGAGGGAGGCCGAGGCGCTGCTGCAGCTCAATGGTGAC 1291 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 694 TGGTTCCACGGGAAGCTGAGCCGGAGGGAGGCCGAGGCGCTGCTGCAGCTCAATGGTGAC 753 Query 1292 TTCTTGGTGCGAGAGAGCACGACCACGCCTGGCCAGTATGTGCTCACTGGCCTGCAGAGT 1351 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 754 TTCTTGGTGCGAGAGAGCACGACCACGCCTGGCCAGTATGTGCTCACTGGCCTGCAGAGT 813 Query 1352 GGGCAGCCCAAGCACTTGCTGCTGGTGGACCCTGAAGGTGTGGTTCGGACAAAGGATCAC 1411 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 814 GGGCAGCCCAAGCACTTGCTGCTGGTGGACCCTGAAGGTGTGGTTCGGACAAAGGATCAC 873 Query 1412 CGCTTTGAGAGTGTCAGTCACCTGATCAGCTACCACATGGACAATCACTTGCCCATCATC 1471 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 874 CGCTTTGAGAGTGTCAGTCACCTGATCAGCTACCACATGGACAATCACTTGCCCATCATC 933 Query 1472 TCTGCGGGCAGCGAACTGTGCCTACAGCAACCCGTGG 1508 |||||||||||||||||||||||| |||||||||||| Sbjct 934 TCTGCGGGCAGCGAACTGTGCCTAGAGCAACCCGTGG 970 >dbj|AK203451.1| UniGene infoGene info Mus musculus cDNA, clone:Y1G0144O18, strand:minus, reference:ENSEMBL:Mouse-Transcript-ENST:ENSMUST00000039110, based on BLAT search Length=294 Score = 477 bits (258), Expect = 1e-130 Identities = 284/296 (95%), Gaps = 7/296 (2%) Strand=Plus/Plus Query 133 CGGC-GGGCGCAGGACTCGGG--TAGAA-GGGGG-CCAGCTGGGGGGCGAGGAGTGGACC 187 |||| |||||||||||||||| ||||| ||||| |||||||||||||||||||| |||| Sbjct 1 CGGCGGGGCGCAGGACTCGGGTTTAGAAGGGGGGNCCAGCTGGGGGGCGAGGAGT-GACC 59 Query 188 AGACACGGGAGCTTTGTCAATAAGCCCACACGAGGCTGGCTGCATCCCAACGACAAAGTC 247 | |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 60 ANACAC-GGAGCTTTGTCAATAAGCCCACACGAGGCTGGCTGCATCCCAACGACAAAGTC 118 Query 248 ATGGGACCTGGGGTTTCCTACTTGGTTCGGTACATGGGCTGTGTGGAGGTCTTACAGTCA 307 |||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||| Sbjct 119 ATGGGACCTGGGGTTTCCTACTTGGTTCGGTACATGGGCTGTTTGGAGGTCTTACANTCA 178 Query 308 ATGCGAGCCCTTGACTTCAATACCCGGACTCAGGTCACCAGGGAGGCCATCAGTTTGGTG 367 |||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||| Sbjct 179 ATGCGAGCCCTTGACTTCAATACCCGGACTCAGGTCACAAGGGAGGCCATCAATTTGGTG 238 Query 368 TGTGAAGCTGTGCCTGGTGCCAAAGGGGCGACAAGGAGGAGAAAGCCTTGTAGCCG 423 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 239 TGTGAAGCTGTGCCTGGTGCCAAAGGGGCGACAAGGAGGAGAAAGCCTTGTAGCCG 294 >dbj|AK036980.1| GeoGene info Mus musculus adult female vagina cDNA, RIKEN full-length enriched library, clone:9930032M20 product:src homology 2 domain-containing transforming protein C1, full insert sequence Length=2775 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 473 bits (256), Expect = 1e-129 Identities = 256/256 (100%), Gaps = 0/256 (0%) Strand=Plus/Plus Query 277 GTACATGGGCTGTGTGGAGGTCTTACAGTCAATGCGAGCCCTTGACTTCAATACCCGGAC 336 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2293 GTACATGGGCTGTGTGGAGGTCTTACAGTCAATGCGAGCCCTTGACTTCAATACCCGGAC 2352 Query 337 TCAGGTCACCAGGGAGGCCATCAGTTTGGTGTGTGAAGCTGTGCCTGGTGCCAAAGGGGC 396 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2353 TCAGGTCACCAGGGAGGCCATCAGTTTGGTGTGTGAAGCTGTGCCTGGTGCCAAAGGGGC 2412 Query 397 GACAAGGAGGAGAAAGCCTTGTAGCCGCCCACTCAGCTCCATCCTGGGGAGGAGTAACCT 456 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2413 GACAAGGAGGAGAAAGCCTTGTAGCCGCCCACTCAGCTCCATCCTGGGGAGGAGTAACCT 2472 Query 457 GAAGTTTGCTGGAATGCCAATCACTCTCACTGTGTCTACCAGCAGCCTTAACCTCATGGC 516 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2473 GAAGTTTGCTGGAATGCCAATCACTCTCACTGTGTCTACCAGCAGCCTTAACCTCATGGC 2532 Query 517 AGCCGACTGCAAACAG 532 |||||||||||||||| Sbjct 2533 AGCCGACTGCAAACAG 2548 Score = 313 bits (169), Expect = 3e-81 Identities = 169/169 (100%), Gaps = 0/169 (0%) Strand=Plus/Plus Query 109 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCT 168 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1546 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCT 1605 Query 169 GGGGGGCGAGGAGTGGACCAGACACGGGAGCTTTGTCAATAAGCCCACACGAGGCTGGCT 228 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1606 GGGGGGCGAGGAGTGGACCAGACACGGGAGCTTTGTCAATAAGCCCACACGAGGCTGGCT 1665 Query 229 GCATCCCAACGACAAAGTCATGGGACCTGGGGTTTCCTACTTGGTTCGG 277 ||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1666 GCATCCCAACGACAAAGTCATGGGACCTGGGGTTTCCTACTTGGTTCGG 1714 >dbj|AK195313.1| UniGene infoGene info Mus musculus cDNA, clone:Y1G0118B15, strand:minus, reference:ENSEMBL:Mouse-Transcript-ENST:ENSMUST00000039110, based on BLAT search Length=244 Score = 446 bits (241), Expect = 3e-121 Identities = 243/244 (99%), Gaps = 0/244 (0%) Strand=Plus/Plus Query 332 CGGACTCAGGTCACCAGGGAGGCCATCAGTTTGGTGTGTGAAGCTGTGCCTGGTGCCAAA 391 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1 CGGACTCAGGTCACCAGGGAGGCCATCAGTTTGGTGTGTGAAGCTGTGCCTGGTGCCAAA 60 Query 392 GGGGCGACAAGGAGGAGAAAGCCTTGTAGCCGCCCACTCAGCTCCATCCTGGGGAGGAGT 451 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || Sbjct 61 GGGGCGACAAGGAGGAGAAAGCCTTGTAGCCGCCCACTCAGCTCCATCCTGGGGAGGGGT 120 Query 452 AACCTGAAGTTTGCTGGAATGCCAATCACTCTCACTGTGTCTACCAGCAGCCTTAACCTC 511 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 121 AACCTGAAGTTTGCTGGAATGCCAATCACTCTCACTGTGTCTACCAGCAGCCTTAACCTC 180 Query 512 ATGGCAGCCGACTGCAAACAGATCATTGCCAACCATCACATGCAATCTATCTCTTTCGCG 571 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 181 ATGGCAGCCGACTGCAAACAGATCATTGCCAACCATCACATGCAATCTATCTCTTTCGCG 240 Query 572 TCCG 575 |||| Sbjct 241 TCCG 244 >dbj|AK211173.1| UniGene infoGene info Mus musculus cDNA, clone:Y2G0120O03, strand:minus, reference:ENSEMBL:Mouse-Transcript-ENST:ENSMUST00000039110, based on BLAT search Length=201 Score = 366 bits (198), Expect = 3e-97 Identities = 200/201 (99%), Gaps = 0/201 (0%) Strand=Plus/Plus Query 133 CGGCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCTGGGGGGCGAGGAGTGGACCAGACA 192 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1 CGGCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCTGGGGGGCGAGGAGTGGACCAGACA 60 Query 193 CGGGAGCTTTGTCAATAAGCCCACACGAGGCTGGCTGCATCCCAACGACAAAGTCATGGG 252 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 61 CGGGAGCTTTGTCAATAAGCCCACACGAGGCTGGCTGCATCCCAACGACAAAGTCATGGG 120 Query 253 ACCTGGGGTTTCCTACTTGGTTCGGTACATGGGCTGTGTGGAGGTCTTACAGTCAATGCG 312 |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct 121 ACCTGGGGTTTCCTACTTGGTTCGGTACATGGGCTGTGTGGAGGTCCTACAGTCAATGCG 180 Query 313 AGCCCTTGACTTCAATACCCG 333 ||||||||||||||||||||| Sbjct 181 AGCCCTTGACTTCAATACCCG 201 >gb|AC196865.9| Download subject sequence spanning the HSP Rhesus Macaque BAC CH250-498O8 () complete sequence Length=151414 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 363 bits (196), Expect = 3e-96 Identities = 627/820 (76%), Gaps = 90/820 (10%) Strand=Plus/Minus Query 1393 GGTTCGGACAAAGGATCACCGCTTTGAGAGTGTCAGTCACCTGATCAGCTACCACATGGA 1452 ||||||||| |||||||||||||||||||||||||||||||| ||||||||||| ||||| Sbjct 140061 GGTTCGGACTAAGGATCACCGCTTTGAGAGTGTCAGTCACCTCATCAGCTACCATATGGA 140002 Query 1453 CAATCACTTGCCCATCATCTCTGCGGGCAGCGAACTGTGCCTACAGCAACCCGTGGATCG 1512 ||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| || Sbjct 140001 CAATCACTTGCCCATCATCTCTGCGGGCAGCGAACTGTGTCTACAGCAACCTGTGGAGCG 139942 Query 1513 GAAAGTGTGATCCTTCTC-AG-C-T-TCT-CCA-ACAGGATGCTCTCCATTTCCGTCT-C 1565 |||| ||||||| | | | || | | ||| ||| | || |||| ||||| | || || | Sbjct 139941 GAAACTGTGATC-TGCCCCAGACCTCTCTTCCAGA-AG-ATGCCCTCCAATCCCTTCCAC 139885 Query 1566 CCGTATTCTCTAACT-TGTGGGACCTC-T--G----T-TT-TGTGGGTCT-GGCCTTGGG 1614 || ||||| |||||| | ||||||||| | | | || |||||| || ||||||| | Sbjct 139884 CC-TATTCCCTAACTCT-TGGGACCTCATTTGGGAGTGTTCTGTGGG-CTTGGCCTTGTG 139828 Query 1615 TGGGAACTGGGAGCAACGAGGACA-TGGGTTT-AGTGCCCA-CTTGAGAGAGAGAAAAAG 1671 | || ||||||| | | |||| ||||||| | | ||| || ||| ||| | | Sbjct 139827 TCAGAGCTGGGAGTAGTGTGGACTCTGGGTTTCA-TATCCAGCT-GAGTGAGGGTTT--G 139772 Query 1672 AGGGTTTCAGTAAGGAGCCTGGGGTAGCATCCTGCCTCTGGCCAAAC-TT---CACCAAA 1727 ||||||| ||| || ||||||||| || ||||||||||| |||||| || ||||||| Sbjct 139771 AGGGTTTGAGTCAGAAGCCTGGGGGAGAATCCTGCCTCTCCCCAAACATTGATCACCAAA 139712 Query 1728 GTATTAATGTGCAGAGTGGTCCCTTGTC-TGGGCCTTGCCTGTGCCAACCTGATGCCC-T 1785 |||||||||| |||||||| ||||| | |||||||| |||||||||||||||||||| | Sbjct 139711 GTATTAATGTACAGAGTGG-CCCTTCACCTGGGCCTTTCCTGTGCCAACCTGATGCCCCT 139653 Query 1786 TcccccccAAAGGGTGGGTTCTTATAATGGAAAATGCCCTGTGATGATAGGCCCAGTGGA 1845 ||||| |||| || || || | |||||||||| |||||| ||| |||||||||||| Sbjct 139652 TCCCCAAGAAAG--TGAGTGGTTGTCATGGAAAATGTCCTGTGGTGACAGGCCCAGTGGA 139595 Query 1846 GCAA-CTGCCCTTTGGGGGAAGGGA-AATAATTATACCTCTGGTTTACTCCTGGGTCTTC 1903 || | |||||| ||| ||||| || || || | | ||| ||| | |||| Sbjct 139594 ACAGTCA-CCCTTTTGGGCAAGGGGGAACAA--AT-CA-C------ACTTCTGCG-CTTC 139547 Query 1904 AGGGTACCCCAGATCCCG-CAT-AACATATCCCACTCCCTCTGCTTCCCCTTAAACTTTG 1961 |||||| |||||| ||| | | |||| ||||| ||| | | | |||||||||| Sbjct 139546 AGGGTATCCCAGA-CCCTTC-TCAACACC-CCCAC-CCCAC--CATGT--TTAAACTTTG 139495 Query 1962 TGCCTTTGACTATCA-T-AGGTCTGCA-GATACTTAATGCAGAGTTCTCAGGCCCTTCAC 2018 |||||||||| ||| | ||||||| | |||| || |||||||||||| ||||| | | Sbjct 139494 TGCCTTTGACCATCTCTTAGGTCTG-ATGATATTTTATGCAGAGTTCTTGGGCCCCTGA- 139437 Query 2019 GTG---TGGACAGGGGTTACTGCCACCTT---GGCTTCTGGAGCCCTGTCCTATT-C--A 2069 || || |||||| | | | ||||| ||||||||| | |||||| | || | | Sbjct 139436 GTTCAATG-ACAGGGATGCCAAC-ACCTTCTTGGCTTCTGG-GACCTGTCTTCTTGCTCA 139380 Query 2070 GCACCCCTTCCTGT--G-TCTAGGGAGAATAG-GGACAGGAGTGGCCGCTATCTGCTCTG 2125 |||| | |||| || | | | |||| || || || |||||||||| ||| || |||| Sbjct 139379 GCACTCTTTCCGGTTTGGTTT-GGGATAACAGAGG-CAGGAGTGGCAGCTGTCCCCTCTC 139322 Query 2126 CCTTTCGGATGTGCAGCCCTTAAGAGATTGCCCCA-AGCC 2164 ||| |||| |||| |||||| |||||||||||| |||| Sbjct 139321 CCTGG-GGATATGCAACCCTTA-GAGATTGCCCCAGAGCC 139284 Score = 279 bits (151), Expect = 3e-71 Identities = 163/169 (96%), Gaps = 0/169 (0%) Strand=Plus/Minus Query 109 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCT 168 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct 146881 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTGGAAGGGGGCCAGCT 146822 Query 169 GGGGGGCGAGGAGTGGACCAGACACGGGAGCTTTGTCAATAAGCCCACACGAGGCTGGCT 228 ||||||||||||||||||| | |||||||||||||||||||||||||| || |||||||| Sbjct 146821 GGGGGGCGAGGAGTGGACCCGCCACGGGAGCTTTGTCAATAAGCCCACGCGGGGCTGGCT 146762 Query 229 GCATCCCAACGACAAAGTCATGGGACCTGGGGTTTCCTACTTGGTTCGG 277 ||||||||||||||||||||||||||| ||||||||||||||||||||| Sbjct 146761 GCATCCCAACGACAAAGTCATGGGACCCGGGGTTTCCTACTTGGTTCGG 146713 Score = 126 bits (68), Expect = 5e-25 Identities = 91/102 (89%), Gaps = 1/102 (0%) Strand=Plus/Minus Query 9 GGGTCCTGGGGTGAAAGTTGGGGCGGTGACTTAAGCAGACAGTTGCGTGATCCGGAACCA 68 ||| || |||| ||||||||| ||||| || ||||| | |||| |||||||||||||||| Sbjct 151017 GGG-CCCGGGGAGAAAGTTGGAGCGGTAACCTAAGCTGGCAGTGGCGTGATCCGGAACCA 150959 Query 69 GATCGGCCCGCGGTGCGGTGCGGAGACTCCATGAGACCCTGG 110 |||||||||||||||||||||||||||||||||| |||||| Sbjct 150958 AATCGGCCCGCGGTGCGGTGCGGAGACTCCATGAGGCCCTGG 150917 Score = 82.4 bits (44), Expect = 1e-11 Identities = 50/53 (94%), Gaps = 0/53 (0%) Strand=Plus/Minus Query 586 GGACACAGCTGAGTATGTTGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAG 638 ||||||||| |||||||| ||||| |||||||||||||||||||||||||||| Sbjct 144714 GGACACAGCCGAGTATGTCGCCTACGTTGCCAAAGACCCTGTGAATCAGAGAG 144662 >dbj|AK191292.1| UniGene infoGene info Mus musculus cDNA, clone:Y1G0105G20, strand:minus, reference:ENSEMBL:Mouse-Transcript-ENST:ENSMUST00000039110, based on BLAT search Length=176 Score = 326 bits (176), Expect = 4e-85 Identities = 176/176 (100%), Gaps = 0/176 (0%) Strand=Plus/Plus Query 1079 CGGCAGGCTGGGGGTGGGGCTGGGCCCCCAAATCCTTCTCTTAATGGCAGTGCACCCCGA 1138 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1 CGGCAGGCTGGGGGTGGGGCTGGGCCCCCAAATCCTTCTCTTAATGGCAGTGCACCCCGA 60 Query 1139 GACCTTTTTGACATGAAGCCCTTTGAAGATGCACTTCGGGTGCCACCCCCACCGCAGTCC 1198 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 61 GACCTTTTTGACATGAAGCCCTTTGAAGATGCACTTCGGGTGCCACCCCCACCGCAGTCC 120 Query 1199 ATGTCCATGGCTGAGCAGCTGCAAGGGGAGCCCTGGTTCCACGGGAAGCTGAGCCG 1254 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 121 ATGTCCATGGCTGAGCAGCTGCAAGGGGAGCCCTGGTTCCACGGGAAGCTGAGCCG 176 >gb|AF455140.1| GeoGene info Mus musculus Src homology 2 domain-containing transforming protein 1 isoform p66 and Src homology 2 domain-containing transforming protein 1 isoform p52 genes, alternative promoter regions, exons 1 and 2 and partial cds Length=5178 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 313 bits (169), Expect = 3e-81 Identities = 169/169 (100%), Gaps = 0/169 (0%) Strand=Plus/Plus Query 109 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCT 168 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4366 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCT 4425 Query 169 GGGGGGCGAGGAGTGGACCAGACACGGGAGCTTTGTCAATAAGCCCACACGAGGCTGGCT 228 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4426 GGGGGGCGAGGAGTGGACCAGACACGGGAGCTTTGTCAATAAGCCCACACGAGGCTGGCT 4485 Query 229 GCATCCCAACGACAAAGTCATGGGACCTGGGGTTTCCTACTTGGTTCGG 277 ||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4486 GCATCCCAACGACAAAGTCATGGGACCTGGGGTTTCCTACTTGGTTCGG 4534 Score = 180 bits (97), Expect = 4e-41 Identities = 97/97 (100%), Gaps = 0/97 (0%) Strand=Plus/Plus Query 14 CTGGGGTGAAAGTTGGGGCGGTGACTTAAGCAGACAGTTGCGTGATCCGGAACCAGATCG 73 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 803 CTGGGGTGAAAGTTGGGGCGGTGACTTAAGCAGACAGTTGCGTGATCCGGAACCAGATCG 862 Query 74 GCCCGCGGTGCGGTGCGGAGACTCCATGAGACCCTGG 110 ||||||||||||||||||||||||||||||||||||| Sbjct 863 GCCCGCGGTGCGGTGCGGAGACTCCATGAGACCCTGG 899 Score = 91.6 bits (49), Expect = 2e-14 Identities = 58/62 (93%), Gaps = 2/62 (3%) Strand=Plus/Plus Query 277 GTACAT-GGGCTGTG-TGGAGGTCTTACAGTCAATGCGAGCCCTTGACTTCAATACCCGG 334 |||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| | Sbjct 5116 GTACATGGGGCTGTGCGGGAGGTCTTACAGTCAATGCGAGCCCTTGACTTCAATACCCAG 5175 Query 335 AC 336 || Sbjct 5176 AC 5177 >emb|CR617132.1| UniGene info full-length cDNA clone CS0DI004YK21 of Placenta Cot 25-normalized of Homo sapiens (human) Length=727 Score = 303 bits (164), Expect = 2e-78 Identities = 386/484 (79%), Gaps = 52/484 (10%) Strand=Plus/Plus Query 1392 TGGTTCGGACAAAGGATCACCGCTTTGAGAGTGTCAGTCACCTGATCAGCTACCACATGG 1451 |||||||||| ||||||||||||||||| |||||||||||||| |||||||||||||||| Sbjct 123 TGGTTCGGACTAAGGATCACCGCTTTGAAAGTGTCAGTCACCTTATCAGCTACCACATGG 182 Query 1452 ACAATCACTTGCCCATCATCTCTGCGGGCAGCGAACTGTGCCTACAGCAACCCGTGGATC 1511 |||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| | Sbjct 183 ACAATCACTTGCCCATCATCTCTGCGGGCAGCGAACTGTGTCTACAGCAACCTGTGGAGC 242 Query 1512 GGAAAGTGTGATCCTTCTC-AGC--T-TCT-CCA-ACAGGATGCTCTCCATTTCCGT-CT 1564 ||||| ||||||| | | | ||| | ||| ||| | || |||| ||||| | || | | Sbjct 243 GGAAACTGTGATC-TGCCCTAGCGCTCTCTTCCAGA-AG-ATGCCCTCCAAT-CCTTTCC 298 Query 1565 -CCCGTATTCTCTAACT-TGTGGGACCTC-T--G----T-TT-TGTGGGTCT-GGCCTTG 1612 ||| ||||| |||||| | |||||||| | | | || |||||| || ||||||| Sbjct 299 ACCC-TATTCCCTAACTCTC-GGGACCTCGTTTGGGAGTGTTCTGTGGG-CTTGGCCTTG 355 Query 1613 GGTGGGAACTGGGAGCAACGA-GGACA-TGGGTTT-AGTGCCCA-CTTGAGAGAGAGAAA 1668 || || ||||||| | | | |||| ||||||| | | ||| || ||| ||||| Sbjct 356 TGTCAGAGCTGGGAGTAGC-ATGGACTCTGGGTTTCA-TATCCAGCT-GAGTGAGAG--- 409 Query 1669 AAGAGGGTTTCAGT-AAGGAGCCTGGG-GTAGCATCCTGCCTCTGGCCAAAC-TT---CA 1722 | | ||| ||| || |||||||| | || ||||||||||| |||||| || || Sbjct 410 --G-G--TTTGAGTCAAA-AGCCTGGGTG-AGAATCCTGCCTCTCCCCAAACATTAATCA 462 Query 1723 CCAAAGTATTAATGTGCAGAGTGGTCCCTTGTCTGGGCCTTGCCTGTGCCAACCTGATGC 1782 ||||||||||||||| |||||||| |||| ||||||||| |||||||||||||||||| Sbjct 463 CCAAAGTATTAATGTACAGAGTGGCCCCTCACCTGGGCCTTTCCTGTGCCAACCTGATGC 522 Query 1783 CC-TTcccccccAAAGGGTGGGTTCTTATAATGGAAAATGCCCTGTGATGATAGGCCCAG 1841 || |||||| || || || || ||| | |||||||||| |||||| ||| |||||||| Sbjct 523 CCCTTCCCCAAGAA-GG-TGAGTGCTTGTCATGGAAAATGTCCTGTGGTGACAGGCCCAG 580 Query 1842 TGGA 1845 |||| Sbjct 581 TGGA 584 >emb|AL451085.20| Download subject sequence spanning the HSP Human DNA sequence from clone RP11-307C12 on chromosome 1, complete sequence Length=182166 