spacer

ClustalW Results


Results of search
Number of sequences 11
Alignment score 733264
Sequence format Pearson
Sequence type nt
ClustalW version 1.83
JalView
Output file clustalw-20070603-20423073.output
Alignment file clustalw-20070603-20423073.aln
Guide tree file clustalw-20070603-20423073.dnd
Your input file clustalw-20070603-20423073.input

To save a result file right-click the file link in the above table and choose "Save Target As".
If you cannot see the JalView button, reload the page and check your browser settings to enable Java Applets.




Scores Table

SeqA Name          Len(nt)  SeqB Name          Len(nt)  Score
=============================================================
1    Mus           3143     2    M.musculus    2560     96   
1    Mus           3143     3    R.            1955     92   
1    Mus           3143     4    H.sapiens     3031     78   
1    Mus           3143     5    Macaca        3779     68   
1    Mus           3143     6    Pan           3252     67   
1    Mus           3143     7    Pongo         3554     74   
1    Mus           3143     8    Bos           3025     77   
1    Mus           3143     9    Canis         3013     69   
1    Mus           3143     10   Monodelphis   1734     67   
1    Mus           3143     11   Xenopus       3979     34   
2    M.musculus    2560     3    R.            1955     62   
2    M.musculus    2560     4    H.sapiens     3031     64   
2    M.musculus    2560     5    Macaca        3779     65   
2    M.musculus    2560     6    Pan           3252     64   
2    M.musculus    2560     7    Pongo         3554     72   
2    M.musculus    2560     8    Bos           3025     71   
2    M.musculus    2560     9    Canis         3013     61   
2    M.musculus    2560     10   Monodelphis   1734     42   
2    M.musculus    2560     11   Xenopus       3979     27   
3    R.            1955     4    H.sapiens     3031     84   
3    R.            1955     5    Macaca        3779     80   
3    R.            1955     6    Pan           3252     81   
3    R.            1955     7    Pongo         3554     80   
3    R.            1955     8    Bos           3025     82   
3    R.            1955     9    Canis         3013     83   
3    R.            1955     10   Monodelphis   1734     67   
3    R.            1955     11   Xenopus       3979     55   
4    H.sapiens     3031     5    Macaca        3779     92   
4    H.sapiens     3031     6    Pan           3252     96   
4    H.sapiens     3031     7    Pongo         3554     95   
4    H.sapiens     3031     8    Bos           3025     85   
4    H.sapiens     3031     9    Canis         3013     76   
4    H.sapiens     3031     10   Monodelphis   1734     69   
4    H.sapiens     3031     11   Xenopus       3979     35   
5    Macaca        3779     6    Pan           3252     86   
5    Macaca        3779     7    Pongo         3554     92   
5    Macaca        3779     8    Bos           3025     82   
5    Macaca        3779     9    Canis         3013     73   
5    Macaca        3779     10   Monodelphis   1734     82   
5    Macaca        3779     11   Xenopus       3979     28   
6    Pan           3252     7    Pongo         3554     88   
6    Pan           3252     8    Bos           3025     83   
6    Pan           3252     9    Canis         3013     75   
6    Pan           3252     10   Monodelphis   1734     70   
6    Pan           3252     11   Xenopus       3979     33   
7    Pongo         3554     8    Bos           3025     83   
7    Pongo         3554     9    Canis         3013     74   
7    Pongo         3554     10   Monodelphis   1734     82   
7    Pongo         3554     11   Xenopus       3979     30   
8    Bos           3025     9    Canis         3013     77   
8    Bos           3025     10   Monodelphis   1734     68   
8    Bos           3025     11   Xenopus       3979     36   
9    Canis         3013     10   Monodelphis   1734     67   
9    Canis         3013     11   Xenopus       3979     35   
10   Monodelphis   1734     11   Xenopus       3979     61   
=============================================================
PLEASE NOTE: Some scores may be missing from the above table if the alignment was done using multiple CPU mode. Please check the output.




Alignment

CLUSTAL W (1.83) multiple sequence alignment


Mus              ------------------------------------------------------------
M.musculus       ------------------------------------------------------------
H.sapiens        ------------------------------------------------------------
Pan              ------------------------------------------------------------
Macaca           CTTTTCCACCCGCAGCTGCCTCTGTTTCCTCCCTCATTCCCCTCTAGCCTGGCTTCCTGC 60
Pongo            ------------------------------------------------------------
Bos              ------------------------------------------------------------
Canis            ------------------------------------------------------------
R.               ------------------------------------------------------------
Monodelphis      ------------------------------------------------------------
Xenopus          ------------------------------------------------------------
                                                                             

Mus              ------------------------------------------------------------
M.musculus       ------------------------------------------------------------
H.sapiens        ------------------------------------------------------------
Pan              ------------------------------------------------------------
Macaca           CCCCTTTGGCCTGCCTGTGTCCGGTTTCGAGTGACCCAGACCTCCTATCTCCTTTCTTTC 120
Pongo            ------------------------------------------------------------
Bos              ------------------------------------------------------------
Canis            ------------------------------------------------------------
R.               ------------------------------------------------------------
Monodelphis      ------------------------------------------------------------
Xenopus          ------------------------------------------------------------
                                                                             

Mus              ------------------------------------------------------------
M.musculus       ------------------------------------------------------------
H.sapiens        ------------------------------------------------------------
Pan              ------------------------------------------------------------
Macaca           CGTCCAACTCCTCCATGCTTCCCTCCCACCCCCACTTTCCTTCTCCCCAGATTACTAGTT 180
Pongo            ------------------------------------------------------------
Bos              ------------------------------------------------------------
Canis            ------------------------------------------------------------
R.               ------------------------------------------------------------
Monodelphis      ------------------------------------------------------------
Xenopus          ------------------------------------------------------------
                                                                             

Mus              ------------------------------------------------------------
M.musculus       ------------------------------------------------------------
H.sapiens        ------------------------------------------------------------
Pan              ------------------------------------------------------------
Macaca           GTTTGTGTAGGGCAGGGGAGAGGAGCTTGGATAGCCCTACCCTCTGCTCCAGTCCGAGGT 240
Pongo            ------------------------------------------------------------
Bos              ------------------------------------------------------------
Canis            ------------------------------------------------------------
R.               ------------------------------------------------------------
Monodelphis      ------------------------------------------------------------
Xenopus          ------------------------------------------------------------
                                                                             

Mus              ------------------------------------------------------------
M.musculus       ------------------------------------------------------------
H.sapiens        ------------------------------------------------------------
Pan              ------------------------------------------------------------
Macaca           TGGGGCGGGGTGGGGGCTCAGCCCCTCTGAGCCTGTGAGTCAGCACTGTCCTCGTGATTG 300
Pongo            ------------------------------------------------------------
Bos              ------------------------------------------------------------
Canis            ------------------------------------------------------------
R.               ------------------------------------------------------------
Monodelphis      ------------------------------------------------------------
Xenopus          ------------------------------------------------------------
                                                                             

Mus              ------------------------------------------------------------
M.musculus       ------------------------------------------------------------
H.sapiens        ------------------------------------------------------------
Pan              ------------------------------------------------------------
Macaca           GTCTCTCCCTTTAGCTCTCCGCCCCTGGGGAGGAGCCAGGCAGCTCTGGGTCCAGCCTGT 360
Pongo            ------------------------------------------------------------
Bos              ------------------------------------------------------------
Canis            ------------------------------------------------------------
R.               ------------------------------------------------------------
Monodelphis      ------------------------------------------------------------
Xenopus          ------------------------------------------------------------
                                                                             

Mus              ------------------------------------------------------------
M.musculus       ------------------------------------------------------------
H.sapiens        ------------------------------------------------------------
Pan              ------------------------------------------------------------
Macaca           TCTCTTCTCAGCCAGAGAAGAGGCTCCACGTTGGGCGGGGATGGGGCCCGAAACTGTCTG 420
Pongo            -------------AGAGAAGAGGCTCCACGTTGGGCGGGGATGGGGCCTGAAACTGTCTG 47
Bos              ------------------------------------------------------------
Canis            ------------------------------------------------------------
R.               ------------------------------------------------------------
Monodelphis      ------------------------------------------------------------
Xenopus          ------------------------------------------------------------
                                                                             

Mus              ------------------------------------------------------------
M.musculus       ------------------------------------------------------------
H.sapiens        ------------------------------------------------------------
Pan              ------------------------------------------------------------
Macaca           GGTCTGAGCTGGGGAGCGGAAGCCACTTGTCCCTCTCCCTCCCCAGGACTTCTGTGACTC 480
Pongo            GGTCTGAGCTGGGGAGCGGAAGCCACTTGTCCCTCTCCCTCCCCAGGACTTCTGTGACTC 107
Bos              ------------------------------------------------------------
Canis            ------------------------------------------------------------
R.               ------------------------------------------------------------
Monodelphis      ------------------------------------------------------------
Xenopus          ------------------------------------------------------------
                                                                             