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 302 bits (163), Expect = 7e-78 Identities = 385/483 (79%), Gaps = 52/483 (10%) Strand=Plus/Minus Query 1393 GGTTCGGACAAAGGATCACCGCTTTGAGAGTGTCAGTCACCTGATCAGCTACCACATGGA 1452 ||||||||| ||||||||||||||||| |||||||||||||| ||||||||||||||||| Sbjct 92370 GGTTCGGACTAAGGATCACCGCTTTGAAAGTGTCAGTCACCTTATCAGCTACCACATGGA 92311 Query 1453 CAATCACTTGCCCATCATCTCTGCGGGCAGCGAACTGTGCCTACAGCAACCCGTGGATCG 1512 ||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| || Sbjct 92310 CAATCACTTGCCCATCATCTCTGCGGGCAGCGAACTGTGTCTACAGCAACCTGTGGAGCG 92251 Query 1513 GAAAGTGTGATCCTTCTC-AGC--T-TCT-CCA-ACAGGATGCTCTCCATTTCCGT-CT- 1564 |||| ||||||| | | | ||| | ||| ||| | || |||| ||||| | || | | Sbjct 92250 GAAACTGTGATC-TGCCCTAGCGCTCTCTTCCAGA-AG-ATGCCCTCCAAT-CCTTTCCA 92195 Query 1565 CCCGTATTCTCTAACT-TGTGGGACCTC-T--G----T-TT-TGTGGGTCT-GGCCTTGG 1613 ||| ||||| |||||| | |||||||| | | | || |||||| || ||||||| Sbjct 92194 CCC-TATTCCCTAACTCTC-GGGACCTCGTTTGGGAGTGTTCTGTGGG-CTTGGCCTTGT 92138 Query 1614 GTGGGAACTGGGAGCAACGA-GGACA-TGGGTTT-AGTGCCCA-CTTGAGAGAGAGAAAA 1669 || || ||||||| | | | |||| ||||||| | | ||| || ||| ||||| Sbjct 92137 GTCAGAGCTGGGAGTAGC-ATGGACTCTGGGTTTCA-TATCCAGCT-GAGTGAGAG---- 92085 Query 1670 AGAGGGTTTCAGT-AAGGAGCCTGGG-GTAGCATCCTGCCTCTGGCCAAAC-TT---CAC 1723 | | ||| ||| || |||||||| | || ||||||||||| |||||| || ||| Sbjct 92084 -G-G--TTTGAGTCAAA-AGCCTGGGTG-AGAATCCTGCCTCTCCCCAAACATTAATCAC 92031 Query 1724 CAAAGTATTAATGTGCAGAGTGGTCCCTTGTCTGGGCCTTGCCTGTGCCAACCTGATGCC 1783 |||||||||||||| |||||||| |||| ||||||||| ||||||||||||||||||| Sbjct 92030 CAAAGTATTAATGTACAGAGTGGCCCCTCACCTGGGCCTTTCCTGTGCCAACCTGATGCC 91971 Query 1784 C-TTcccccccAAAGGGTGGGTTCTTATAATGGAAAATGCCCTGTGATGATAGGCCCAGT 1842 | |||||| || || || || ||| | |||||||||| |||||| ||| ||||||||| Sbjct 91970 CCTTCCCCAAGAA-GG-TGAGTGCTTGTCATGGAAAATGTCCTGTGGTGACAGGCCCAGT 91913 Query 1843 GGA 1845 ||| Sbjct 91912 GGA 91910 Score = 274 bits (148), Expect = 2e-69 Identities = 162/169 (95%), Gaps = 0/169 (0%) Strand=Plus/Minus Query 109 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCT 168 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct 98638 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTGGAAGGGGGCCAGCT 98579 Query 169 GGGGGGCGAGGAGTGGACCAGACACGGGAGCTTTGTCAATAAGCCCACACGAGGCTGGCT 228 |||||||||||||||||| | |||||||||||||||||||||||||| || |||||||| Sbjct 98578 TGGGGGCGAGGAGTGGACCCGCCACGGGAGCTTTGTCAATAAGCCCACGCGGGGCTGGCT 98519 Query 229 GCATCCCAACGACAAAGTCATGGGACCTGGGGTTTCCTACTTGGTTCGG 277 ||||||||||||||||||||||||||| ||||||||||||||||||||| Sbjct 98518 GCATCCCAACGACAAAGTCATGGGACCCGGGGTTTCCTACTTGGTTCGG 98470 Score = 121 bits (65), Expect = 2e-23 Identities = 90/102 (88%), Gaps = 1/102 (0%) Strand=Plus/Minus Query 9 GGGTCCTGGGGTGAAAGTTGGGGCGGTGACTTAAGCAGACAGTTGCGTGATCCGGAACCA 68 ||| || |||| ||||||||| ||||| || ||||| | |||| ||||||||||| |||| Sbjct 102785 GGG-CCCGGGGAGAAAGTTGGAGCGGTAACCTAAGCTGGCAGTGGCGTGATCCGGCACCA 102727 Query 69 GATCGGCCCGCGGTGCGGTGCGGAGACTCCATGAGACCCTGG 110 |||||||||||||||||||||||||||||||||| |||||| Sbjct 102726 AATCGGCCCGCGGTGCGGTGCGGAGACTCCATGAGGCCCTGG 102685 Score = 87.9 bits (47), Expect = 2e-13 Identities = 51/53 (96%), Gaps = 0/53 (0%) Strand=Plus/Minus Query 586 GGACACAGCTGAGTATGTTGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAG 638 ||||||||| |||||||| |||||||||||||||||||||||||||||||||| Sbjct 96470 GGACACAGCCGAGTATGTCGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAG 96418 >gb|BC012812.1| Geo Homo sapiens zinc finger and SCAN domain containing 18, mRNA (cDNA clone IMAGE:2964582), **** WARNING: chimeric clone **** Length=2288 Score = 291 bits (157), Expect = 2e-74 Identities = 173/181 (95%), Gaps = 0/181 (0%) Strand=Plus/Plus Query 109 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCT 168 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct 554 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTGGAAGGGGGCCAGCT 613 Query 169 GGGGGGCGAGGAGTGGACCAGACACGGGAGCTTTGTCAATAAGCCCACACGAGGCTGGCT 228 |||||||||||||||||| | |||||||||||||||||||||||||| || |||||||| Sbjct 614 TGGGGGCGAGGAGTGGACCCGCCACGGGAGCTTTGTCAATAAGCCCACGCGGGGCTGGCT 673 Query 229 GCATCCCAACGACAAAGTCATGGGACCTGGGGTTTCCTACTTGGTTCGGTACATGGGCTG 288 ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| || Sbjct 674 GCATCCCAACGACAAAGTCATGGGACCCGGGGTTTCCTACTTGGTTCGGTACATGGGTTG 733 Query 289 T 289 | Sbjct 734 T 734 >gb|BC006198.1| Geo Homo sapiens zinc finger and SCAN domain containing 18, mRNA (cDNA clone IMAGE:2964582), **** WARNING: chimeric clone **** Length=2288 Score = 291 bits (157), Expect = 2e-74 Identities = 173/181 (95%), Gaps = 0/181 (0%) Strand=Plus/Plus Query 109 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCT 168 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct 554 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTGGAAGGGGGCCAGCT 613 Query 169 GGGGGGCGAGGAGTGGACCAGACACGGGAGCTTTGTCAATAAGCCCACACGAGGCTGGCT 228 |||||||||||||||||| | |||||||||||||||||||||||||| || |||||||| Sbjct 614 TGGGGGCGAGGAGTGGACCCGCCACGGGAGCTTTGTCAATAAGCCCACGCGGGGCTGGCT 673 Query 229 GCATCCCAACGACAAAGTCATGGGACCTGGGGTTTCCTACTTGGTTCGGTACATGGGCTG 288 ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| || Sbjct 674 GCATCCCAACGACAAAGTCATGGGACCCGGGGTTTCCTACTTGGTTCGGTACATGGGTTG 733 Query 289 T 289 | Sbjct 734 T 734 >gb|BC002386.1| Homo sapiens zinc finger and SCAN domain containing 18, mRNA (cDNA clone IMAGE:2964582), **** WARNING: chimeric clone **** Length=2286 Score = 291 bits (157), Expect = 2e-74 Identities = 173/181 (95%), Gaps = 0/181 (0%) Strand=Plus/Plus Query 109 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCT 168 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct 554 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTGGAAGGGGGCCAGCT 613 Query 169 GGGGGGCGAGGAGTGGACCAGACACGGGAGCTTTGTCAATAAGCCCACACGAGGCTGGCT 228 |||||||||||||||||| | |||||||||||||||||||||||||| || |||||||| Sbjct 614 TGGGGGCGAGGAGTGGACCCGCCACGGGAGCTTTGTCAATAAGCCCACGCGGGGCTGGCT 673 Query 229 GCATCCCAACGACAAAGTCATGGGACCTGGGGTTTCCTACTTGGTTCGGTACATGGGCTG 288 ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| || Sbjct 674 GCATCCCAACGACAAAGTCATGGGACCCGGGGTTTCCTACTTGGTTCGGTACATGGGTTG 733 Query 289 T 289 | Sbjct 734 T 734 >gb|AC190310.5| Download subject sequence spanning the HSP Rhesus Macaque BAC CH250-550M15 () complete sequence Length=127678 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 279 bits (151), Expect = 3e-71 Identities = 163/169 (96%), Gaps = 0/169 (0%) Strand=Plus/Plus Query 109 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCT 168 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct 121380 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTGGAAGGGGGCCAGCT 121439 Query 169 GGGGGGCGAGGAGTGGACCAGACACGGGAGCTTTGTCAATAAGCCCACACGAGGCTGGCT 228 ||||||||||||||||||| | |||||||||||||||||||||||||| || |||||||| Sbjct 121440 GGGGGGCGAGGAGTGGACCCGCCACGGGAGCTTTGTCAATAAGCCCACGCGGGGCTGGCT 121499 Query 229 GCATCCCAACGACAAAGTCATGGGACCTGGGGTTTCCTACTTGGTTCGG 277 ||||||||||||||||||||||||||| ||||||||||||||||||||| Sbjct 121500 GCATCCCAACGACAAAGTCATGGGACCCGGGGTTTCCTACTTGGTTCGG 121548 Score = 126 bits (68), Expect = 5e-25 Identities = 91/102 (89%), Gaps = 1/102 (0%) Strand=Plus/Plus Query 9 GGGTCCTGGGGTGAAAGTTGGGGCGGTGACTTAAGCAGACAGTTGCGTGATCCGGAACCA 68 ||| || |||| ||||||||| ||||| || ||||| | |||| |||||||||||||||| Sbjct 117244 GGG-CCCGGGGAGAAAGTTGGAGCGGTAACCTAAGCTGGCAGTGGCGTGATCCGGAACCA 117302 Query 69 GATCGGCCCGCGGTGCGGTGCGGAGACTCCATGAGACCCTGG 110 |||||||||||||||||||||||||||||||||| |||||| Sbjct 117303 AATCGGCCCGCGGTGCGGTGCGGAGACTCCATGAGGCCCTGG 117344 Score = 82.4 bits (44), Expect = 1e-11 Identities = 50/53 (94%), Gaps = 0/53 (0%) Strand=Plus/Plus Query 586 GGACACAGCTGAGTATGTTGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAG 638 ||||||||| |||||||| ||||| |||||||||||||||||||||||||||| Sbjct 123547 GGACACAGCCGAGTATGTCGCCTACGTTGCCAAAGACCCTGTGAATCAGAGAG 123599 >gb|AF455141.1| Gene info Homo sapiens Src homology 2 domain-containing transforming protein 1 isoform p66 and Src homology 2 domain-containing transforming protein 1 isoform p52 genes, alternative promoter regions, exons 1 and 2 and partial cds Length=5092 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 274 bits (148), Expect = 2e-69 Identities = 162/169 (95%), Gaps = 0/169 (0%) Strand=Plus/Plus Query 109 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCT 168 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct 4627 GGACATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTGGAAGGGGGCCAGCT 4686 Query 169 GGGGGGCGAGGAGTGGACCAGACACGGGAGCTTTGTCAATAAGCCCACACGAGGCTGGCT 228 |||||||||||||||||| | |||||||||||||||||||||||||| || |||||||| Sbjct 4687 TGGGGGCGAGGAGTGGACCCGCCACGGGAGCTTTGTCAATAAGCCCACGCGGGGCTGGCT 4746 Query 229 GCATCCCAACGACAAAGTCATGGGACCTGGGGTTTCCTACTTGGTTCGG 277 ||||||||||||||||||||||||||| ||||||||||||||||||||| Sbjct 4747 GCATCCCAACGACAAAGTCATGGGACCCGGGGTTTCCTACTTGGTTCGG 4795 Score = 121 bits (65), Expect = 2e-23 Identities = 90/102 (88%), Gaps = 1/102 (0%) Strand=Plus/Plus Query 9 GGGTCCTGGGGTGAAAGTTGGGGCGGTGACTTAAGCAGACAGTTGCGTGATCCGGAACCA 68 ||| || |||| ||||||||| ||||| || ||||| | |||| ||||||||||| |||| Sbjct 480 GGG-CCCGGGGAGAAAGTTGGAGCGGTAACCTAAGCTGGCAGTGGCGTGATCCGGCACCA 538 Query 69 GATCGGCCCGCGGTGCGGTGCGGAGACTCCATGAGACCCTGG 110 |||||||||||||||||||||||||||||||||| |||||| Sbjct 539 AATCGGCCCGCGGTGCGGTGCGGAGACTCCATGAGGCCCTGG 580 >dbj|AK210297.1| UniGene info Mus musculus cDNA, clone:Y2G0117O21, strand:minus, reference:ENSEMBL:Mouse-Transcript-ENST:ENSMUST00000039110, based on BLAT search Length=136 Score = 252 bits (136), Expect = 7e-63 Identities = 136/136 (100%), Gaps = 0/136 (0%) Strand=Plus/Plus Query 585 CGGACACAGCTGAGTATGTTGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCC 644 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1 CGGACACAGCTGAGTATGTTGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCC 60 Query 645 ATATCCTGGAGTGTCCTGAAGGGCTTGCTCAGGATGTCATCAGCACCATCGGGCAGGCCT 704 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 61 ATATCCTGGAGTGTCCTGAAGGGCTTGCTCAGGATGTCATCAGCACCATCGGGCAGGCCT 120 Query 705 TTGAGTTGCGCTTCAA 720 |||||||||||||||| Sbjct 121 TTGAGTTGCGCTTCAA 136 >gb|EF026651.1| Mus musculus cyclin-dependent kinase subunit 1 (Cks1) gene, promoter region and partial cds Length=1359 Score = 180 bits (97), Expect = 4e-41 Identities = 97/97 (100%), Gaps = 0/97 (0%) Strand=Plus/Minus Query 14 CTGGGGTGAAAGTTGGGGCGGTGACTTAAGCAGACAGTTGCGTGATCCGGAACCAGATCG 73 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 956 CTGGGGTGAAAGTTGGGGCGGTGACTTAAGCAGACAGTTGCGTGATCCGGAACCAGATCG 897 Query 74 GCCCGCGGTGCGGTGCGGAGACTCCATGAGACCCTGG 110 ||||||||||||||||||||||||||||||||||||| Sbjct 896 GCCCGCGGTGCGGTGCGGAGACTCCATGAGACCCTGG 860 >dbj|AK198488.1| Mus musculus cDNA, clone:Y1G0128F05, strand:plus, reference:ENSEMBL:Mouse-Transcript-ENST:ENSMUST00000039110, based on BLAT search Length=92 Score = 165 bits (89), Expect = 1e-36 Identities = 91/92 (98%), Gaps = 0/92 (0%) Strand=Plus/Plus Query 332 CGGACTCAGGTCACCAGGGAGGCCATCAGTTTGGTGTGTGAAGCTGTGCCTGGTGCCAAA 391 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1 CGGACTCAGGTCACCAGGGAGGCCATCAGTTTGGTGTGTGAAGCTGTGCCTGGTGCCAAA 60 Query 392 GGGGCGACAAGGAGGAGAAAGCCTTGTAGCCG 423 |||||||||||||||||||||||||||| ||| Sbjct 61 GGGGCGACAAGGAGGAGAAAGCCTTGTACCCG 92 >gb|AC167135.3| Download subject sequence spanning the HSP Mus musculus chromosome 1, clone RP24-335L18, complete sequence Length=157775 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 148 bits (80), Expect = 1e-31 Identities = 123/142 (86%), Gaps = 10/142 (7%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G-T 2225 ||||||||||||||||||||| ||||||||||||||||||| |||| ||| | | | | Sbjct 110457 TGGTGGCGCACGCCTTTAATCCCAGCACTCAGGAGGCAGAGGCAGGTGGATTTCTGAGTT 110398 Query 2226 -GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 ||||||| || | ||| |||||||||||||||||||||||||||||||| ||||||| Sbjct 110397 CGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATGCAGAGAGA 110341 Query 2284 ACCTGTCTCCAAAAACCAAAAA 2305 |||||||| |||||||||||| Sbjct 110340 CCCTGTCTCGAAAAACCAAAAA 110319 Score = 122 bits (66), Expect = 6e-24 Identities = 120/144 (83%), Gaps = 12/144 (8%) Strand=Plus/Plus Query 2170 ATGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G- 2224 ||||||| ||||| |||||||| ||||||| |||||||||| |||||||| | | | Sbjct 70316 ATGGTGGTGCACGTCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGAGGATTTCTGAGT 70375 Query 2225 T-GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAG 2282 | ||||||| || | ||| ||||||||||||||||||||||||||||||| ||||| Sbjct 70376 TCGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGA- 70431 Query 2283 AACC-TGTCTCCAAAAACCAAAAA 2305 |||| |||||| |||||||||||| Sbjct 70432 AACCCTGTCTCAAAAAACCAAAAA 70455 Score = 121 bits (65), Expect = 2e-23 Identities = 120/144 (83%), Gaps = 13/144 (9%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G-T 2225 |||||||||| |||||||||| |||||||| |||||||||| |||| ||| | | | | Sbjct 84815 TGGTGGCGCATGCCTTTAATCCCAGCACTCGGGAGGCAGAGGCAGGCGGATTTCTGAGTT 84874 Query 2226 -GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 ||||||| || | ||| ||||||||||||||||||||||||||||||| ||||| | Sbjct 84875 CGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGA-A 84930 Query 2284 ACC-TGTCTCCAAAAA-CCAAAAA 2305 ||| |||||| ||||| ||||||| Sbjct 84931 ACCCTGTCTCAAAAAAACCAAAAA 84954 Score = 113 bits (61), Expect = 4e-21 Identities = 113/136 (83%), Gaps = 12/136 (8%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGAATT----G-- 2224 ||||||||| ||||||||||| |||||||| |||||||||| |||| ||| || | Sbjct 73633 TGGTGGCGCTCGCCTTTAATCCCAGCACTCGGGAGGCAGAGGCAGGCGGATTTCAGAGTT 73574 Query 2225 TGAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 |||||||| || | ||| ||||||||||||||||||||||||||||||| ||||| | Sbjct 73573 TGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGA-A 73518 Query 2284 ACC-TGTCTCCAAAAA 2298 ||| |||||| ||||| Sbjct 73517 ACCCTGTCTCAAAAAA 73502 Score = 108 bits (58), Expect = 2e-19 Identities = 117/143 (81%), Gaps = 13/143 (9%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G-T 2225 ||||||||||||||||||||| |||||||| |||||||||| |||| ||| | | | | Sbjct 51538 TGGTGGCGCACGCCTTTAATCCCAGCACTCGGGAGGCAGAGGCAGGCGGATTTCTGAGTT 51479 Query 2226 -GAGGCCATCCGAT-CTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 ||||||| || | | | ||||||||||||||||||||||||||||| ||||| | Sbjct 51478 CGAGGCCA--CGTTGGT-CTCCAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA-A 51423 Query 2284 ACC-TGTCTCCAAAAACCAAAAA 2305 ||| |||||| |||| ||||||| Sbjct 51422 ACCCTGTCTCGAAAA-CCAAAAA 51401 Score = 106 bits (57), Expect = 6e-19 Identities = 124/154 (80%), Gaps = 13/154 (8%) Strand=Plus/Plus Query 2160 AAGCCTGAATATGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGG 2219 |||||| | | |||||||||| |||||||||| ||||||| |||||||||| |||| || Sbjct 68905 AAGCCT-AGTGTGGTGGCGCATGCCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGCGG 68963 Query 2220 A-AT-T--G-T-GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCT 2272 | | | | | ||||||| || | ||| ||||||||||||||||||||||||||||| Sbjct 68964 ATTTCTGAGTTCGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCT 69020 Query 2273 ATGGAGAGAGAACC-TGTCTCCAAAAACCAAAAA 2305 | | ||| |||| |||||| ||||| |||||| Sbjct 69021 ACACAAAGA-AACCCTGTCTCGAAAAAACAAAAA 69053 Score = 102 bits (55), Expect = 8e-18 Identities = 111/136 (81%), Gaps = 12/136 (8%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGG-AGGAATTGTGAG- 2228 |||||| |||||||||||||| ||||||| |||||||||| |||| | || || |||| Sbjct 125692 TGGTGGTGCACGCCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGCA-GATTTCTGAGT 125634 Query 2229 GCCA-TCCGA-TCT--ACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAA 2284 ||| || | || | ||||||||||||||||||||||||||||||| | |||||| Sbjct 125633 TCCAGGCC-AGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTAT--ACAGAGAA 125577 Query 2285 -CC-TGTCTCCAAAAA 2298 || |||||||||||| Sbjct 125576 