Mus              ------------------------------------------------------------
M.musculus       ------------------------------------------------------------
H.sapiens        ------------------------------------------------------------
Pan              ------------------------------------------------------------
Macaca           GTGGGCCACAGAGGTCCGACCAGGCTAAGGGCC--------------------------- 513
Pongo            CTGGGCCACAGAGGTCCAACCAGGCTAAGGGCCTGGGGATACCCCCTGCCTGGCCCCCTT 167
Bos              ------------------------------------------------------------
Canis            ------------------------------------------------------------
R.               ------------------------------------------------------------
Monodelphis      ------------------------------------------------------------
Xenopus          ------------------------------------------------------------
                                                                             

Mus              ------------------------------------------------------------
M.musculus       ------------------------------------------------------------
H.sapiens        ------------------------------------------------------------
Pan              ------------------------------------------------------------
Macaca           ---------------------AGGCCGGGCAGCAGCCCCTCTCTCACCTCAGCTATGGAT 552
Pongo            GCCCAAACTGGCAGGGGGGCCAGGCTGGGCAGCAGCCCCTCTTTCACCTCAGCTATGGAT 227
Bos              ------------------------------------------------------------
Canis            ------------------------------------------------------------
R.               ------------------------------------------------------------
Monodelphis      ------------------------------------------------------ATGGAT 6
Xenopus          ------------------------------------------------------------
                                                                             

Mus              ------------------------------------------------------------
M.musculus       ------------------------------------------------------------
H.sapiens        ------------------------------------------------------------
Pan              ------------------------------------------------------------
Macaca           CTCCTGCCCCCCAAGCCCAAGTACAATCCACTCCGGAATGAGTCTCTGTCATCGCTGGAG 612
Pongo            CTCCTGCCCCCCAAGCCCAAGTACAATCCACTCCGGAATGAGTCTCTGTCATCGCTGGAG 287
Bos              ------------------------------------------------------------
Canis            ------------------------------------------------------------
R.               ------------------------------------------------------------
Monodelphis      CTCCTGCCTCCTAAGCCTAAGTACAACCCTCTTCGGAATGAATCTATATCATCATTGGAA 66
Xenopus          ------------------------------------------------------------
                                                                             

Mus              ------------------------------------------------------------
M.musculus       ------------------------------------------------------------
H.sapiens        ------------------------------------------------------------
Pan              -------------------------------------CCGCCCTCGCTCTTGGGTTCTGG 23
Macaca           GAGGGGGCTTCAGGGTCCACCCCCCCGGAGGAGCTGCCTTCCCCATCAGCTTCATCCCTG 672
Pongo            GAAGGGGCTTCTGGGTCCACCCCCCCGGAGGAGCTGCCTTCTCCATCAGCTTCATCCCTG 347
Bos              ------------------------------------------------------------
Canis            ------------------------------------------------------------
R.               ------------------------------------------------------------
Monodelphis      GAGGGGACTCTGGGATCCTTATCCCCTGGGGAACTCTCCTCCCCATCTGCCTCTTCCCTG 126
Xenopus          ------------------------------------------------------------
                                                                             

Mus              ------------------------------------------------------------
M.musculus       ------------------------------------------------------------
H.sapiens        ------------------------------------------------------------
Pan              GGGCATGAGCTGGCGTGGAAAAGGACGGACGAAGGACACTGCAGTAGTCTCGAGCCTAGT 83
Macaca           GGGCCCATCCTGCCTCCTCTGCCTGGGGACGATAGTCCC---ACTACTCTGTGCTCCTTC 729
Pongo            GGGCCCATCCTGCCTCCTCTGCCTGGGGACGATAGTCCC---ACTACCCTGTGCTCCTTC 404
Bos              ------------------------------------------------------------
Canis            -------------------------------------GGAGGGACGCTGAGGTAGAGGGT 23
R.               ------------------------------------------------------------
Monodelphis      GGACCCATCTTGCCCTCCATGCTGGGGGATGAGAGTCCT---ACAACCCTTTGCTCTTTC 183
Xenopus          ------------------------------------------------------------
                                                                             