GCCCTGTCTCCAAAAA 125561 Score = 99.0 bits (53), Expect = 1e-16 Identities = 117/145 (80%), Gaps = 15/145 (10%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGG-AGGA-AT-T--G- 2224 |||||||||| |||||||||| |||||||| |||||||||| |||| | || | | | Sbjct 118346 TGGTGGCGCATGCCTTTAATCCCAGCACTCGGGAGGCAGAGGCAGGCA-GATTTCTGAGT 118288 Query 2225 -TGAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAG 2282 |||||||| || | ||| |||||||||||||||||||||||||||||| |||| | Sbjct 118287 TTGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAG-G 118232 Query 2283 AACC-TGTCTCC-AAAAACCAAAAA 2305 |||| |||||| ||||| ||||| Sbjct 118231 AACCCTGTCTCGGAAAAAAAAAAAA 118207 Score = 91.6 bits (49), Expect = 2e-14 Identities = 105/130 (80%), Gaps = 12/130 (9%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGG-AG--GAAT---TG 2224 ||||||| || |||||||||| ||||||| ||||||||||||||| || || | Sbjct 130844 TGGTGGCACATGCCTTTAATCCCAGCACTTGGGAGGCAGAGACAGGCAGCTTTATGGGTC 130785 Query 2225 TGAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 |||||||| || | ||| |||||||||||||||||||||||||||||| ||||| | Sbjct 130784 TGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA-A 130729 Query 2284 ACC-TGTCTC 2292 ||| |||||| Sbjct 130728 ACCCTGTCTC 130719 Score = 91.6 bits (49), Expect = 2e-14 Identities = 111/138 (80%), Gaps = 15/138 (10%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGAA--T-T--G- 2224 ||||||||||| ||||||||| || |||| |||||||||| |||| ||| | | | Sbjct 141492 TGGTGGCGCACACCTTTAATCCCAACACTTGGGAGGCAGAGGCAGG-CGAATTTCTGAGT 141550 Query 2225 T-GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAG 2282 | |||||| || | ||| ||||||||||||||||||||||||||||||| ||||| Sbjct 141551 TCAAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGA- 141606 Query 2283 AACC-TGTCTCCAAAAAC 2299 |||| |||||| |||||| Sbjct 141607 AACCCTGTCTC-AAAAAC 141623 Score = 87.9 bits (47), Expect = 2e-13 Identities = 105/131 (80%), Gaps = 12/131 (9%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G-- 2224 |||||| ||| |||||||||| ||||||| |||||||||| |||| ||| | | | Sbjct 66589 TGGTGGTGCATGCCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGCGGATTTCTGAGTT 66530 Query 2225 TGAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 |||||||| || | ||| ||||||||||||||||||||||||||||| ||||| | Sbjct 66529 TGAGGCCAGCCTGGTCT---GCAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA-A 66474 Query 2284 ACC-TGTCTCC 2293 ||| ||||||| Sbjct 66473 ACCCTGTCTCC 66463 Score = 87.9 bits (47), Expect = 2e-13 Identities = 57/62 (91%), Gaps = 0/62 (0%) Strand=Plus/Minus Query 2244 ACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAACCTGTCTCCAAAAACCAAA 2303 ||||||||||||||||||||||||||||||| ||| | |||||||||| |||||||||| Sbjct 109426 ACAGAGTGAGTTCCAGGACAGCCAGGGCTATATAGAAAAAACCTGTCTCGAAAAACCAAA 109367 Query 2304 AA 2305 || Sbjct 109366 AA 109365 Score = 86.1 bits (46), Expect = 8e-13 Identities = 113/143 (79%), Gaps = 13/143 (9%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAAT-CACAGCACTCAGGAGGCAGAGACAGGAGGAA-TTGTGAG 2228 |||||||| | ||||| ||| || |||||| |||||||||| |||| || || |||| Sbjct 43224 TGGTGGCGGATGCCTTCAATCCA-AGCACTTGGGAGGCAGAGGCAGG-CAAATTTCTGAG 43281 Query 2229 GCC-A-TCCGA-TCT--ACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 || | || | ||| | ||||||||||||||||||||||||||||||| ||||| | Sbjct 43282 TCCGAGGCC-AGTCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGA-A 43339 Query 2284 ACCTG-TCTCCAAAAA-CCAAAA 2304 ||| | |||| ||||| |||||| Sbjct 43340 ACCCGGTCTCAAAAAAACCAAAA 43362 Score = 86.1 bits (46), Expect = 8e-13 Identities = 113/143 (79%), Gaps = 13/143 (9%) Strand=Plus/Minus Query 2170 ATGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G- 2224 |||||||| ||| ||||||||| || |||| |||||||||| |||| ||| | | | Sbjct 70081 ATGGTGGCACACACCTTTAATCCCAACACTTGGGAGGCAGAGGCAGGCGGATTTCTGAGT 70022 Query 2225 -TGAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAG 2282 |||||||| || | ||| ||||||||||||||||||||||||||||| ||| | Sbjct 70021 TTGAGGCCAGCCTGGTCT---GCAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAAA- 69966 Query 2283 AACC-TGTCTCCAAAAACCAAAA 2304 |||| |||||| |||||| |||| Sbjct 69965 AACCCTGTCTCAAAAAAC-AAAA 69944 Score = 84.2 bits (45), Expect = 3e-12 Identities = 102/127 (80%), Gaps = 14/127 (11%) Strand=Plus/Plus Query 2174 TGGCGCACGCCTTTAATCAC-AGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G--TG 2226 ||||||| |||||||||| | |||||| |||||||||| |||| ||| | | | || Sbjct 77501 TGGCGCATGCCTTTAATC-CTAGCACTTGGGAGGCAGAGGCAGGTGGATTTCTGAGTTTG 77559 Query 2227 AGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAAC 2285 |||||| || | ||| |||||||||||||||||||||||||||||| ||||| ||| Sbjct 77560 AGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA-AAC 77615 Query 2286 C-TGTCT 2291 | ||||| Sbjct 77616 CCTGTCT 77622 Score = 80.5 bits (43), Expect = 4e-11 Identities = 56/62 (90%), Gaps = 2/62 (3%) Strand=Plus/Minus Query 2244 ACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAACC-TGTCTCCAAAAACCAA 2302 |||||||||||||||||||||||||||||| ||||| |||| |||||| ||||||||| Sbjct 111764 ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA-AACCCTGTCTCGAAAAACCAA 111706 Query 2303 AA 2304 || Sbjct 111705 AA 111704 Score = 76.8 bits (41), Expect = 5e-10 Identities = 112/144 (77%), Gaps = 14/144 (9%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGG-AGGA-AT-T--G- 2224 ||||||| ||| || |||| | ||||||| |||||||||| |||| | || | | | Sbjct 20436 TGGTGGCACACACCCTTAAACCCAGCACTTGGGAGGCAGAGGCAGGCA-GATTTCTGAGT 20494 Query 2225 T-GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAG 2282 | |||||| || | ||| ||||||||||||||||||||||||||||||| ||||| Sbjct 20495 TCAAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGA- 20550 Query 2283 AACCTG-TCTCCAAAAACCAAAAA 2305 |||| | |||| ||||| ||||| Sbjct 20551 AACCCGGTCTCAAAAAAAAAAAAA 20574 Score = 76.8 bits (41), Expect = 5e-10 Identities = 112/143 (78%), Gaps = 17/143 (11%) Strand=Plus/Minus Query 2171 TGGTGG-CGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGG-AGGA-AT-T--G 2224 |||||| | || |||||||||| ||| ||| |||||||||| |||| | || | | | Sbjct 118026 TGGTGGTC-CATGCCTTTAATCCCAGTACTTGGGAGGCAGAGGCAGGCA-GATTTCTGAG 117969 Query 2225 -T-GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGA 2281 | |||| || || | ||| |||||||||||||||||||||||||||||| ||||| Sbjct 117968 TTCGAGGACAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA 117912 Query 2282 GAACC-TGTCTCCAAAAACCAAA 2303 |||| |||||| |||||| ||| Sbjct 117911 -AACCCTGTCTCGAAAAAC-AAA 117891 Score = 71.3 bits (38), Expect = 2e-08 Identities = 55/63 (87%), Gaps = 2/63 (3%) Strand=Plus/Plus Query 2244 ACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAACC-TGTCTCCAAAAACCAA 2302 ||||||||||||||||||||||||||||||| ||||| |||| ||| || ||||| || Sbjct 49872 ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGA-AACCCTGTATCAAAAAAAAAA 49930 Query 2303 AAA 2305 ||| Sbjct 49931 AAA 49933 >gb|AC160101.7| Download subject sequence spanning the HSP Mus musculus chromosome 1, clone RP24-126E20, complete sequence Length=159705 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 148 bits (80), Expect = 1e-31 Identities = 123/142 (86%), Gaps = 10/142 (7%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G-T 2225 ||||||||||||||||||||| ||||||||||||||||||| |||| ||| | | | | Sbjct 41824 TGGTGGCGCACGCCTTTAATCCCAGCACTCAGGAGGCAGAGGCAGGTGGATTTCTGAGTT 41883 Query 2226 -GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 ||||||| || | ||| |||||||||||||||||||||||||||||||| ||||||| Sbjct 41884 CGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATGCAGAGAGA 41940 Query 2284 ACCTGTCTCCAAAAACCAAAAA 2305 |||||||| |||||||||||| Sbjct 41941 CCCTGTCTCGAAAAACCAAAAA 41962 Score = 122 bits (66), Expect = 6e-24 Identities = 120/144 (83%), Gaps = 12/144 (8%) Strand=Plus/Minus Query 2170 ATGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G- 2224 ||||||| ||||| |||||||| ||||||| |||||||||| |||||||| | | | Sbjct 81885 ATGGTGGTGCACGTCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGAGGATTTCTGAGT 81826 Query 2225 T-GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAG 2282 | ||||||| || | ||| ||||||||||||||||||||||||||||||| ||||| Sbjct 81825 TCGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGA- 81770 Query 2283 AACC-TGTCTCCAAAAACCAAAAA 2305 |||| |||||| |||||||||||| Sbjct 81769 AACCCTGTCTCAAAAAACCAAAAA 81746 Score = 121 bits (65), Expect = 2e-23 Identities = 120/144 (83%), Gaps = 13/144 (9%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G-T 2225 |||||||||| |||||||||| |||||||| |||||||||| |||| ||| | | | | Sbjct 67466 TGGTGGCGCATGCCTTTAATCCCAGCACTCGGGAGGCAGAGGCAGGCGGATTTCTGAGTT 67407 Query 2226 -GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 ||||||| || | ||| ||||||||||||||||||||||||||||||| ||||| | Sbjct 67406 CGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGA-A 67351 Query 2284 ACC-TGTCTCCAAAAA-CCAAAAA 2305 ||| |||||| ||||| ||||||| Sbjct 67350 ACCCTGTCTCAAAAAAACCAAAAA 67327 Score = 113 bits (61), Expect = 4e-21 Identities = 113/136 (83%), Gaps = 12/136 (8%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGAATT----G-- 2224 ||||||||| ||||||||||| |||||||| |||||||||| |||| ||| || | Sbjct 78568 TGGTGGCGCTCGCCTTTAATCCCAGCACTCGGGAGGCAGAGGCAGGCGGATTTCAGAGTT 78627 Query 2225 TGAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 |||||||| || | ||| ||||||||||||||||||||||||||||||| ||||| | Sbjct 78628 TGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGA-A 78683 Query 2284 ACC-TGTCTCCAAAAA 2298 ||| |||||| ||||| Sbjct 78684 ACCCTGTCTCAAAAAA 78699 Score = 108 bits (58), Expect = 2e-19 Identities = 117/143 (81%), Gaps = 13/143 (9%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G-T 2225 ||||||||||||||||||||| |||||||| |||||||||| |||| ||| | | | | Sbjct 100663 TGGTGGCGCACGCCTTTAATCCCAGCACTCGGGAGGCAGAGGCAGGCGGATTTCTGAGTT 100722 Query 2226 -GAGGCCATCCGAT-CTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 ||||||| || | | | ||||||||||||||||||||||||||||| ||||| | Sbjct 100723 CGAGGCCA--CGTTGGT-CTCCAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA-A 100778 Query 2284 ACC-TGTCTCCAAAAACCAAAAA 2305 ||| |||||| |||| ||||||| Sbjct 100779 ACCCTGTCTCGAAAA-CCAAAAA 100800 Score = 106 bits (57), Expect = 6e-19 Identities = 124/154 (80%), Gaps = 13/154 (8%) Strand=Plus/Minus Query 2160 AAGCCTGAATATGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGG 2219 |||||| | | |||||||||| |||||||||| ||||||| |||||||||| |||| || Sbjct 83296 AAGCCT-AGTGTGGTGGCGCATGCCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGCGG 83238 Query 2220 A-AT-T--G-T-GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCT 2272 | | | | | ||||||| || | ||| ||||||||||||||||||||||||||||| Sbjct 83237 ATTTCTGAGTTCGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCT 83181 Query 2273 ATGGAGAGAGAACC-TGTCTCCAAAAACCAAAAA 2305 | | ||| |||| |||||| ||||| |||||| Sbjct 83180 ACACAAAGA-AACCCTGTCTCGAAAAAACAAAAA 83148 Score = 102 bits (55), Expect = 8e-18 Identities = 111/136 (81%), Gaps = 12/136 (8%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGG-AGGAATTGTGAG- 2228 |||||| |||||||||||||| ||||||| |||||||||| |||| | || || |||| Sbjct 26589 TGGTGGTGCACGCCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGCA-GATTTCTGAGT 26647 Query 2229 GCCA-TCCGA-TCT--ACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAA 2284 ||| || | || | ||||||||||||||||||||||||||||||| | |||||| Sbjct 26648 TCCAGGCC-AGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTAT--ACAGAGAA 26704 Query 2285 -CC-TGTCTCCAAAAA 2298 || |||||||||||| Sbjct 26705 GCCCTGTCTCCAAAAA 26720 Score = 99.0 bits (53), Expect = 1e-16 Identities = 117/145 (80%), Gaps = 15/145 (10%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGG-AGGA-AT-T--G- 2224 |||||||||| |||||||||| |||||||| |||||||||| |||| | || | | | Sbjct 33935 TGGTGGCGCATGCCTTTAATCCCAGCACTCGGGAGGCAGAGGCAGGCA-GATTTCTGAGT 33993 Query 2225 -TGAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAG 2282 |||||||| || | ||| |||||||||||||||||||||||||||||| |||| | Sbjct 33994 TTGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAG-G 34049 Query 2283 AACC-TGTCTCC-AAAAACCAAAAA 2305 |||| |||||| ||||| ||||| Sbjct 34050 AACCCTGTCTCGGAAAAAAAAAAAA 34074 Score = 91.6 bits (49), Expect = 2e-14 Identities = 111/138 (80%), Gaps = 15/138 (10%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGAA--T-T--G- 2224 ||||||||||| ||||||||| || |||| |||||||||| |||| ||| | | | Sbjct 10788 TGGTGGCGCACACCTTTAATCCCAACACTTGGGAGGCAGAGGCAGG-CGAATTTCTGAGT 10730 Query 2225 T-GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAG 2282 | |||||| || | ||| ||||||||||||||||||||||||||||||| ||||| Sbjct 10729 TCAAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGA- 10674 Query 2283 AACC-TGTCTCCAAAAAC 2299 |||| |||||| |||||| Sbjct 10673 AACCCTGTCTC-AAAAAC 10657 Score = 91.6 bits (49), Expect = 2e-14 Identities = 105/130 (80%), Gaps = 12/130 (9%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGG-AG--GAAT---TG 2224 ||||||| || |||||||||| ||||||| ||||||||||||||| || || | Sbjct 21437 TGGTGGCACATGCCTTTAATCCCAGCACTTGGGAGGCAGAGACAGGCAGCTTTATGGGTC 21496 Query 2225 TGAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 |||||||| || | ||| |||||||||||||||||||||||||||||| ||||| | Sbjct 21497 TGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA-A 21552 Query 2284 ACC-TGTCTC 2292 ||| |||||| Sbjct 21553 ACCCTGTCTC 21562 Score = 87.9 bits (47), Expect = 2e-13 Identities = 57/62 (91%), Gaps = 0/62 (0%) Strand=Plus/Plus Query 2244 ACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAACCTGTCTCCAAAAACCAAA 2303 ||||||||||||||||||||||||||||||| ||| | |||||||||| |||||||||| Sbjct 42855 ACAGAGTGAGTTCCAGGACAGCCAGGGCTATATAGAAAAAACCTGTCTCGAAAAACCAAA 42914 Query 2304 AA 2305 || Sbjct 42915 AA 42916 Score = 87.9 bits (47), Expect = 2e-13 Identities = 105/131 (80%), Gaps = 12/131 (9%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G-- 2224 |||||| ||| |||||||||| ||||||| |||||||||| |||| ||| | | | Sbjct 85612 TGGTGGTGCATGCCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGCGGATTTCTGAGTT 85671 Query 2225 TGAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 |||||||| || | ||| ||||||||||||||||||||||||||||| ||||| | Sbjct 85672 TGAGGCCAGCCTGGTCT---GCAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA-A 85727 Query 2284 ACC-TGTCTCC 2293 ||| ||||||| Sbjct 85728 ACCCTGTCTCC 85738 Score = 86.1 bits (46), Expect = 8e-13 Identities = 113/143 (79%), Gaps = 13/143 (9%) Strand=Plus/Plus Query 2170 ATGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G- 2224 |||||||| ||| ||||||||| || |||| |||||||||| |||| ||| | | | Sbjct 82120 ATGGTGGCACACACCTTTAATCCCAACACTTGGGAGGCAGAGGCAGGCGGATTTCTGAGT 82179 Query 2225 -TGAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAG 2282 |||||||| || | ||| ||||||||||||||||||||||||||||| ||| | Sbjct 82180 TTGAGGCCAGCCTGGTCT---GCAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAAA- 82235 Query 2283 AACC-TGTCTCCAAAAACCAAAA 2304 |||| |||||| |||||| |||| Sbjct 82236 AACCCTGTCTCAAAAAAC-AAAA 82257 Score = 86.1 bits (46), Expect = 8e-13 Identities = 113/143 (79%), Gaps = 13/143 (9%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAAT-CACAGCACTCAGGAGGCAGAGACAGGAGGAA-TTGTGAG 2228 |||||||| | ||||| ||| || |||||| |||||||||| |||| || || |||| Sbjct 108979 TGGTGGCGGATGCCTTCAATCCA-AGCACTTGGGAGGCAGAGGCAGG-CAAATTTCTGAG 108922 Query 2229 GCC-A-TCCGA-TCT--ACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 || | || | ||| | ||||||||||||||||||||||||||||||| ||||| | Sbjct 108921 TCCGAGGCC-AGTCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGA-A 108864 Query 2284 ACCTG-TCTCCAAAAA-CCAAAA 2304 ||| | |||| ||||| |||||| Sbjct 108863 ACCCGGTCTCAAAAAAACCAAAA 108841 Score = 84.2 bits (45), Expect = 3e-12 Identities = 102/127 (80%), Gaps = 14/127 (11%) Strand=Plus/Minus Query 2174 TGGCGCACGCCTTTAATCAC-AGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G--TG 2226 ||||||| |||||||||| | |||||| |||||||||| |||| ||| | | | || Sbjct 74700 TGGCGCATGCCTTTAATC-CTAGCACTTGGGAGGCAGAGGCAGGTGGATTTCTGAGTTTG 74642 Query 2227 AGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAAC 2285 |||||| || | ||| |||||||||||||||||||||||||||||| ||||| ||| Sbjct 74641 AGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA-AAC 74586 Query 2286 C-TGTCT 2291 | ||||| Sbjct 74585 CCTGTCT 74579 Score = 80.5 bits (43), Expect = 4e-11 Identities = 56/62 (90%), Gaps = 2/62 (3%) Strand=Plus/Plus Query 2244 ACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAACC-TGTCTCCAAAAACCAA 2302 |||||||||||||||||||||||||||||| ||||| |||| |||||| ||||||||| Sbjct 40517 ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA-AACCCTGTCTCGAAAAACCAA 40575 Query 2303 AA 2304 || Sbjct 40576 AA 40577 Score = 76.8 bits (41), Expect = 5e-10 Identities = 112/143 (78%), Gaps = 17/143 (11%) Strand=Plus/Plus Query 2171 TGGTGG-CGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGG-AGGA-AT-T--G 2224 |||||| | || |||||||||| ||| ||| |||||||||| |||| | || | | | Sbjct 34255 TGGTGGTC-CATGCCTTTAATCCCAGTACTTGGGAGGCAGAGGCAGGCA-GATTTCTGAG 34312 Query 2225 -T-GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGA 2281 | |||| || || | ||| |||||||||||||||||||||||||||||| ||||| Sbjct 34313 TTCGAGGACAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA 34369 Query 2282 GAACC-TGTCTCCAAAAACCAAA 2303 |||| |||||| |||||| ||| Sbjct 34370 -AACCCTGTCTCGAAAAAC-AAA 34390 Score = 76.8 bits (41), Expect = 5e-10 Identities = 112/144 (77%), Gaps = 14/144 (9%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGG-AGGA-AT-T--G- 2224 ||||||| ||| || |||| | ||||||| |||||||||| |||| | || | | | Sbjct 131767 TGGTGGCACACACCCTTAAACCCAGCACTTGGGAGGCAGAGGCAGGCA-GATTTCTGAGT 131709 Query 2225 T-GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAG 2282 | |||||| || | ||| ||||||||||||||||||||||||||||||| ||||| Sbjct 131708 TCAAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGA- 131653 Query 2283 AACCTG-TCTCCAAAAACCAAAAA 2305 |||| | |||| ||||| ||||| Sbjct 131652 AACCCGGTCTCAAAAAAAAAAAAA 131629 Score = 71.3 bits (38), Expect = 2e-08 Identities = 55/63 (87%), Gaps = 2/63 (3%) Strand=Plus/Minus Query 2244 ACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAACC-TGTCTCCAAAAACCAA 2302 ||||||||||||||||||||||||||||||| ||||| |||| ||| || ||||| || Sbjct 102329 ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGA-AACCCTGTATCAAAAAAAAAA 102271 Query 2303 AAA 2305 ||| Sbjct 102270 AAA 102268 >emb|AL731811.24| Download subject sequence spanning the HSP Mouse DNA sequence from clone RP23-60A1 on chromosome X, complete sequence Length=167102 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 148 bits (80), Expect = 1e-31 Identities = 120/138 (86%), Gaps = 8/138 (5%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGG-AGGAATTGTGAGG 2229 ||||||||||||||||||||| |||||||| ||||||| || |||| | || || ||||| Sbjct 127857 TGGTGGCGCACGCCTTTAATCCCAGCACTCGGGAGGCATAGGCAGGCA-GATTTCTGAGG 127915 Query 2230 CCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAACC-T 2287 ||| || ||||| ||||||||||||||||||||||||||||||| ||||| |||| | Sbjct 127916 CCAACCTGATCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGA-AACCCT 127971 Query 2288 GTCTCCAAAAACCAAAAA 2305 ||||| |||||||||||| Sbjct 127972 GTCTCGAAAAACCAAAAA 127989 Score = 99.0 bits (53), Expect = 1e-16 Identities = 115/143 (80%), Gaps = 12/143 (8%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-TG---T 2225 |||| || ||| ||||||||| ||||||| |||||||||| |||| ||| | || | Sbjct 40912 TGGTAGCACACACCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGTGGATCTCTGAATT 40971 Query 2226 -GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 |||||| || | ||| |||||||||||||||||||||||||||||| ||||| | Sbjct 40972 CCAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTACATAGAGA-A 41027 Query 2284 ACC-TGTCTCCAAAAACCAAAAA 2305 ||| |||||| |||||||||||| Sbjct 41028 ACCCTGTCTCGAAAAACCAAAAA 41050 Score = 95.3 bits (51), Expect = 1e-15 Identities = 115/143 (80%), Gaps = 15/143 (10%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGG-AGGA-AT-T--G- 2224 |||||| ||| |||||||||| ||||||| |||||||||| |||| | || | | | Sbjct 18697 TGGTGGTGCATGCCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGCA-GATTTCTGAGT 18639 Query 2225 -TGAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAG 2282 |||||||| || | || | |||||||||||||||||||||||||||||| ||||| Sbjct 18638 TTGAGGCCAGCCTGGTC--C-ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA- 18583 Query 2283 AACC-TGTCTCCAAAAA-CCAAA 2303 |||| |||||| ||||| ||||| Sbjct 18582 AACCCTGTCTCAAAAAAACCAAA 18560 >gb|AC167036.6| Download subject sequence spanning the HSP Mus musculus chromosome 1, clone RP23-76P9, complete sequence Length=250160 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 148 bits (80), Expect = 1e-31 Identities = 123/142 (86%), Gaps = 10/142 (7%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G-T 2225 ||||||||||||||||||||| ||||||||||||||||||| |||| ||| | | | | Sbjct 36031 TGGTGGCGCACGCCTTTAATCCCAGCACTCAGGAGGCAGAGGCAGGTGGATTTCTGAGTT 35972 Query 2226 -GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 ||||||| || | ||| |||||||||||||||||||||||||||||||| ||||||| Sbjct 35971 CGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATGCAGAGAGA 35915 Query 2284 ACCTGTCTCCAAAAACCAAAAA 2305 |||||||| |||||||||||| Sbjct 35914 CCCTGTCTCGAAAAACCAAAAA 35893 Score = 121 bits (65), Expect = 2e-23 Identities = 120/144 (83%), Gaps = 13/144 (9%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G-T 2225 |||||||||| |||||||||| |||||||| |||||||||| |||| ||| | | | | Sbjct 10389 TGGTGGCGCATGCCTTTAATCCCAGCACTCGGGAGGCAGAGGCAGGCGGATTTCTGAGTT 10448 Query 2226 -GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 ||||||| || | ||| ||||||||||||||||||||||||||||||| ||||| | Sbjct 10449 CGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGA-A 10504 Query 2284 ACC-TGTCTCCAAAAA-CCAAAAA 2305 ||| |||||| ||||| ||||||| Sbjct 10505 ACCCTGTCTCAAAAAAACCAAAAA 10528 Score = 110 bits (59), Expect = 5e-20 Identities = 118/144 (81%), Gaps = 13/144 (9%) Strand=Plus/Minus Query 2170 ATGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G- 2224 |||||||| || |||||||||| ||||||| ||||||||||| |||||||| | | | Sbjct 244715 ATGGTGGCACATGCCTTTAATCCCAGCACTTAGGAGGCAGAGGCAGGAGGATTTCTGAGT 244656 Query 2225 T-GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAG 2282 | |||||| || | ||| |||||||||||||||||||||||||||||| ||||| Sbjct 244655 TCAAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA- 244600 Query 2283 AACC-TGTCTCCAAAAA-CCAAAA 2304 |||| |||||| ||||| |||||| Sbjct 244599 AACCCTGTCTCGAAAAAACCAAAA 244576 Score = 102 bits (55), Expect = 8e-18 Identities = 111/136 (81%), Gaps = 12/136 (8%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGG-AGGAATTGTGAG- 2228 |||||| |||||||||||||| ||||||| |||||||||| |||| | || || |||| Sbjct 51266 TGGTGGTGCACGCCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGCA-GATTTCTGAGT 51208 Query 2229 GCCA-TCCGA-TCT--ACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAA 2284 ||| || | || | ||||||||||||||||||||||||||||||| | |||||| Sbjct 51207 TCCAGGCC-AGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTAT--ACAGAGAA 51151 Query 2285 -CC-TGTCTCCAAAAA 2298 || |||||||||||| Sbjct 51150 GCCCTGTCTCCAAAAA 51135 Score = 100 bits (54), Expect = 3e-17 Identities = 114/141 (80%), Gaps = 12/141 (8%) Strand=Plus/Minus Query 2172 GGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G-T- 2225 |||||| || |||||||||| ||||||| |||||||||| |||| ||| | | | | Sbjct 123272 GGTGGCACATGCCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGCGGATTTCTGAGTTC 123213 Query 2226 GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAA 2284 |||||| || | ||| |||||||||||||||||||||||||||||| ||||| || Sbjct 123212 AAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA-AA 123157 Query 2285 CC-TGTCTCCAAAAACCAAAA 2304 || |||||| ||||||||||| Sbjct 123156 CCCTGTCTCGAAAAACCAAAA 123136 Score = 99.0 bits (53), Expect = 1e-16 Identities = 117/145 (80%), Gaps = 15/145 (10%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGG-AGGA-AT-T--G- 2224 |||||||||| |||||||||| |||||||| |||||||||| |||| | || | | | Sbjct 43920 TGGTGGCGCATGCCTTTAATCCCAGCACTCGGGAGGCAGAGGCAGGCA-GATTTCTGAGT 43862 Query 2225 -TGAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAG 2282 |||||||| || | ||| |||||||||||||||||||||||||||||| |||| | Sbjct 43861 TTGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAG-G 43806 Query 2283 AACC-TGTCTCC-AAAAACCAAAAA 2305 |||| |||||| ||||| ||||| Sbjct 43805 AACCCTGTCTCGGAAAAAAAAAAAA 43781 Score = 91.6 bits (49), Expect = 2e-14 Identities = 105/130 (80%), Gaps = 12/130 (9%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGG-AG--GAAT---TG 2224 ||||||| || |||||||||| ||||||| ||||||||||||||| || || | Sbjct 56418 TGGTGGCACATGCCTTTAATCCCAGCACTTGGGAGGCAGAGACAGGCAGCTTTATGGGTC 56359 Query 2225 TGAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 |||||||| || | ||| |||||||||||||||||||||||||||||| ||||| | Sbjct 56358 TGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA-A 56303 Query 2284 ACC-TGTCTC 2292 ||| |||||| Sbjct 56302 ACCCTGTCTC 56293 Score = 91.6 bits (49), Expect = 2e-14 Identities = 111/138 (80%), Gaps = 15/138 (10%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGAA--T-T--G- 2224 ||||||||||| ||||||||| || |||| |||||||||| |||| ||| | | | Sbjct 67066 TGGTGGCGCACACCTTTAATCCCAACACTTGGGAGGCAGAGGCAGG-CGAATTTCTGAGT 67124 Query 2225 T-GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAG 2282 | |||||| || | ||| ||||||||||||||||||||||||||||||| ||||| Sbjct 67125 TCAAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGA- 67180 Query 2283 AACC-TGTCTCCAAAAAC 2299 |||| |||||| |||||| Sbjct 67181 AACCCTGTCTC-AAAAAC 67197 Score = 87.9 bits (47), Expect = 2e-13 Identities = 57/62 (91%), Gaps = 0/62 (0%) Strand=Plus/Minus Query 2244 ACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAACCTGTCTCCAAAAACCAAA 2303 ||||||||||||||||||||||||||||||| ||| | |||||||||| |||||||||| Sbjct 35000 ACAGAGTGAGTTCCAGGACAGCCAGGGCTATATAGAAAAAACCTGTCTCGAAAAACCAAA 34941 Query 2304 AA 2305 || Sbjct 34940 AA 34939 Score = 84.2 bits (45), Expect = 3e-12 Identities = 102/127 (80%), Gaps = 14/127 (11%) Strand=Plus/Plus Query 2174 TGGCGCACGCCTTTAATCAC-AGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G--TG 2226 ||||||| |||||||||| | |||||| |||||||||| |||| ||| | | | || Sbjct 3075 TGGCGCATGCCTTTAATC-CTAGCACTTGGGAGGCAGAGGCAGGTGGATTTCTGAGTTTG 3133 Query 2227 AGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAAC 2285 |||||| || | ||| |||||||||||||||||||||||||||||| ||||| ||| Sbjct 3134 AGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA-AAC 3189 Query 2286 C-TGTCT 2291 | ||||| Sbjct 3190 CCTGTCT 3196 Score = 80.5 bits (43), Expect = 4e-11 Identities = 56/62 (90%), Gaps = 2/62 (3%) Strand=Plus/Minus Query 2244 ACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAACC-TGTCTCCAAAAACCAA 2302 |||||||||||||||||||||||||||||| ||||| |||| |||||| ||||||||| Sbjct 37338 ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA-AACCCTGTCTCGAAAAACCAA 37280 Query 2303 AA 2304 || Sbjct 37279 AA 37278 Score = 76.8 bits (41), Expect = 5e-10 Identities = 112/143 (78%), Gaps = 17/143 (11%) Strand=Plus/Minus Query 2171 TGGTGG-CGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGG-AGGA-AT-T--G 2224 |||||| | || |||||||||| ||| ||| |||||||||| |||| | || | | | Sbjct 43600 TGGTGGTC-CATGCCTTTAATCCCAGTACTTGGGAGGCAGAGGCAGGCA-GATTTCTGAG 43543 Query 2225 -T-GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGA 2281 | |||| || || | ||| |||||||||||||||||||||||||||||| ||||| Sbjct 43542 TTCGAGGACAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA 43486 Query 2282 GAACC-TGTCTCCAAAAACCAAA 2303 |||| |||||| |||||| ||| Sbjct 43485 -AACCCTGTCTCGAAAAAC-AAA 43465 Score = 65.8 bits (35), Expect = 1e-06 Identities = 106/138 (76%), Gaps = 14/138 (10%) Strand=Plus/Plus Query 2170 ATGGTGGCGCACGCCTTTAATCACAGCACT-CAGGAGGCAGAGACAGGAGGA-AT-T--G 2224 |||||||| || || ||||||| ||||| | |||||||||| ||| ||| | | | Sbjct 100422 ATGGTGGCACATGCTTTTAATCCCAGCA-TGTGGGAGGCAGAGGCAGTCGGATTTCTGAG 100480 Query 2225 -T-GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGA 2281 | |||||| || | ||| |||||||||||||||||||||||||||||| ||||| Sbjct 100481 TTCAAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA 100537 Query 2282 GAACC-TGTCTCCAAAAA 2298 |||| ||||| ||||| Sbjct 100538 -AACCCTGTCTTGAAAAA 100554 >emb|AL591711.22| Download subject sequence spanning the HSP Mouse DNA sequence from clone RP23-19L12 on chromosome 2, complete sequence Length=197743 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 147 bits (79), Expect = 4e-31 Identities = 123/142 (86%), Gaps = 11/142 (7%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-TG--T- 2225 ||||||||||||||||||||| ||||||||||||||||||| |||||||| | || | Sbjct 33093 TGGTGGCGCACGCCTTTAATCCCAGCACTCAGGAGGCAGAGCCAGGAGGACTTCTGATTC 33152 Query 2226 GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAA 2284 ||||||| || | ||| ||||||||||||||||||||||||||||||| ||||| || Sbjct 33153 GAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGA-AA 33208 Query 2285 CC-TGTCTCCAAAAACCAAAAA 2305 || |||||| |||||||||||| Sbjct 33209 CCCTGTCTCGAAAAACCAAAAA 33230 Score = 106 bits (57), Expect = 6e-19 Identities = 113/138 (81%), Gaps = 12/138 (8%) Strand=Plus/Plus Query 2176 GCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G-T-GAGG 2229 |||||||||||||||| ||||||| |||||||||| ||||| || | | | | |||| Sbjct 157157 GCGCACGCCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGAAGATTTCTGAGTTCGAGG 157216 Query 2230 CCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAACC-T 2287 ||| || | ||| |||||||||||||||||||||||||||||| ||||| |||| | Sbjct 157217 CCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA-AACCCT 157272 Query 2288 GTCTCCAAAAACCAAAAA 2305 ||||| |||||| ||||| Sbjct 157273 GTCTCGAAAAACTAAAAA 157290 Score = 104 bits (56), Expect = 2e-18 Identities = 117/144 (81%), Gaps = 14/144 (9%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G-- 2224 ||||||||||||||||||||| |||||||| |||||||||| |||| ||| | | | Sbjct 29059 TGGTGGCGCACGCCTTTAATCCCAGCACTCGGGAGGCAGAGGCAGGCGGATTTCTGAGTT 29118 Query 2225 TGAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 |||||||| || | ||| |||||||||||||||||||||||||||||| ||| | | Sbjct 29119 TGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAAA-A 29174 Query 2284 ACC-TGTCTCCAA-AAACCAAAAA 2305 ||| |||||| || ||| ||||| Sbjct 29175 ACCCTGTCTC-AAGAAAGAAAAAA 29197 Score = 93.5 bits (50), Expect = 5e-15 Identities = 111/138 (80%), Gaps = 14/138 (10%) Strand=Plus/Plus Query 2178 GCACGC-C-TTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G--TGAGG 2229 |||||| | ||||||| ||||||| |||||||||| |||| ||| | | | ||||| Sbjct 67173 GCACGCACGTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGCGGATTTCTGAGTTTGAGG 67232 Query 2230 CCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAACC-T 2287 ||| || | ||| ||||||||||||||||||||||||||||||| ||||| |||| | Sbjct 67233 CCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGA-AACCCT 67288 Query 2288 GTCTCCAAAAACCAAAAA 2305 |||| ||||| |||||| Sbjct 67289 GTCTGGAAAAAACAAAAA 67306 Score = 87.9 bits (47), Expect = 2e-13 Identities = 109/137 (79%), Gaps = 12/137 (8%) Strand=Plus/Minus Query 2170 ATGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G- 2224 |||||||| || |||||||||| || |||| |||||||||| |||| ||| | | | Sbjct 13049 ATGGTGGCACATGCCTTTAATCTCAACACTTGGGAGGCAGAGGCAGGTGGATTTCTGAGT 12990 Query 2225 T-GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAG 2282 | ||||||| || | ||| |||||||||||||||||||||||||||||| ||||| Sbjct 12989 TCGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA- 12934 Query 2283 AACC-TGTCTCCAAAAA 2298 |||| ||||| ||||| Sbjct 12933 AACCCTGTCTTGAAAAA 12917 Score = 87.9 bits (47), Expect = 2e-13 Identities = 106/132 (80%), Gaps = 14/132 (10%) Strand=Plus/Minus Query 2170 ATGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGAA--T-T--G 2224 |||||||||||||||||||||| ||||||| || ||||||| || || || | | | Sbjct 27275 ATGGTGGCGCACGCCTTTAATCCCAGCACTTGGGCGGCAGAGGCA-GACAAATTTCTGAG 27217 Query 2225 -T-GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGA 2281 | ||||||| || | ||| |||||||||||||||||||||||||||||| ||||| Sbjct 27216 TTCGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA 27160 Query 2282 GAACC-TGTCTC 2292 |||| |||||| Sbjct 27159 -AACCCTGTCTC 27149 Score = 87.9 bits (47), Expect = 2e-13 Identities = 114/144 (79%), Gaps = 13/144 (9%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGG-AGGA-AT-T--G- 2224 |||| ||||||| |||||||| ||||||||||||||||||| ||| ||| | | | Sbjct 130760 TGGTAGCGCACGTCTTTAATCCCAGCACTCAGGAGGCAGAGGTAGGTGGGATTTCTGAGT 130819 Query 2225 T-GAGGCCA-TCCGATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAG 2282 | ||||||| | | ||| ||||||||||||||||||||||||||||||| ||||| Sbjct 130820 TCGAGGCCAGTGTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATTCAGAGA- 130875 Query 2283 AACC-TGTCTCCAAAAACCAAAAA 2305 |||| || |||||||||||| Sbjct 130876 AACCCTGAAAAAAAAAACCAAAAA 130899 Score = 75.0 bits (40), Expect = 2e-09 Identities = 110/140 (78%), Gaps = 19/140 (13%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAA-TCACAGCACTCAGGAGGCAGA-GACAGGAGGAA--T-T-- 2223 ||||||| ||||||||||| || || |||| ||||||||| | |||| ||| | | Sbjct 82704 TGGTGGCACACGCCTTTAATTC-CAACACTTGGGAGGCAGACG-CAGG-TGAATTTCTGA 82648 Query 2224 G-T-GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAG 2280 | | | ||||| || | ||| ||||||||||||||||||||||||||||||| |||| Sbjct 82647 GTTAGTGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAG 82591 Query 2281 AGAA-CC-TGTCTCCAAAAA 2298 ||| || |||||| ||||| Sbjct 82590 -GAAACCCTGTCTCAAAAAA 82572 Score = 58.4 bits (31), Expect = 2e-04 Identities = 45/51 (88%), Gaps = 4/51 (7%) Strand=Plus/Minus Query 2224 GTGAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTA 2273 ||||||||| || | ||| |||||||||||||||||||||||||||||| Sbjct 48147 GTGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTA 48100 Score = 58.4 bits (31), Expect = 2e-04 Identities = 89/114 (78%), Gaps = 16/114 (14%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAG-GAGGCA-GAGACAGGAGGA-AT-TGT- 2225 |||||| ||| ||||||||| |||||| ||| |||| | |||||||| ||| | ||| Sbjct 130159 TGGTGGTGCATACCTTTAATCCCAGCAC-CAGAGAGG-AGGAGACAGGTGGATCTCTGTG 130102 Query 2226 -G----AGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTA 2273 | |||||| || | | | |||||||||||||||||||||||||||||| Sbjct 130101 AGATCAAGGCCAGCCTGGT-T--TACAGAGTGAGTTCCAGGACAGCCAGGGCTA 130051 Score = 58.4 bits (31), Expect = 2e-04 Identities = 48/56 (85%), Gaps = 2/56 (3%) Strand=Plus/Plus Query 2244 ACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAACCT-GTCTCCAAAAA 2298 |||||||||||||||||||||||||||||| ||||| || || |||| ||||| Sbjct 162391 ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA-AATCTTGTCTTGAAAAA 162445 >gb|AC109139.15| Download subject sequence spanning the HSP Mus musculus chromosome 8, clone RP23-47L13, complete sequence Length=268904 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 143 bits (77), Expect = 5e-30 Identities = 117/135 (86%), Gaps = 7/135 (5%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGAATTGTGAGGC 2230 ||||||||||||||||||||| ||||||||||||||||||| |||| ||| || ||| || Sbjct 264185 TGGTGGCGCACGCCTTTAATCCCAGCACTCAGGAGGCAGAGGCAGGCGGATTTCTGA-GC 264127 Query 2231 CATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAACC-TG 2288 || || | ||| ||||||||||||||||||||||||||||||| ||||| |||| || Sbjct 264126 CAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGA-AACCCTG 264071 Query 2289 TCTCCAAAAACCAAA 2303 |||| ||||| |||| Sbjct 264070 TCTCAAAAAAACAAA 264056 Score = 115 bits (62), Expect = 1e-21 Identities = 120/145 (82%), Gaps = 16/145 (11%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G-T 2225 ||||||| ||||||||||||| ||||||||||||||||||| |||| ||| | | | | Sbjct 103435 TGGTGGCACACGCCTTTAATCCCAGCACTCAGGAGGCAGAGGCAGGCGGATTTCTGAGTT 103376 Query 2226 -GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 |||||| || | ||| ||||||||||||||||||||||||||||||| | ||||| Sbjct 103375 CAAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTAT--ACAGAGA 103321 Query 2284 A-CC-TGTCTCCA-AAAACCAAAAA 2305 | || |||||| | ||||||||||| Sbjct 103320 ATCCCTGTCTC-AGAAAACCAAAAA 103297 Score = 100 bits (54), Expect = 3e-17 Identities = 126/158 (79%), Gaps = 15/158 (9%) Strand=Plus/Minus Query 2157 CCCAAGCCTGAATATGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGG 2216 |||||||| | | ||||||||||| ||||||||| |||||||| |||||||||| || | Sbjct 232025 CCCAAGCC-GGGTGTGGTGGCGCACACCTTTAATCCCAGCACTCGGGAGGCAGAGGCA-G 231968 Query 2217 A-GGA-AT-T--G-T-GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAG 2268 | ||| | | | | ||||||| || | ||| ||||||||||||||||||||||||| Sbjct 231967 ACGGATTTCTGAGTTCGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAG 231911 Query 2269 GGCTATGGAGAGAGAACC-TGTCTCCAAAAACCAAAAA 2305 ||||| || || |||| |||||| ||||| ||||| Sbjct 231910 GGCTACACAGGGA-AACCCTGTCTCAAAAAAAAAAAAA 231874 Score = 87.9 bits (47), Expect = 2e-13 Identities = 110/138 (79%), Gaps = 14/138 (10%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G-- 2224 |||||| |||||||||||||| ||||||| || ||||||||||| ||| | | | Sbjct 258820 TGGTGGTGCACGCCTTTAATCCCAGCACTTGGGCTGCAGAGACAGGTGGATTTCTGAGTT 258761 Query 2225 TGAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 ||||| || || | ||| |||||||||||||||||||||||||||||| ||||| | Sbjct 258760 TGAGGACAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA-A 258705 Query 2284 ACC-TGTCTCCA-AAAAC 2299 ||| |||||| | ||||| Sbjct 258704 ACCCTGTCTC-ATAAAAC 258688 Score = 80.5 bits (43), Expect = 4e-11 Identities = 112/143 (78%), Gaps = 13/143 (9%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGA-GACAGG-AGGAATTGTGAG 2228 |||| ||||| |||||||||| ||||||| ||||||||| || ||| | || || |||| Sbjct 195449 TGGTAGCGCATGCCTTTAATCCCAGCACTTGGGAGGCAGAGGA-AGGCA-GATTTATGAG 195506 Query 2229 -GCCA-TCCGA-TCT--ACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 | | || | ||| | |||||||||||||||||||||||||||||| ||||| | Sbjct 195507 TTCAAGGCC-ACTCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA-A 195564 Query 2284 ACC-TGTCTCCAAAAACCAAAAA 2305 ||| |||||| | ||| ||||| Sbjct 195565 ACCCTGTCTC-AGAAAGAAAAAA 195586 Score = 65.8 bits (35), Expect = 1e-06 Identities = 88/112 (78%), Gaps = 10/112 (8%) Strand=Plus/Minus Query 2196 CACTCAGGAGGCAGAGACAGGAGGA-AT-TGTGAG-GCCA-TCCGA-TCT--ACAACAGA 2248 |||||||||||||||| |||| ||| | |||||| ||| || | || | ||||| Sbjct 111040 CACTCAGGAGGCAGAGGCAGGTGGATCTCTGTGAGTTCCAGGCC-AGCCTGGTCTACAGA 110982 Query 2249 GTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAACC-TGTCTCCAAAAAC 2299 ||||||||||||||||||||||||| || || |||| ||||| |||||| Sbjct 110981 GTGAGTTCCAGGACAGCCAGGGCTACACAGGGA-AACCCTGTCTTGAAAAAC 110931 >gb|AC126938.2| Download subject sequence spanning the HSP Mus musculus BAC clone RP23-50I16 from chromosome 5, complete sequence Length=187269 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 143 bits (77), Expect = 5e-30 Identities = 123/143 (86%), Gaps = 12/143 (8%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G-T 2225 ||||||||||||||||||||| ||||||||||||||||||| |||||||| | | | | Sbjct 111072 TGGTGGCGCACGCCTTTAATCCCAGCACTCAGGAGGCAGAGGCAGGAGGATTTCTGAGTT 111131 Query 2226 -GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 ||||||| || | ||| ||||||||||||||||||||||||||||||| ||||| | Sbjct 111132 CGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGA-A 111187 Query 2284 ACC-TGTCTCCAAAAACCAAAAA 2305 ||| |||||| |||||||||||| Sbjct 111188 ACCCTGTCTCGAAAAACCAAAAA 111210 Score = 128 bits (69), Expect = 1e-25 Identities = 122/145 (84%), Gaps = 14/145 (9%) Strand=Plus/Minus Query 2170 ATGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGG-AGGA-AT-T--G 2224 |||||||||||||||||||||| |||||||| |||||||||| |||| | || | | | Sbjct 174153 ATGGTGGCGCACGCCTTTAATCCCAGCACTCGGGAGGCAGAGGCAGGCA-GATTTCTGAG 174095 Query 2225 --TGAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGA 2281 |||||||| || | ||||| | | |||||||||||||||||||||||||||| ||||| Sbjct 174094 TTTGAGGCCAGCCTGGTCTAC-A-A-AGTGAGTTCCAGGACAGCCAGGGCTATGCAGAGA 174038 Query 2282 GAACC-TGTCTCCAAAAACCAAAAA 2305 |||| |||||| |||||| ||||| Sbjct 174037 -AACCCTGTCTCAAAAAACAAAAAA 174014 Score = 126 bits (68), Expect = 5e-25 Identities = 120/143 (83%), Gaps = 12/143 (8%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G-T 2225 ||||||||||||||||||||| |||||||| |||||||||| |||| ||| | | | | Sbjct 171892 TGGTGGCGCACGCCTTTAATCCCAGCACTCGGGAGGCAGAGGCAGGCGGATTTCTGAGTT 171951 Query 2226 -GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 |||||| || | ||| ||||||||||||||||||||||||||||||| ||||| | Sbjct 171952 CAAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGA-A 172007 Query 2284 ACC-TGTCTCCAAAAACCAAAAA 2305 ||| |||||| |||||||||||| Sbjct 172008 ACCCTGTCTCGAAAAACCAAAAA 172030 Score = 104 bits (56), Expect = 2e-18 Identities = 117/144 (81%), Gaps = 13/144 (9%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G-T 2225 |||||| |||||||||||||| ||||||| |||||||||| |||| ||| | | | | Sbjct 57072 TGGTGGTGCACGCCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGTGGATTTCTGAGTT 57013 Query 2226 -GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 ||||||| || | ||| |||||||||||||||||||||||||||||| ||||| | Sbjct 57012 CGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA-A 56957 Query 2284 ACC-TGTCTCCAAAAAC-CAAAAA 2305 ||| |||||| ||||| |||||| Sbjct 56956 ACCCTGTCTCAAAAAAAACAAAAA 56933 Score = 99.0 bits (53), Expect = 1e-16 Identities = 113/140 (80%), Gaps = 12/140 (8%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G-T 2225 |||||||||| ||||||| || ||||||| |||||||||| |||| ||| | | | | Sbjct 100257 TGGTGGCGCATGCCTTTAGTCCCAGCACTTGGGAGGCAGAGGCAGGCGGATTTCTGAGTT 100316 Query 2226 -GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 ||||||| || | ||| |||||||||||||||||||||||||||||| ||||| | Sbjct 100317 CGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA-A 100372 Query 2284 ACC-TGTCTCCAAAAACCAA 2302 ||| ||||| ||||||||| Sbjct 100373 ACCCTGTCTTGAAAAACCAA 100392 Score = 93.5 bits (50), Expect = 5e-15 Identities = 111/138 (80%), Gaps = 14/138 (10%) Strand=Plus/Plus Query 2170 ATGGTGGCGCACGCCTTTAAT-CACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G 2224 ||||||||||||||||||| | || |||||| |||||||||| |||| ||| | | | Sbjct 13255 ATGGTGGCGCACGCCTTTAGTCCA-AGCACTTGGGAGGCAGAGGCAGGTGGATTTCTGAG 13313 Query 2225 --TGAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGA 2281 |||||||| || | ||| |||||||||||||||||||||||||||||| ||||| Sbjct 13314 TTTGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA 13370 Query 2282 GAACC-TGTCTCCAAAAA 2298 |||| ||||| ||||| Sbjct 13371 -AACCCTGTCTTGAAAAA 13387 Score = 78.7 bits (42), Expect = 1e-10 Identities = 115/147 (78%), Gaps = 18/147 (12%) Strand=Plus/Plus Query 2174 TGGCGCACGCCTTTAATCACAGCAC-TCAGGAGGCAGAGACAGG-AGGA-AT-T--G-T- 2225 |||| ||| ||||||||| |||||| | |||||||||| |||| | || | | | | Sbjct 88690 TGGCACACACCTTTAATCTCAGCACGT-GGGAGGCAGAGGCAGGCA-GATTTCTGGGTTC 88747 Query 2226 GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAA 2284 ||||||| || | ||| |||||||||||||||||||||||||||||| ||||| || Sbjct 88748 GAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA-AA 88803 Query 2285 CC-TGTCTCCA-AAAACCA-AAAAGAG 2308 || |||||| | |||| | ||||||| Sbjct 88804 CCCTGTCTCAAGAAAAAAATAAAAGAG 88830 Score = 58.4 bits (31), Expect = 2e-04 Identities = 42/47 (89%), Gaps = 2/47 (4%) Strand=Plus/Plus Query 2244 ACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAACC-TGT 2289 |||||||||||||||||||||||||||||| ||||| |||| ||| Sbjct 156591 ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA-AACCCTGT 156636 >gb|AC098705.2| Download subject sequence spanning the HSP Mus musculus BAC clone RP23-1B19 from 3, complete sequence Length=202444 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 143 bits (77), Expect = 5e-30 Identities = 123/143 (86%), Gaps = 12/143 (8%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGAATT--G--T- 2225 ||||||||||||||||||||| |||||||||||||||||||||||||||| || | | Sbjct 129463 TGGTGGCGCACGCCTTTAATCCCAGCACTCAGGAGGCAGAGACAGGAGGATTTCTGAGTT 129404 Query 2226 -GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 ||||||| || | ||||||| || |||||||||||||||||||||||| ||||| | Sbjct 129403 CGAGGCCAGCCTGGTCTACAA-AG--TGAGTTCCAGGACAGCCAGGGCTACACAGAGA-A 129348 Query 2284 ACC-TGTCTCCAAAAACCAAAAA 2305 ||| |||||| |||||||||||| Sbjct 129347 ACCCTGTCTCGAAAAACCAAAAA 129325 Score = 71.3 bits (38), Expect = 2e-08 Identities = 101/129 (78%), Gaps = 13/129 (10%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G-- 2224 |||| || || |||| ||||| ||||||| ||||| |||| |||| ||| | | | Sbjct 110106 TGGTAGCACATGCCTATAATCCCAGCACTTGGGAGG-AGAGGCAGGCGGATTTCTGAGTT 110048 Query 2225 TGAGGCCA-TCCGATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 |||||||| || | ||| |||||||||||||||||||||||||||||| ||||| | Sbjct 110047 TGAGGCCAGTCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA-A 109992 Query 2284 AC-CTGTCT 2291 || |||||| Sbjct 109991 ACTCTGTCT 109983 Score = 56.5 bits (30), Expect = 6e-04 Identities = 30/30 (100%), Gaps = 0/30 (0%) Strand=Plus/Minus Query 2244 ACAGAGTGAGTTCCAGGACAGCCAGGGCTA 2273 |||||||||||||||||||||||||||||| Sbjct 4531 ACAGAGTGAGTTCCAGGACAGCCAGGGCTA 4502 >gb|AC113049.22| Download subject sequence spanning the HSP Mus musculus chromosome 8, clone RP23-248P8, complete sequence Length=200431 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 143 bits (77), Expect = 5e-30 Identities = 117/135 (86%), Gaps = 7/135 (5%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGAATTGTGAGGC 2230 ||||||||||||||||||||| ||||||||||||||||||| |||| ||| || ||| || Sbjct 66444 TGGTGGCGCACGCCTTTAATCCCAGCACTCAGGAGGCAGAGGCAGGCGGATTTCTGA-GC 66386 Query 2231 CATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAACC-TG 2288 || || | ||| ||||||||||||||||||||||||||||||| ||||| |||| || Sbjct 66385 CAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGA-AACCCTG 66330 Query 2289 TCTCCAAAAACCAAA 2303 |||| ||||| |||| Sbjct 66329 TCTCAAAAAAACAAA 66315 Score = 100 bits (54), Expect = 3e-17 Identities = 126/158 (79%), Gaps = 15/158 (9%) Strand=Plus/Minus Query 2157 CCCAAGCCTGAATATGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGG 2216 |||||||| | | ||||||||||| ||||||||| |||||||| |||||||||| || | Sbjct 34282 CCCAAGCC-GGGTGTGGTGGCGCACACCTTTAATCCCAGCACTCGGGAGGCAGAGGCA-G 34225 Query 2217 A-GGA-AT-T--G-T-GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAG 2268 | ||| | | | | ||||||| || | ||| ||||||||||||||||||||||||| Sbjct 34224 ACGGATTTCTGAGTTCGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAG 34168 Query 2269 GGCTATGGAGAGAGAACC-TGTCTCCAAAAACCAAAAA 2305 ||||| || || |||| |||||| ||||| ||||| Sbjct 34167 GGCTACACAGGGA-AACCCTGTCTCAAAAAAAAAAAAA 34131 Score = 87.9 bits (47), Expect = 2e-13 Identities = 110/138 (79%), Gaps = 14/138 (10%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G-- 2224 |||||| |||||||||||||| ||||||| || ||||||||||| ||| | | | Sbjct 61079 TGGTGGTGCACGCCTTTAATCCCAGCACTTGGGCTGCAGAGACAGGTGGATTTCTGAGTT 61020 Query 2225 TGAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 ||||| || || | ||| |||||||||||||||||||||||||||||| ||||| | Sbjct 61019 TGAGGACAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA-A 60964 Query 2284 ACC-TGTCTCCA-AAAAC 2299 ||| |||||| | ||||| Sbjct 60963 ACCCTGTCTC-ATAAAAC 60947 Score = 84.2 bits (45), Expect = 3e-12 Identities = 79/94 (84%), Gaps = 7/94 (7%) Strand=Plus/Plus Query 2182 GCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGAATTGT-GAGGCCATCC-GATC 2239 |||||||||| ||||||||||||||||||| |||| || | | | | |||| || | | Sbjct 106676 GCCTTTAATCCCAGCACTCAGGAGGCAGAGGCAGGTGG-A-TCTCCAAGCCAGCCTG-T- 106731 Query 2240 TACAACAGAGTGAGTTCCAGGACAGCCAGGGCTA 2273 || |||||||||||||||||||||||||||||| Sbjct 106732 TA-TACAGAGTGAGTTCCAGGACAGCCAGGGCTA 106764 Score = 80.5 bits (43), Expect = 4e-11 Identities = 103/130 (79%), Gaps = 11/130 (8%) Strand=Plus/Plus Query 2178 GCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGG-AGGAATTGTGAG-GCCA-TC 2234 ||||| |||||||| |||||||| |||||||||| ||| | || || |||| ||| | Sbjct 122803 GCACGTCTTTAATCCCAGCACTCGGGAGGCAGAGGTAGGCA-GATTTCTGAGTTCCAGGC 122861 Query 2235 CGA-TCT--ACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAAC-CT-GT 2289 | | || | |||||||||||||||||||||||||||||| ||||| ||| || || Sbjct 122862 C-AGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA-AACTCTTGT 122919 Query 2290 CTCCAAAAAC 2299 ||| |||||| Sbjct 122920 CTCGAAAAAC 122929 >emb|AL731731.14| Download subject sequence spanning the HSP Mouse DNA sequence from clone RP23-331L13 on chromosome X, complete sequence Length=151603 Score = 143 bits (77), Expect = 5e-30 Identities = 122/142 (85%), Gaps = 10/142 (7%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G-T 2225 ||||||||||||||||||||| ||||||||||||||||||| |||| ||| | | | | Sbjct 30313 TGGTGGCGCACGCCTTTAATCCCAGCACTCAGGAGGCAGAGGCAGGTGGATTTCTGAGTT 30372 Query 2226 -GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 ||||||| || | ||| ||||||||||||||||||||||||||||||| ||||| | Sbjct 30373 CGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGAAA 30429 Query 2284 ACCTGTCTCCAAAAACCAAAAA 2305 ||||||||| |||||||||||| Sbjct 30430 ACCTGTCTCTAAAAACCAAAAA 30451 >emb|AL732560.11| Download subject sequence spanning the HSP Mouse DNA sequence from clone RP24-209P15 on chromosome 2, complete sequence Length=104663 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 143 bits (77), Expect = 5e-30 Identities = 118/137 (86%), Gaps = 6/137 (4%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGAATTGTGAGGC 2230 |||||| ||| |||||||||| |||||||| |||||||||| |||||||| || |||||| Sbjct 14891 TGGTGGTGCATGCCTTTAATCCCAGCACTCCGGAGGCAGAGGCAGGAGGATTTCTGAGGC 14832 Query 2231 CATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAACC-TG 2288 || || | ||| ||||||||||||||||||||||||||||||| ||||| |||| || Sbjct 14831 CAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGA-AACCCTG 14776 Query 2289 TCTCCAAAAACCAAAAA 2305 |||| |||||| ||||| Sbjct 14775 TCTCGAAAAACAAAAAA 14759 Score = 115 bits (62), Expect = 1e-21 Identities = 122/148 (82%), Gaps = 15/148 (10%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G-T 2225 |||||| | |||||||||||||||||||| ||||||| ||||||| ||| | | | | Sbjct 60323 TGGTGGTGAACGCCTTTAATCACAGCACTTGGGAGGCAAAGACAGGTGGATTTCTGAGTT 60264 Query 2226 -GAGGCCAT-CC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAG 2282 |||||| | || | ||| ||||||||||||||||||||||||||||||| ||||| Sbjct 60263 CGAGGCC-TGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGA- 60209 Query 2283 AACC-TGTCTCCAAAAACCAAAA-AGAG 2308 |||| |||||| ||||||||||| |||| Sbjct 60208 AACCCTGTCTCGAAAAACCAAAAGAGAG 60181 Score = 115 bits (62), Expect = 1e-21 Identities = 119/144 (82%), Gaps = 14/144 (9%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAATCAC-AGCACTCAGGAGGCAGAGACAGG-AGGAATTGTGAG 2228 ||||||||||| |||||||| | |||||||||||||||||| |||| | || || |||| Sbjct 81823 TGGTGGCGCACAACTTTAATC-CTAGCACTCAGGAGGCAGAGGCAGGCA-GATTTCTGAG 81766 Query 2229 -GCCA-TCCGA-TCTA--CAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 | | ||| | ||| | ||||||||||||||||||||||||||||||| ||||| | Sbjct 81765 TTCGAGTCC-AGCCTAGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTATATAGAGA-A 81708 Query 2284 ACC-TGTCTCCA-AAAACCAAAAA 2305 ||| |||||| | ||||||||||| Sbjct 81707 ACCCTGTCTC-AGAAAACCAAAAA 81685 Score = 102 bits (55), Expect = 8e-18 Identities = 116/143 (81%), Gaps = 14/143 (9%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G-T 2225 ||||||| ||||||||||||| ||||||| |||||||||| |||| ||| | | | | Sbjct 62776 TGGTGGCACACGCCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGTGGATTTCTGAGTT 62717 Query 2226 -GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 ||||||| || | ||| |||||||||||||||||||||||||||||| ||||| | Sbjct 62716 CGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA-A 62661 Query 2284 ACC-TGTCTCCAAA-AACCAAAA 2304 ||| |||||| ||| ||| |||| Sbjct 62660 ACCCTGTCTCGAAAGAAC-AAAA 62639 Score = 95.3 bits (51), Expect = 1e-15 Identities = 113/141 (80%), Gaps = 11/141 (7%) Strand=Plus/Minus Query 2172 GGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G-T- 2225 |||| | ||| ||||||||| ||||||| ||||||||||||||| ||| | | | | Sbjct 38474 GGTGTC-CACCCCTTTAATCCCAGCACTTGGGAGGCAGAGACAGGTGGATTTCTGAGTTC 38416 Query 2226 GAGGCCATCCGATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAAC 2285 ||||||| || | | | | ||||||||||||||||||||||||||||| ||||| ||| Sbjct 38415 GAGGCCAGCCTA-GT-CTATAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGA-AAC 38359 Query 2286 C-TGTCTCCAAAAACCAAAAA 2305 | ||||| ||||| |||||| Sbjct 38358 CCTGTCTTGAAAAAACAAAAA 38338 Score = 93.5 bits (50), Expect = 5e-15 Identities = 116/145 (80%), Gaps = 16/145 (11%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCAC-TCAGGAGGCAGAGACAGG-AGGA-AT-T--G 2224 |||||| ||| |||||||||| |||||| | | ||||||||| |||| | || | | | Sbjct 8138 TGGTGGTGCATGCCTTTAATCCCAGCACTTGA-GAGGCAGAGGCAGGCA-GATTTCTGAG 8195 Query 2225 -T-GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGA 2281 | ||||||| || | ||| ||||||||||||||||||||||||||||||| ||||| Sbjct 8196 TTCGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGA 8252 Query 2282 GAACC-TGTCTCCAAAAACCAAAAA 2305 |||| |||||| ||||| ||||| Sbjct 8253 -AACCCTGTCTCGAAAAAAAAAAAA 8276 >gb|AC154842.2| Download subject sequence spanning the HSP Mus musculus BAC clone RP23-55C11 from chromosome 17, complete sequence Length=252431 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 141 bits (76), Expect = 2e-29 Identities = 124/145 (85%), Gaps = 12/145 (8%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGAATTGTGAG-- 2228 |||||| |||| |||||||||||||||||||||||||||||||||| ||| ||||||| Sbjct 198343 TGGTGGTGCACACCTTTAATCACAGCACTCAGGAGGCAGAGACAGGCGGATTTGTGAGTT 198284 Query 2229 -G---CCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 | ||| || | ||||||| || ||||||||||||||||||||||||| ||||| | Sbjct 198283 TGAGGCCAGCCTGGTCTACAA-AG--TGAGTTCCAGGACAGCCAGGGCTATACAGAGA-A 198228 Query 2284 AC-CTGTCTCCAAAAACCAAAAAGA 2307 || ||||||| |||||||||||||| Sbjct 198227 ACACTGTCTCGAAAAACCAAAAAGA 198203 Score = 97.1 bits (52), Expect = 4e-16 Identities = 119/148 (80%), Gaps = 18/148 (12%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAG-AGACAGG-AGGA-AT-T--G 2224 ||||||| || |||||||||| ||||||| |||||||| || |||| | || | | | Sbjct 143814 TGGTGGCACATGCCTTTAATCCCAGCACTTGGGAGGCAGAAG-CAGGCA-GATTTCTGAG 143871 Query 2225 -T-GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGA 2281 | ||||||| || | ||| ||||||||||||||||||||||||||||||| ||||| Sbjct 143872 TTCGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGA 143928 Query 2282 GAACC-TGTCTCCAAAAACCAAAA-AGA 2307 |||| |||||| |||||| |||| ||| Sbjct 143929 -AACCCTGTCTCAAAAAAC-AAAACAGA 143954 >gb|AC154851.3| Download subject sequence spanning the HSP Mus musculus BAC clone RP23-28P10 from chromosome 13, complete sequence Length=234202 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 141 bits (76), Expect = 2e-29 Identities = 123/143 (86%), Gaps = 14/143 (9%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGAATT--G--T- 2225 ||||||||||||||||||||||||||||||||||||||||| |||| ||| || | | Sbjct 60119 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGGCAGGTGGATTTCTGAGTT 60060 Query 2226 -GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 ||||||| || | |||||| ||||||||||||||||||||||||||| | ||||| | Sbjct 60059 CGAGGCCAGCCTGGTCTACA---GAGTGAGTTCCAGGACAGCCAGGGCTA-G-AGAGA-A 60006 Query 2284 ACC-TGTCTCCAAAAACCAAAAA 2305 ||| |||||| |||||||||||| Sbjct 60005 ACCCTGTCTCGAAAAACCAAAAA 59983 Score = 128 bits (69), Expect = 1e-25 Identities = 121/144 (84%), Gaps = 12/144 (8%) Strand=Plus/Plus Query 2170 ATGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G- 2224 |||||||||||||||||||||| |||||||| |||||||||| |||| ||| | | | Sbjct 192767 ATGGTGGCGCACGCCTTTAATCCCAGCACTCGGGAGGCAGAGGCAGGCGGATTTCTGAGT 192826 Query 2225 T-GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAG 2282 | ||||||| || | ||| |||||||||||||||||||||||||||||| ||||| Sbjct 192827 TCGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA- 192882 Query 2283 AACC-TGTCTCCAAAAACCAAAAA 2305 |||| |||||| |||||||||||| Sbjct 192883 AACCCTGTCTCGAAAAACCAAAAA 192906 Score = 104 bits (56), Expect = 2e-18 Identities = 115/141 (81%), Gaps = 13/141 (9%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G-- 2224 ||||||||||||||||||||| ||||||| |||||||||| |||| ||| | | | Sbjct 114925 TGGTGGCGCACGCCTTTAATCTCAGCACTTGGGAGGCAGAGGCAGGCGGATCTCTGAGTT 114984 Query 2225 TGAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 |||||||| || | ||| |||||||||||||||||||||||||||||| | ||| | Sbjct 114985 TGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAAAGA-A 115040 Query 2284 ACC-TGTCTCCAAAAACCAAA 2303 ||| |||||| |||||| ||| Sbjct 115041 ACCCTGTCTCGAAAAAC-AAA 115060 Score = 104 bits (56), Expect = 2e-18 Identities = 118/145 (81%), Gaps = 16/145 (11%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGG-AGGCAGAGACAGG-AGGA-AT-T--G 2224 ||||||| || |||||||||| ||||||| || |||||||| |||| | || | | | Sbjct 115668 TGGTGGCACATGCCTTTAATCCCAGCACT-TGGAAGGCAGAGGCAGGCA-GATTTCTGAG 115611 Query 2225 -T-GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGA 2281 | ||||||| || | ||| ||||||||||||||||||||||||||||||| ||||| Sbjct 115610 TTCGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGA 115554 Query 2282 GAACC-TGTCTCCAAAAACCAAAAA 2305 |||| |||||| |||||||||||| Sbjct 115553 -AACCCTGTCTCAAAAAACCAAAAA 115530 Score = 95.3 bits (51), Expect = 1e-15 Identities = 115/143 (80%), Gaps = 15/143 (10%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGG---A----GGAATT 2223 ||||||| |||||||| |||| |||||||| |||||||||| |||| | || || Sbjct 151837 TGGTGGCACACGCCTTCAATCCCAGCACTCGGGAGGCAGAGGCAGGCATATTTCTGAGTT 151778 Query 2224 GTGAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAG 2282 |||||||| || | ||| |||||||||||||||||||||||||||||| ||||| Sbjct 151777 -TGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA- 151723 Query 2283 AACC-TGTCTCCAAAAACCAAAA 2304 |||| |||||| |||||| |||| Sbjct 151722 AACCCTGTCTCAAAAAAC-AAAA 151701 Score = 87.9 bits (47), Expect = 2e-13 Identities = 102/126 (80%), Gaps = 14/126 (11%) Strand=Plus/Minus Query 2183 CCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGAAT--T--G-T-GAGGCCATCC- 2235 ||||||||| ||||||| |||||||||| |||||||| | | | | ||||||| || Sbjct 153916 CCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGAGGATTCCTGAGTTCGAGGCCAGCCT 153857 Query 2236 GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAACC-TGTCTCCA 2294 | ||| |||||||||||||||||||||||||||||| ||||| |||| |||||| | Sbjct 153856 GGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA-AACCCTGTCTC-A 153802 Query 2295 -AAAAC 2299 ||||| Sbjct 153801 GAAAAC 153796 Score = 86.1 bits (46), Expect = 8e-13 Identities = 108/135 (80%), Gaps = 15/135 (11%) Strand=Plus/Minus Query 2181 CGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGG-AGGA-AT-T--G-T-GAGGCCAT 2233 ||||||||||| |||||||| |||||||||| |||| | || | | | | ||||||| Sbjct 160222 CGCCTTTAATCCCAGCACTCGGGAGGCAGAGGCAGGCA-GATTTCTCAGTTAGAGGCCAG 160164 Query 2234 CC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAACC-TGTCT 2291 || | ||| |||||||||||||||||||||||||||||| ||||| |||| ||||| Sbjct 160163 CCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA-AACCCTGTCT 160108 Query 2292 CC-AAAAACCAAAAA 2305 | ||||| ||||| Sbjct 160107 CGGAAAAAAAAAAAA 160093 >gb|AC147992.3| Download subject sequence spanning the HSP Mus musculus BAC clone RP24-384K8 from chromosome 18, complete sequence Length=239075 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 139 bits (75), Expect = 6e-29 Identities = 132/157 (84%), Gaps = 13/157 (8%) Strand=Plus/Minus Query 2157 CCCAAGCCTGAATATGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGG 2216 |||||||| | |||||||| ||||||||||||| |||||||| |||||||||| |||| Sbjct 108263 CCCAAGCCAG-GCATGGTGGCACACGCCTTTAATCCCAGCACTCGGGAGGCAGAGGCAGG 108205 Query 2217 AGGA-AT-TG---T-GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGG 2269 |||| | || | ||||||| || | ||||| | | |||||||||||||||||||||| Sbjct 108204 AGGATTTCTGAATTCGAGGCCAGCCTGGTCTAC-A-A-AGTGAGTTCCAGGACAGCCAGG 108148 Query 2270 GCTATGGAGAGAGAAC-CTGTCTCCAAAAACCAAAAA 2305 |||||| ||||| ||| ||||||| |||||||||||| Sbjct 108147 GCTATGCAGAGA-AACTCTGTCTCGAAAAACCAAAAA 108112 Score = 126 bits (68), Expect = 5e-25 Identities = 118/141 (83%), Gaps = 8/141 (5%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGAATTGTGAG-G 2229 ||||||| ||||||||||||| ||||||||||||||||||| |||| ||| || |||| Sbjct 212995 TGGTGGCACACGCCTTTAATCCCAGCACTCAGGAGGCAGAGGCAGGTGGATTTCTGAGTT 213054 Query 2230 CCA-TCCGA-TCT--ACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAAC 2285 ||| || | || | |||||||||||||||||||||||||||||| ||||| ||| Sbjct 213055 CCAGGCC-AGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA-AAC 213112 Query 2286 C-TGTCTCCAAAAACCAAAAA 2305 | |||||| |||||||||||| Sbjct 213113 CCTGTCTCGAAAAACCAAAAA 213133 Score = 102 bits (55), Expect = 8e-18 Identities = 113/140 (80%), Gaps = 8/140 (5%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGAATTGTGAG-G 2229 ||||||| ||||||||||||| ||||||| ||||| |||| |||| ||| || |||| Sbjct 166824 TGGTGGCACACGCCTTTAATCCCAGCACTTGGGAGGTAGAGGCAGGTGGATTTCTGAGTT 166883 Query 2230 CCA-TCCGA-TCT--ACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAAC 2285 | | || | || | |||||||||||||||||||||||||||||| ||||| ||| Sbjct 166884 CAAGGCC-AGGCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA-AAC 166941 Query 2286 C-TGTCTCCAAAAACCAAAA 2304 | |||||| ||||||||||| Sbjct 166942 CCTGTCTCGAAAAACCAAAA 166961 Score = 84.2 bits (45), Expect = 3e-12 Identities = 101/127 (79%), Gaps = 8/127 (6%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGAATTGTGAG-G 2229 ||||||| || |||||||||| ||||| | |||||||| | |||| ||| || |||| Sbjct 173040 TGGTGGCACATGCCTTTAATCCCAGCATTTGGGAGGCAGGGGCAGGTGGATTTCTGAGTT 172981 Query 2230 CCA-TCCGA-TCT--ACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAAC 2285 ||| || | || | |||||||||||||||||||||||||||||| |||||| ||| Sbjct 172980 CCAGGCC-AGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTACAGAGAGA-AAC 172923 Query 2286 C-TGTCT 2291 | ||||| Sbjct 172922 CCTGTCT 172916 >gb|AC124432.5| Download subject sequence spanning the HSP Mus musculus BAC clone RP24-243L15 from chromosome 18, complete sequence Length=160728 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 139 bits (75), Expect = 6e-29 Identities = 132/157 (84%), Gaps = 13/157 (8%) Strand=Plus/Plus Query 2157 CCCAAGCCTGAATATGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGG 2216 |||||||| | |||||||| ||||||||||||| |||||||| |||||||||| |||| Sbjct 133250 CCCAAGCCAG-GCATGGTGGCACACGCCTTTAATCCCAGCACTCGGGAGGCAGAGGCAGG 133308 Query 2217 AGGA-AT-TG---T-GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGG 2269 |||| | || | ||||||| || | ||||| | | |||||||||||||||||||||| Sbjct 133309 AGGATTTCTGAATTCGAGGCCAGCCTGGTCTAC-A-A-AGTGAGTTCCAGGACAGCCAGG 133365 Query 2270 GCTATGGAGAGAGAAC-CTGTCTCCAAAAACCAAAAA 2305 |||||| ||||| ||| ||||||| |||||||||||| Sbjct 133366 GCTATGCAGAGA-AACTCTGTCTCGAAAAACCAAAAA 133401 Score = 126 bits (68), Expect = 5e-25 Identities = 118/141 (83%), Gaps = 8/141 (5%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGAATTGTGAG-G 2229 ||||||| ||||||||||||| ||||||||||||||||||| |||| ||| || |||| Sbjct 28522 TGGTGGCACACGCCTTTAATCCCAGCACTCAGGAGGCAGAGGCAGGTGGATTTCTGAGTT 28463 Query 2230 CCA-TCCGA-TCT--ACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAAC 2285 ||| || | || | |||||||||||||||||||||||||||||| ||||| ||| Sbjct 28462 CCAGGCC-AGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA-AAC 28405 Query 2286 C-TGTCTCCAAAAACCAAAAA 2305 | |||||| |||||||||||| Sbjct 28404 CCTGTCTCGAAAAACCAAAAA 28384 Score = 102 bits (55), Expect = 8e-18 Identities = 113/140 (80%), Gaps = 8/140 (5%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGAATTGTGAG-G 2229 ||||||| ||||||||||||| ||||||| ||||| |||| |||| ||| || |||| Sbjct 74689 TGGTGGCACACGCCTTTAATCCCAGCACTTGGGAGGTAGAGGCAGGTGGATTTCTGAGTT 74630 Query 2230 