Mus              --------------------------------------------------GGACGCGTGG 10
M.musculus       ------------------------------------------------------------
H.sapiens        ------------------------------------------------------------
Pan              GAACCCCGAGCCAGGAGACAAAAGTGGGGTACACTCACCTCTCAGCCGTCGGGTCCGCTG 143
Macaca           TTCCCCCGGATGAGCAACCTGAGGCTGGCCAACCCGGCTGGGGGGCGCCCAGGGTCTAAG 789
Pongo            TTCCCCCGGATGAGCAACCTGAGGCTGGCCAACCCGGCTGGGGGGCGCCCAGGGTCTAAG 464
Bos              ------------------------------------------------------------
Canis            CAGGGGTTAGTGAGGCCGGAAGTGAGTGCAATAAAGTTTCTTCAGGGAGGCCAGGCCGGG 83
R.               -------------------------------------------------CCCAGGCCGGG 11
Monodelphis      TTCCCTCGGATGAGCAATTTGAAGCTAGCTAACCCAACTGGGGGGCGGCTAGGACCCTCT 243
Xenopus          ---------------------------------------GAAAGTTTCTAGAGGGAAAGA 21
                                                                             

Mus              GTCCTGGGGTGAAAGTTGGGGCGGTGACTTAAGCAGACAGTTGCGTGATCCGGAACCAGA 70
M.musculus       ------------------------------------------------------------
H.sapiens        ------------GCGGTAACCTAAG-CTGGCAGTGGCGTGATCCGGCA-CCAAATC---- 42
Pan              GCTGGAGCTGCTGAGGCTCACAGTG-TGGGAAGAAGCGCG-TCCCCCA-CCAGGCCCGGG 200
Macaca           GGGGAGCCAGGAAGGGCAGCCGATGATGGGGAGGGGATCGTAGGGGCAGCCATGCC---- 845
Pongo            GGGGAGCCAGGAAGGGCAGCCGATGATGGGGAGGGGATCGTAGGGGCAGCCATGCC---- 520
Bos              ---------------------GAGG--AGGCAGTGGCGTGATCCGGAA-CCAAATC---- 32
Canis            GAGAAAGTTGGAACGGCGACCTAAG-GAGGCAGTGGCGTGATCCGGAA-CCAAATC---- 137
R.               GTGAAAGTTGGGGCGGTGACTTAAG-CAGACAGTTGCGTGGTCCGGAA-CCAGATC---- 65
Monodelphis      GAAGAGACAGGTCAGGGACCTGAGGATAGGGAGAGAAATGCAGGGGGCGCTGGGCT---- 299
Xenopus          GTTAAGCTCCGGCCAGCGCCTCACAGGCCACACTTGCTTCATGCTTCCCTGGCTGTAGAA 81
                                                                             

Mus              TCGGCCCGCGGTGCGGTGCGGAGACTCCATGAGAC-CCTGGACATGAACAAGCTGAGTGG 129
M.musculus       ------------------------------------------------------------
H.sapiens        GGCCCGCGGTGC-GTGCGGAGACT--CCATGAGGC-CCTGGACATGAACAAGCTGAGTGG 98
Pan              GGCTTGGGGCCCTGCTCCGGTCCTGGTCAGAAGGC-CGCGGACATGAACAAGCTGAGTGG 259
Macaca           AGACTCAGGCCCCCTACCCCTCCT------------CCAGGACATGAACAAGCTGAGTGG 893
Pongo            AGACTCAGGCCCCCTACCCCTCCT------------CCGGGACATGAACAAGCTGAGTGG 568
Bos              GGCCCGCGGTGCGGTGCGGAGACT--CCATGAAGT-CCTGGACATGAACAAGCTGAGTGG 89
Canis            GAGCCGCGGTGCGGTGCGGAGACT--CCATGAGGC-CCTGGACATGAACAAGCTGAGTGG 194
R.               GGCCCGCGGTGCGGTGCGGAGACT--CCATGAGAC-CCTGGACATGAACAAGCTGAGTGG 122
Monodelphis      AGACTCAGGCCCTTCACCTCTTCT------------CCAGGACATGAACAAACTGAG--- 344
Xenopus          GACAGGGGGTTTGTTATTGGCACCAGACATGGAGTATGTGGATATGAACAAACTGAG--- 138
                                                                             