CCA-TCCGA-TCT--ACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAAC 2285 | | || | || | |||||||||||||||||||||||||||||| ||||| ||| Sbjct 74629 CAAGGCC-AGGCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA-AAC 74572 Query 2286 C-TGTCTCCAAAAACCAAAA 2304 | |||||| ||||||||||| Sbjct 74571 CCTGTCTCGAAAAACCAAAA 74552 Score = 84.2 bits (45), Expect = 3e-12 Identities = 101/127 (79%), Gaps = 8/127 (6%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGAATTGTGAG-G 2229 ||||||| || |||||||||| ||||| | |||||||| | |||| ||| || |||| Sbjct 68477 TGGTGGCACATGCCTTTAATCCCAGCATTTGGGAGGCAGGGGCAGGTGGATTTCTGAGTT 68536 Query 2230 CCA-TCCGA-TCT--ACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAAC 2285 ||| || | || | |||||||||||||||||||||||||||||| |||||| ||| Sbjct 68537 CCAGGCC-AGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTACAGAGAGA-AAC 68594 Query 2286 C-TGTCT 2291 | ||||| Sbjct 68595 CCTGTCT 68601 >gb|AC026385.19|AC026385 Download subject sequence spanning the HSP Mus musculus 17 BAC RP23-413K14 complete sequence Length=222610 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 139 bits (75), Expect = 6e-29 Identities = 123/144 (85%), Gaps = 12/144 (8%) Strand=Plus/Minus Query 2170 ATGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G- 2224 |||||||||||||||||||||| ||||||||||||||||||| |||| ||| | | | Sbjct 131246 ATGGTGGCGCACGCCTTTAATCCCAGCACTCAGGAGGCAGAGGCAGGTGGATTTCTGAGT 131187 Query 2225 T-GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAG 2282 | ||||||| || | ||| ||||||||||||||||||||||||||||||| ||||| Sbjct 131186 TCGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGA- 131131 Query 2283 AACC-TGTCTCCAAAAACCAAAAA 2305 |||| |||||| |||||||||||| Sbjct 131130 AACCCTGTCTCGAAAAACCAAAAA 131107 Score = 104 bits (56), Expect = 2e-18 Identities = 116/143 (81%), Gaps = 12/143 (8%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G-T 2225 |||||| |||||||||||||| |||||||| ||| |||||| ||| ||| | | | | Sbjct 196142 TGGTGGTGCACGCCTTTAATCCCAGCACTCGGGAAGCAGAGGTAGGCGGATTTCTGAGTT 196083 Query 2226 -GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 ||||||| || | ||| |||||||||||||||||||||||||||||| ||||| | Sbjct 196082 CGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA-A 196027 Query 2284 ACC-TGTCTCCAAAAACCAAAAA 2305 ||| |||||| |||||| ||||| Sbjct 196026 ACCCTGTCTCGAAAAACAAAAAA 196004 Score = 104 bits (56), Expect = 2e-18 Identities = 117/144 (81%), Gaps = 14/144 (9%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTC-AGGAGGCAGAGACAGGAGGA-AT-T--G- 2224 ||||||||||||||||||||| ||||| || |||||||||| |||| ||| | | | Sbjct 212819 TGGTGGCGCACGCCTTTAATCCCAGCA-TCTGGGAGGCAGAGGCAGGCGGATTTCTGAGT 212877 Query 2225 T-GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAG 2282 | ||||||| || | ||| |||||||||||||||||||||||||||||| ||||| Sbjct 212878 TAGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA- 212933 Query 2283 AACC-TGTCTCCAAAAACCAAAAA 2305 |||| |||||| ||||| ||||| Sbjct 212934 AACCCTGTCTCAAAAAAAAAAAAA 212957 Score = 104 bits (56), Expect = 2e-18 Identities = 116/143 (81%), Gaps = 12/143 (8%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G-T 2225 ||||||| ||||||||||||| | ||||||||||||||||| |||| ||| | | | | Sbjct 218477 TGGTGGCTCACGCCTTTAATCCCTGCACTCAGGAGGCAGAGGCAGGCGGATTTCTGAGTT 218536 Query 2226 -GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 |||||| || | ||| ||||||||||||||||||||||||||||||| ||||| | Sbjct 218537 CAAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGA-A 218592 Query 2284 ACC-TGTCTCCAAAAACCAAAAA 2305 ||| ||||| |||| | ||||| Sbjct 218593 ACCCTGTCTGGAAAAGCAAAAAA 218615 Score = 93.5 bits (50), Expect = 5e-15 Identities = 115/144 (79%), Gaps = 13/144 (9%) Strand=Plus/Plus Query 2170 ATGGTGGCGCACGCCTTTAATCAC-AGCACTCAGGAGGCAGAGACAGGAGGAATT---G- 2224 |||||||| || |||||||||| | |||||| |||||||||| |||| ||| || | Sbjct 155121 ATGGTGGCTCAGGCCTTTAATC-CTAGCACTTGGGAGGCAGAGGCAGGTGGATTTCGAGT 155179 Query 2225 T-GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAG 2282 | |||||| || | ||| |||||||||||||||||||||||||||||| ||||| Sbjct 155180 TCAAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA- 155235 Query 2283 AACC-TGTCTCCAAAAACCAAAAA 2305 |||| |||||| ||||| ||||| Sbjct 155236 AACCCTGTCTCAAAAAAAAAAAAA 155259 Score = 86.1 bits (46), Expect = 8e-13 Identities = 113/143 (79%), Gaps = 14/143 (9%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G-T 2225 ||||||||||| |||||||| ||| | |||| ||||||| |||| ||| | | | | Sbjct 98680 TGGTGGCGCACACCTTTAAT-GCAG-AGGCAGGTGGCAGAGGCAGGCGGATTTCTGAGTT 98623 Query 2226 -GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 ||||||| || | ||| ||||||||||||||||||||||||||||||| |||| | Sbjct 98622 CGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACTGAGA-A 98567 Query 2284 ACCT-GTCTCCAAAAACCAAAAA 2305 ||| ||||| |||||| ||||| Sbjct 98566 ACCCCGTCTCGAAAAACAAAAAA 98544 Score = 78.7 bits (42), Expect = 1e-10 Identities = 88/109 (80%), Gaps = 8/109 (7%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G-- 2224 ||||| ||||| ||||||||| ||||||| |||||||||| ||| ||| | | | Sbjct 63857 TGGTGTCGCACACCTTTAATCCCAGCACTTGGGAGGCAGAGGGAGGTGGATTTCTGAGTT 63798 Query 2225 TGAGGCCATCCGATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTA 2273 |||||||| || | | | |||||||||||||||||||||||||||||| Sbjct 63797 TGAGGCCAACCTA-GT-CTACAGAGTGAGTTCCAGGACAGCCAGGGCTA 63751 Score = 54.7 bits (29), Expect = 0.002 Identities = 86/111 (77%), Gaps = 13/111 (11%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAATCAC-AGCACTCAGGAGG-CAGAGACAGGAGGA-AT-TGTG 2226 |||||| |||| ||||||||| | |||||| || || ||||| |||||||| | | || Sbjct 53299 TGGTGGTGCACACCTTTAATC-CTAGCACT-TGG-GGTCAGAGGCAGGAGGATCTCTATG 53243 Query 2227 AG-GCC--ATCCGATCTA--CAACAGAGTGAGTTCCAGGACAGCCAGGGCT 2272 || || || | ||| | |||||||||||||||||||||||||||| Sbjct 53242 AGTTCCAGAT-TAACCTAGTCTGCAGAGTGAGTTCCAGGACAGCCAGGGCT 53193 >emb|CT025760.12| Download subject sequence spanning the HSP Mouse DNA sequence from clone RP23-351E9 on chromosome 17, complete sequence Length=128479 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 139 bits (75), Expect = 6e-29 Identities = 123/144 (85%), Gaps = 12/144 (8%) Strand=Plus/Minus Query 2170 ATGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G- 2224 |||||||||||||||||||||| ||||||||||||||||||| |||| ||| | | | Sbjct 92830 ATGGTGGCGCACGCCTTTAATCCCAGCACTCAGGAGGCAGAGGCAGGTGGATTTCTGAGT 92771 Query 2225 T-GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAG 2282 | ||||||| || | ||| ||||||||||||||||||||||||||||||| ||||| Sbjct 92770 TCGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGA- 92715 Query 2283 AACC-TGTCTCCAAAAACCAAAAA 2305 |||| |||||| |||||||||||| Sbjct 92714 AACCCTGTCTCGAAAAACCAAAAA 92691 Score = 93.5 bits (50), Expect = 5e-15 Identities = 115/144 (79%), Gaps = 13/144 (9%) Strand=Plus/Plus Query 2170 ATGGTGGCGCACGCCTTTAATCAC-AGCACTCAGGAGGCAGAGACAGGAGGAATT---G- 2224 |||||||| || |||||||||| | |||||| |||||||||| |||| ||| || | Sbjct 116705 ATGGTGGCTCAGGCCTTTAATC-CTAGCACTTGGGAGGCAGAGGCAGGTGGATTTCGAGT 116763 Query 2225 T-GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAG 2282 | |||||| || | ||| |||||||||||||||||||||||||||||| ||||| Sbjct 116764 TCAAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA- 116819 Query 2283 AACC-TGTCTCCAAAAACCAAAAA 2305 |||| |||||| ||||| ||||| Sbjct 116820 AACCCTGTCTCAAAAAAAAAAAAA 116843 Score = 86.1 bits (46), Expect = 8e-13 Identities = 113/143 (79%), Gaps = 14/143 (9%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G-T 2225 ||||||||||| |||||||| ||| | |||| ||||||| |||| ||| | | | | Sbjct 60264 TGGTGGCGCACACCTTTAAT-GCAG-AGGCAGGTGGCAGAGGCAGGCGGATTTCTGAGTT 60207 Query 2226 -GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 ||||||| || | ||| ||||||||||||||||||||||||||||||| |||| | Sbjct 60206 CGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACTGAGA-A 60151 Query 2284 ACCT-GTCTCCAAAAACCAAAAA 2305 ||| ||||| |||||| ||||| Sbjct 60150 ACCCCGTCTCGAAAAACAAAAAA 60128 Score = 78.7 bits (42), Expect = 1e-10 Identities = 88/109 (80%), Gaps = 8/109 (7%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G-- 2224 ||||| ||||| ||||||||| ||||||| |||||||||| ||| ||| | | | Sbjct 25441 TGGTGTCGCACACCTTTAATCCCAGCACTTGGGAGGCAGAGGGAGGTGGATTTCTGAGTT 25382 Query 2225 TGAGGCCATCCGATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTA 2273 |||||||| || | | | |||||||||||||||||||||||||||||| Sbjct 25381 TGAGGCCAACCTA-GT-CTACAGAGTGAGTTCCAGGACAGCCAGGGCTA 25335 Score = 54.7 bits (29), Expect = 0.002 Identities = 86/111 (77%), Gaps = 13/111 (11%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAATCAC-AGCACTCAGGAGG-CAGAGACAGGAGGA-AT-TGTG 2226 |||||| |||| ||||||||| | |||||| || || ||||| |||||||| | | || Sbjct 14883 TGGTGGTGCACACCTTTAATC-CTAGCACT-TGG-GGTCAGAGGCAGGAGGATCTCTATG 14827 Query 2227 AG-GCC--ATCCGATCTA--CAACAGAGTGAGTTCCAGGACAGCCAGGGCT 2272 || || || | ||| | |||||||||||||||||||||||||||| Sbjct 14826 AGTTCCAGAT-TAACCTAGTCTGCAGAGTGAGTTCCAGGACAGCCAGGGCT 14777 >gb|AC124027.2| Download subject sequence spanning the HSP Mus musculus chromosome X clone RP21-282L18 map qA7.2, complete sequence Length=147432 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 137 bits (74), Expect = 2e-28 Identities = 117/137 (85%), Gaps = 6/137 (4%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGAATTGTGAGGC 2230 ||||||| ||||||||||||| ||||||| |||||||||| |||| ||| || |||||| Sbjct 67642 TGGTGGCTCACGCCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGCGGATTTCTGAGGC 67701 Query 2231 CATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAACC-TG 2288 || || | ||| ||||||||||||||||||||||||||||||| ||||| |||| || Sbjct 67702 CAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGA-AACCCTG 67757 Query 2289 TCTCCAAAAACCAAAAA 2305 |||| ||||| |||||| Sbjct 67758 TCTCGAAAAAACAAAAA 67774 Score = 115 bits (62), Expect = 1e-21 Identities = 117/141 (82%), Gaps = 13/141 (9%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G-T 2225 |||||||||||| |||||||| ||||||| |||||||||| |||| ||| | | | | Sbjct 93169 TGGTGGCGCACGTCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGTGGATTTCTGAGTT 93228 Query 2226 -GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 ||||||| || ||||| ||||||||||||||||||||||||||||||| ||||| | Sbjct 93229 CGAGGCCAGCCTGATCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGA-A 93284 Query 2284 ACC-TGTCTCCAAAAA-CCAA 2302 ||| |||||| ||||| |||| Sbjct 93285 ACCCTGTCTCAAAAAAACCAA 93305 Score = 97.1 bits (52), Expect = 4e-16 Identities = 117/145 (80%), Gaps = 17/145 (11%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCA-CTCAGGAGGCAGAGACAGGAGGA-AT-T--G- 2224 ||||||||||||||||||||| ||| | || |||||||||| |||| ||| | | | Sbjct 14690 TGGTGGCGCACGCCTTTAATCCCAG-AGCTTGGGAGGCAGAGGCAGGCGGATTTCTGAGT 14748 Query 2225 -TGAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAG 2282 |||||||| || | ||| |||||||||||||||||||||||||||||| ||||| Sbjct 14749 TTGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA- 14804 Query 2283 AACC-TGTCTCCAAAAACCAAAAAG 2306 |||| |||||| ||||| |||||| Sbjct 14805 AACCCTGTCTC-AAAAA--AAAAAG 14826 Score = 97.1 bits (52), Expect = 4e-16 Identities = 117/145 (80%), Gaps = 17/145 (11%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGG-AGGA-AT-T--G- 2224 ||||||||||||||||||||| ||||||| |||||||||| |||| | || | | | Sbjct 112320 TGGTGGCGCACGCCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGCA-GATTTCTGAGT 112262 Query 2225 T-GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAG 2282 | |||||| || | ||| |||||||||||||||||||||||||||||| ||||| Sbjct 112261 TCAAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA- 112206 Query 2283 AACC-TGTCTCCA-AAAACCAAAAA 2305 |||| |||||| | ||||| ||||| Sbjct 112205 AACCCTGTCTC-AGAAAAC-AAAAA 112183 Score = 78.7 bits (42), Expect = 1e-10 Identities = 55/61 (90%), Gaps = 2/61 (3%) Strand=Plus/Plus Query 2244 ACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAACC-TGTCTCCAAAAACCAA 2302 |||||||||||||||||||||||||||||| ||||| |||| |||||| ||||||||| Sbjct 98282 ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA-AACCCTGTCTCGAAAAACCAA 98340 Query 2303 A 2303 | Sbjct 98341 A 98341 >gb|AC124026.2| Download subject sequence spanning the HSP Mus musculus chromosome X clone RP21-564N13 map qA7.2, complete sequence Length=178239 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 137 bits (74), Expect = 2e-28 Identities = 117/137 (85%), Gaps = 6/137 (4%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGAATTGTGAGGC 2230 ||||||| ||||||||||||| ||||||| |||||||||| |||| ||| || |||||| Sbjct 41012 TGGTGGCTCACGCCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGCGGATTTCTGAGGC 41071 Query 2231 CATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAACC-TG 2288 || || | ||| ||||||||||||||||||||||||||||||| ||||| |||| || Sbjct 41072 CAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGA-AACCCTG 41127 Query 2289 TCTCCAAAAACCAAAAA 2305 |||| ||||| |||||| Sbjct 41128 TCTCGAAAAAACAAAAA 41144 Score = 115 bits (62), Expect = 1e-21 Identities = 117/141 (82%), Gaps = 13/141 (9%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G-T 2225 |||||||||||| |||||||| ||||||| |||||||||| |||| ||| | | | | Sbjct 66541 TGGTGGCGCACGTCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGTGGATTTCTGAGTT 66600 Query 2226 -GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 ||||||| || ||||| ||||||||||||||||||||||||||||||| ||||| | Sbjct 66601 CGAGGCCAGCCTGATCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGA-A 66656 Query 2284 ACC-TGTCTCCAAAAA-CCAA 2302 ||| |||||| ||||| |||| Sbjct 66657 ACCCTGTCTCAAAAAAACCAA 66677 Score = 115 bits (62), Expect = 1e-21 Identities = 119/144 (82%), Gaps = 14/144 (9%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGG-AGGA-AT-T--G- 2224 ||||||||||| ||||||||| |||||||| |||||||||| |||| | || | | | Sbjct 134245 TGGTGGCGCACACCTTTAATCCCAGCACTCGGGAGGCAGAGGCAGGCA-GATTTCTGAGT 134303 Query 2225 T-GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAG 2282 | ||||||| || | ||| ||||||||||||||||||||||||||||||| ||||| Sbjct 134304 TCGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGA- 134359 Query 2283 AACC-TGTCTCCAAAAACCAAAAA 2305 |||| ||||| |||||||||||| Sbjct 134360 AACCCTGTCTGGAAAAACCAAAAA 134383 Score = 97.1 bits (52), Expect = 4e-16 Identities = 117/145 (80%), Gaps = 17/145 (11%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGG-AGGA-AT-T--G- 2224 ||||||||||||||||||||| ||||||| |||||||||| |||| | || | | | Sbjct 85692 TGGTGGCGCACGCCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGCA-GATTTCTGAGT 85634 Query 2225 T-GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAG 2282 | |||||| || | ||| |||||||||||||||||||||||||||||| ||||| Sbjct 85633 TCAAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA- 85578 Query 2283 AACC-TGTCTCCA-AAAACCAAAAA 2305 |||| |||||| | ||||| ||||| Sbjct 85577 AACCCTGTCTC-AGAAAAC-AAAAA 85555 Score = 93.5 bits (50), Expect = 5e-15 Identities = 115/144 (79%), Gaps = 14/144 (9%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGAA--T-T--G- 2224 |||||| |||| ||||||||| ||||||| |||||||||| |||| ||| | | | Sbjct 174779 TGGTGGTGCACACCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGG-TGAATTTCTGAGT 174837 Query 2225 T-GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAG 2282 | ||||||| || | ||| |||||||||||||||||||||||||||||| ||||| Sbjct 174838 TCGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA- 174893 Query 2283 AACC-TGTCTCCAAAAACCAAAAA 2305 |||| ||| | |||||||||||| Sbjct 174894 AACCCTGTTTTGAAAAACCAAAAA 174917 Score = 78.7 bits (42), Expect = 1e-10 Identities = 55/61 (90%), Gaps = 2/61 (3%) Strand=Plus/Plus Query 2244 ACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAACC-TGTCTCCAAAAACCAA 2302 |||||||||||||||||||||||||||||| ||||| |||| |||||| ||||||||| Sbjct 71654 ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA-AACCCTGTCTCGAAAAACCAA 71712 Query 2303 A 2303 | Sbjct 71713 A 71713 >gb|AC124020.2| Download subject sequence spanning the HSP Mus musculus chromosome X clone RP21-564N13 map qA7.2, complete sequence Length=155466 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 137 bits (74), Expect = 2e-28 Identities = 117/137 (85%), Gaps = 6/137 (4%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGAATTGTGAGGC 2230 ||||||| ||||||||||||| ||||||| |||||||||| |||| ||| || |||||| Sbjct 33068 TGGTGGCTCACGCCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGCGGATTTCTGAGGC 33127 Query 2231 CATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAACC-TG 2288 || || | ||| ||||||||||||||||||||||||||||||| ||||| |||| || Sbjct 33128 CAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGA-AACCCTG 33183 Query 2289 TCTCCAAAAACCAAAAA 2305 |||| ||||| |||||| Sbjct 33184 TCTCGAAAAAACAAAAA 33200 Score = 115 bits (62), Expect = 1e-21 Identities = 117/141 (82%), Gaps = 13/141 (9%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G-T 2225 |||||||||||| |||||||| ||||||| |||||||||| |||| ||| | | | | Sbjct 58597 TGGTGGCGCACGTCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGTGGATTTCTGAGTT 58656 Query 2226 -GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 ||||||| || ||||| ||||||||||||||||||||||||||||||| ||||| | Sbjct 58657 CGAGGCCAGCCTGATCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGA-A 58712 Query 2284 ACC-TGTCTCCAAAAA-CCAA 2302 ||| |||||| ||||| |||| Sbjct 58713 ACCCTGTCTCAAAAAAACCAA 58733 Score = 115 bits (62), Expect = 1e-21 Identities = 119/144 (82%), Gaps = 14/144 (9%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGG-AGGA-AT-T--G- 2224 ||||||||||| ||||||||| |||||||| |||||||||| |||| | || | | | Sbjct 126301 TGGTGGCGCACACCTTTAATCCCAGCACTCGGGAGGCAGAGGCAGGCA-GATTTCTGAGT 126359 Query 2225 T-GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAG 2282 | ||||||| || | ||| ||||||||||||||||||||||||||||||| ||||| Sbjct 126360 TCGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGA- 126415 Query 2283 AACC-TGTCTCCAAAAACCAAAAA 2305 |||| ||||| |||||||||||| Sbjct 126416 AACCCTGTCTGGAAAAACCAAAAA 126439 Score = 97.1 bits (52), Expect = 4e-16 Identities = 117/145 (80%), Gaps = 17/145 (11%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGG-AGGA-AT-T--G- 2224 ||||||||||||||||||||| ||||||| |||||||||| |||| | || | | | Sbjct 77748 TGGTGGCGCACGCCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGCA-GATTTCTGAGT 77690 Query 2225 T-GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAG 2282 | |||||| || | ||| |||||||||||||||||||||||||||||| ||||| Sbjct 77689 TCAAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA- 77634 Query 2283 AACC-TGTCTCCA-AAAACCAAAAA 2305 |||| |||||| | ||||| ||||| Sbjct 77633 AACCCTGTCTC-AGAAAAC-AAAAA 77611 Score = 78.7 bits (42), Expect = 1e-10 Identities = 55/61 (90%), Gaps = 2/61 (3%) Strand=Plus/Plus Query 2244 ACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAACC-TGTCTCCAAAAACCAA 2302 |||||||||||||||||||||||||||||| ||||| |||| |||||| ||||||||| Sbjct 63710 ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA-AACCCTGTCTCGAAAAACCAA 63768 Query 2303 A 2303 | Sbjct 63769 A 63769 >gb|AC117693.9| Download subject sequence spanning the HSP Mus musculus chromosome 1, clone RP23-448D22, complete sequence Length=193386 Score = 137 bits (74), Expect = 2e-28 Identities = 122/143 (85%), Gaps = 12/143 (8%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G-T 2225 ||||||||||||||||||||| ||||||||||||||||||| |||| ||| | | | | Sbjct 141942 TGGTGGCGCACGCCTTTAATCCCAGCACTCAGGAGGCAGAGGCAGGTGGATTTCTGAGAT 142001 Query 2226 -GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 ||||||| || | ||| ||||||||||||||||||||||||||||||| ||||| | Sbjct 142002 CGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGA-A 142057 Query 2284 ACC-TGTCTCCAAAAACCAAAAA 2305 ||| |||||| |||||||||||| Sbjct 142058 ACCCTGTCTCAAAAAACCAAAAA 142080 >gb|AC117663.13| Download subject sequence spanning the HSP Mus musculus chromosome 5, clone RP23-354E8, complete sequence Length=197426 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 137 bits (74), Expect = 2e-28 Identities = 122/143 (85%), Gaps = 12/143 (8%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G-- 2224 |||||||||| |||||||||| ||||||||||||||||||| |||| ||| | | | Sbjct 111538 TGGTGGCGCATGCCTTTAATCCCAGCACTCAGGAGGCAGAGGCAGGTGGATTTCTGAGTT 111597 Query 2225 TGAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 |||||||| || ||||| ||||||||||||||||||||||||||||||| ||||| | Sbjct 111598 TGAGGCCAGCCTGATCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGA-A 111653 Query 2284 ACC-TGTCTCCAAAAACCAAAAA 2305 ||| |||||| |||||||||||| Sbjct 111654 ACCCTGTCTCGAAAAACCAAAAA 111676 Score = 126 bits (68), Expect = 5e-25 Identities = 121/144 (84%), Gaps = 14/144 (9%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G-T 2225 ||||||| ||||||||||||| ||||||||||||||||||| |||| ||| | | | | Sbjct 172388 TGGTGGCACACGCCTTTAATCCCAGCACTCAGGAGGCAGAGGCAGGTGGATTTCTGAGTT 172447 Query 2226 -GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 ||||||| || | ||| ||||||||||||||||||||||||||||||| ||||| | Sbjct 172448 CGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGA-A 172503 Query 2284 ACC-TGTCTCCAAA-AACCAAAAA 2305 ||| |||||| ||| ||||||||| Sbjct 172504 ACCCTGTCTC-AAACAACCAAAAA 172526 Score = 117 bits (63), Expect = 3e-22 Identities = 122/148 (82%), Gaps = 14/148 (9%) Strand=Plus/Plus Query 2170 ATGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G- 2224 |||||||| ||| ||||||||| ||||||||||||||||||| |||| ||| | | | Sbjct 79112 ATGGTGGCACACACCTTTAATCCCAGCACTCAGGAGGCAGAGGCAGGCGGATTTCTGAGT 79171 Query 2225 T-GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAG 2282 | ||||||| || | ||| |||||||||||||||||||||||||||||| ||||| Sbjct 79172 TCGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA- 79227 Query 2283 AACC-TGTCTCCAAAAA--CCAAAAAGA 2307 |||| |||||| ||||| ||||||||| Sbjct 79228 AACCCTGTCTCGAAAAAAACCAAAAAGA 79255 Score = 113 bits (61), Expect = 4e-21 Identities = 109/130 (83%), Gaps = 12/130 (9%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G-T 2225 ||||||||||||||||||||| |||||||| |||||||||| |||| ||| | | | | Sbjct 95076 TGGTGGCGCACGCCTTTAATCCCAGCACTCGGGAGGCAGAGGCAGGTGGATTTCTGAGTT 95135 Query 2226 -GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 ||||||| || | ||| ||||||||||||||||||||||||||||||| ||||| | Sbjct 95136 CGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGA-A 95191 Query 2284 ACC-TGTCTC 2292 ||| |||||| Sbjct 95192 ACCCTGTCTC 95201 Score = 110 bits (59), Expect = 5e-20 Identities = 118/144 (81%), Gaps = 14/144 (9%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGAA--T-T--G- 2224 |||||| ||| ||||||||||||||||||| |||||||||| |||| ||| | | | Sbjct 75388 TGGTGGTGCATGCCTTTAATCACAGCACTCGGGAGGCAGAGGCAGG-CGAATTTCTGAGT 75330 Query 2225 T-GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAG 2282 | |||| || || | ||| |||||||||||||||||||||||||||||| ||||| Sbjct 75329 TCGAGGACAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA- 75274 Query 2283 AACC-TGTCTCCAAAAACCAAAAA 2305 |||| |||||| |||||||||||| Sbjct 75273 AACCCTGTCTCGAAAAACCAAAAA 75250 Score = 102 bits (55), Expect = 8e-18 Identities = 113/140 (80%), Gaps = 8/140 (5%) Strand=Plus/Plus Query 2172 GGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACA-GGAGGAATTGTGAG-G 2229 |||||| ||||||||||||| |||||||||||||||| || || ||| || || |||| Sbjct 81082 GGTGGCACACGCCTTTAATCCCAGCACTCAGGAGGCAAAGGCAGGGA-GATTTCTGAGTT 81140 Query 2230 CCA-TCC-G-ATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAACC 2286 | | || | | | | |||||||||||||||||||||||||||||| ||||| |||| Sbjct 81141 CAAGGCCAGCCTGTTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA-AACC 81199 Query 2287 -TGTCTCCAAAAACCAAAAA 2305 |||||| ||||| ||||| Sbjct 81200 CTGTCTCAAAAAAAAAAAAA 81219 Score = 102 bits (55), Expect = 8e-18 Identities = 116/143 (81%), Gaps = 13/143 (9%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G-T 2225 |||||| ||| |||||||||| |||||||| |||||||||| |||| ||| | | | | Sbjct 180187 TGGTGGTGCATGCCTTTAATCCCAGCACTCGGGAGGCAGAGGCAGGTGGATTTCTGAGTT 180246 Query 2226 -GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 ||||||| || | ||| |||||||||||||||||||||||||||||| | ||||| Sbjct 180247 CGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTAC--ACAGAGA 180301 Query 2284 ACCTGTCTCC-AAAAACCAAAAA 2305 ||||||||| ||||| ||||| Sbjct 180302 ACCTGTCTCGGAAAAAAAAAAAA 180324 Score = 91.6 bits (49), Expect = 2e-14 Identities = 114/143 (79%), Gaps = 14/143 (9%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGG-AGGA-AT-TG--- 2224 ||||||| ||| ||||||||| ||||||| |||| ||||| |||| | || | || Sbjct 70446 TGGTGGCACACACCTTTAATCCCAGCACTTGGGAGACAGAGGCAGGCA-GATTTCTGAAT 70388 Query 2225 T-GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAG 2282 | |||||| || | ||| |||||||||||||||||||||||||||||| ||||| Sbjct 70387 TCAAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA- 70332 Query 2283 AACC-TGTCTCCAAAAACCAAAA 2304 |||| |||||| ||||||||||| Sbjct 70331 AACCCTGTCTCAAAAAACCAAAA 70309 Score = 71.3 bits (38), Expect = 2e-08 Identities = 56/64 (87%), Gaps = 4/64 (6%) Strand=Plus/Plus Query 2244 ACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAA-CC-TGTCTCCAAAAACCA 2301 ||||||||||||||||||||||||||||| | | |||||| || ||||| |||||||| Sbjct 119376 ACAGAGTGAGTTCCAGGACAGCCAGGGCT--GCACAGAGAAACCCTGTCTGGAAAAACCA 119433 Query 2302 AAAA 2305 |||| Sbjct 119434 AAAA 119437 >gb|AC115880.11| Download subject sequence spanning the HSP Mus musculus chromosome 9, clone RP24-365N15, complete sequence Length=202851 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 137 bits (74), Expect = 2e-28 Identities = 118/138 (85%), Gaps = 7/138 (5%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGAATTGTGAGGC 2230 ||||||||||||||||||||| |||||||| |||||||||| |||| ||| || |||||| Sbjct 152511 TGGTGGCGCACGCCTTTAATCCCAGCACTCGGGAGGCAGAGGCAGGTGGATTTCTGAGGC 152570 Query 2231 CATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAACC-TG 2288 | || | ||| |||||||||||||||||||||||||||||| ||||| |||| || Sbjct 152571 TAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA-AACCCTG 152626 Query 2289 TCTCCAAAAACCAA-AAA 2305 |||| ||||||||| ||| Sbjct 152627 TCTCGAAAAACCAATAAA 152644 Score = 106 bits (57), Expect = 6e-19 Identities = 115/141 (81%), Gaps = 12/141 (8%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCA-GAGACAGGAGGAATTGTGAG- 2228 ||||||| ||||||||||||| |||||||| ||||||| ||| |||| ||| || |||| Sbjct 86553 TGGTGGCACACGCCTTTAATCCCAGCACTCGGGAGGCAGGAG-CAGGCGGATTTCTGAGT 86611 Query 2229 GCCA-TCCGA-TCT--ACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGAA 2284 ||| || | || | |||||||||||||||||||||||||||||| | |||||| Sbjct 86612 TCCAGGCC-AGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTAC--ACAGAGAA 86668 Query 2285 -CC-TGTCTCCAAAAACCAAA 2303 || |||||| |||||||||| Sbjct 86669 TCCCTGTCTCAAAAAACCAAA 86689 Score = 102 bits (55), Expect = 8e-18 Identities = 111/136 (81%), Gaps = 12/136 (8%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G-T 2225 |||||| ||| |||||||||| ||||||| ||||||||||||||| ||| | | | | Sbjct 82915 TGGTGGTGCATGCCTTTAATCCCAGCACTTGGGAGGCAGAGACAGGTGGATTTCTGAGTT 82856 Query 2226 -GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 ||||||| || | ||| ||||||||||||||||||||||||||||||| ||||| | Sbjct 82855 CGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGA-A 82800 Query 2284 ACC-TGTCTCCAAAAA 2298 ||| ||||| ||||| Sbjct 82799 ACCCTGTCTTGAAAAA 82784 Score = 95.3 bits (51), Expect = 1e-15 Identities = 114/142 (80%), Gaps = 13/142 (9%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTT-AATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G- 2224 |||||| ||||| |||| |||| ||||||| |||||||||| |||| ||| | | | Sbjct 23660 TGGTGGTGCACGTCTTTAAATCCCAGCACTTGGGAGGCAGAGGCAGGCGGATTTCTGAGT 23601 Query 2225 -TGAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAG 2282 |||||||| || | ||| |||||||||||||||||||||||||||| | ||||| Sbjct 23600 TTGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCGACACAGAGA- 23545 Query 2283 AACC-TGTCTCCAAAAACCAAA 2303 |||| |||||| |||||||||| Sbjct 23544 AACCCTGTCTCAAAAAACCAAA 23523 Score = 91.6 bits (49), Expect = 2e-14 Identities = 105/130 (80%), Gaps = 12/130 (9%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G-- 2224 ||||||| ||| ||||||||| |||||||| |||||||||| |||| ||| | | | Sbjct 193367 TGGTGGCACACACCTTTAATCCCAGCACTCGGGAGGCAGAGGCAGGCGGATTTCTGAGTT 193308 Query 2225 TGAGGCCA-TCCGATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 |||||||| || | ||| |||||||||||||||||||||||||||||| ||| | | Sbjct 193307 TGAGGCCAGTCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAAA-A 193252 Query 2284 ACC-TGTCTC 2292 ||| |||||| Sbjct 193251 ACCCTGTCTC 193242 Score = 91.6 bits (49), Expect = 2e-14 Identities = 109/136 (80%), Gaps = 12/136 (8%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G-T 2225 |||||| ||| |||||||||| ||||||| ||| |||||| |||| ||| | | | | Sbjct 196661 TGGTGGTGCATGCCTTTAATCCCAGCACTTGGGAAGCAGAGGCAGGTGGATTTCTGAGTT 196720 Query 2226 -GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 ||||||| || | ||| |||||||||||||||||||||||||||||| ||||| | Sbjct 196721 CGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA-A 196776 Query 2284 ACC-TGTCTCCAAAAA 2298 ||| |||||| ||||| Sbjct 196777 ACCCTGTCTCAAAAAA 196792 Score = 78.7 bits (42), Expect = 1e-10 Identities = 104/131 (79%), Gaps = 16/131 (12%) Strand=Plus/Plus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCAC-TCAGGAGGCAGAGACAGG-AGGA-AT-T--G 2224 ||||||| ||||||||||||| |||||| | ||||||||| ||||| | || | | | Sbjct 79697 TGGTGGCACACGCCTTTAATCCCAGCACAT-GGGAGGCAGAAACAGGCA-GATTTCTGAG 79754 Query 2225 -T-GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGA 2281 | |||||| || | ||| |||||||||||||||||||||||||||||| ||||| Sbjct 79755 TTCAAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGA 79811 Query 2282 GAACC-TGTCT 2291 |||| ||||| Sbjct 79812 -AACCCTGTCT 79821 Score = 76.8 bits (41), Expect = 5e-10 Identities = 55/61 (90%), Gaps = 3/61 (4%) Strand=Plus/Plus Query 2244 ACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAG-AGAACC-TGTCTCCAAAAACCA 2301 ||||||||||||||||||||||||||||||| |||| | |||| |||||| |||||||| Sbjct 60240 ACAGAGTGAGTTCCAGGACAGCCAGGGCTATATAGAGTA-AACCCTGTCTCAAAAAACCA 60298 Query 2302 A 2302 | Sbjct 60299 A 60299 >gb|AC159973.2| Download subject sequence spanning the HSP Mus musculus chromosome 1, clone RP24-207D15, complete sequence Length=136567 Score = 137 bits (74), Expect = 2e-28 Identities = 122/143 (85%), Gaps = 12/143 (8%) Strand=Plus/Minus Query 2171 TGGTGGCGCACGCCTTTAATCACAGCACTCAGGAGGCAGAGACAGGAGGA-AT-T--G-T 2225 ||||||||||||||||||||| ||||||||||||||||||| |||| ||| | | | | Sbjct 131228 TGGTGGCGCACGCCTTTAATCCCAGCACTCAGGAGGCAGAGGCAGGTGGATTTCTGAGAT 131169 Query 2226 -GAGGCCATCC-GATCTACAACAGAGTGAGTTCCAGGACAGCCAGGGCTATGGAGAGAGA 2283 ||||||| || | ||| ||||||||||||||||||||||||||||||| ||||| | Sbjct 131168 CGAGGCCAGCCTGGTCT---ACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGA-A 131113 Query 2284 ACC-TGTCTCCAAAAACCAAAAA 2305 ||| |||||| |||||||||||| Sbjct 131112 ACCCTGTCTCAAAAAACCAAAAA 131090
  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS,environmental 
samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Jun 2, 2007  5:48 PM
  Number of letters in database: -698,956,079
  Number of sequences in database:  5,319,389
Lambda     K      H
    1.33    0.621     1.12 
Gapped
Lambda     K      H
    1.33    0.621     1.12 
Matrix: blastn matrix:1 -2
Gap Penalties: Existence: 0, Extension: 0
Number of Sequences: 5319389
Number of Hits to DB: 6726015
Number of extensions: 5955
Number of successful extensions: 5955
Number of sequences better than 10: 1788
Number of HSP's better than 10 without gapping: 0
Number of HSP's gapped: 5950
Number of HSP's successfully gapped: 5949
Length of query: 3143
Length of database: 20775880397
Length adjustment: 34
Effective length of query: 3109
Effective length of database: 20595021171
Effective search space: 64029920820639
Effective search space used: 64029920820639
A: 0
X1: 15 (28.8 bits)
X2: 32 (59.1 bits)
X3: 54 (99.7 bits)
S1: 15 (28.8 bits)
S2: 23 (43.6 bits)