Mus              AGGCGGCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCTGGGGGGCGAGGAGTGGACCAG 189
M.musculus       ------------------------------------------------------------
H.sapiens        AGGCGGCGGGCGCAGGACTCGGGTGGAAGGGGGCCAGCTTGGGGGCGAGGAGTGGACCCG 158
Pan              AGGCGGCGGGCGCAGGACTCGGGTGGAAGGGGGCCAGCTTGGGGGCGAGGAGTGGACCCG 319
Macaca           AGGCGGCGGGCGCAGGACTCGGGTGGAAGGGGGCCAGCTGGGGGGCGAGGAGTGGACCCG 953
Pongo            AGGCGGCGGGCGCAGGACTCGGGTGGAAGGGGGCCAGCTGGGGGGCGAGGAGTGGACCCG 628
Bos              AGGCGGCGGGCGCAGGACTCGGGTGGAAGGGGGCCAGCTGGGGGGCGAGGAGTGGACTCG 149
Canis            AGGAGGCGGGCGCAGGACGCGGGTGGAAGGGGGCCAGCTGGGGGGCGAGGAGTGGACCCG 254
R.               AGGCGGCGGGCGCAGGACTCGGGTAGAAGGGGGCCAGCTGGGGGGCGAGGAGTGGACCAG 182
Monodelphis      ---CGGCGGGCGGAGGACTCGGGTGGAAGGGGGCCAGCTGGGGGGTGAGGAATGGACTCG 401
Xenopus          ---CTGCGGGAGAAAGTCCCGGGTGGAAGGAGGACAACTGGCTGGTGATGAATGGACCAG 195
                                                                             

Mus              ACACGGGAGCTTTGTCAATAAGCCCACACGAGGCTGGCTGCATCCCAACGACAAAGTCAT 249
M.musculus       ------------------------------------------------------------
H.sapiens        CCACGGGAGCTTTGTCAATAAGCCCACGCGGGGCTGGCTGCATCCCAACGACAAAGTCAT 218
Pan              CCACGGGAGCTTTGTCAATAAGCCCACGCGGGGCTGGCTGCATCCCAACGACAAAGTCAT 379
Macaca           CCACGGGAGCTTTGTCAATAAGCCCACGCGGGGCTGGCTGCATCCCAACGACAAAGTCAT 1013
Pongo            CCACGGGAGCTTTGTCAATAAGCCCACGCGGGGCTGGCTGCATCCCAACGACAAAGTCAT 688
Bos              CCACGGGAGCTTTGTCAATAAGCCCACGCGGGGCTGGCTGCATCCCAACGACAAAGTCAT 209
Canis            CCACGGGAGCTTCGTCAATAAGCCCACACGGGGCTGGCTACATCCCAACGACAAAGTCAT 314
R.               ACACGGGAGCTTTGTCAATAAGCCCACACGAGGCTGGCTGCATCCCAACGACAAAGTCAT 242
Monodelphis      GCACGGGAGCTTTGTCAACAAGCCAACTCGGGGTTGGTTGCATCCCAACGACAAGGTCAT 461
Xenopus          ACACGGGAGCTTTGTCAATAAACCCACCCGAGGCTGGCTGCACCCCGACGACAAGGTCAT 255
                                                                             

Mus              GGGACCTGGGGTTTCCTACTTGGTTCGGTACATGGGCTGTGTGGAGGTCTTACAGTCAAT 309
M.musculus       ------------------------------------------------------------
H.sapiens        GGGACCCGGGGTTTCCTACTTGGTTCGGTACATGGGTTGTGTGGAGGTCCTCCAGTCAAT 278
Pan              GGGACCCGGGGTTTCCTACTTGGTTCGGTACATGGGCTGTGTGGAGGTCCTCCAGTCAAT 439
Macaca           GGGACCCGGGGTTTCCTACTTGGTTCGGTACATGGGCTGTGTGGAGGTCCTTCAGTCAAT 1073
Pongo            GGGACCCGGGGTTTCCTACTTGGTTCGGTACATGGGCTGTGTGGAGGTCCTTCAGTCAAT 748
Bos              GGGACCCGGGGTTTCCTACTTGGTTCGGTACATGGGCTGTGTGGAGGTCCTGCAGTCAAT 269
Canis            GGGACCTGGGGTTTCCTACTTGGTTCGGTACATGGGCTGTGTGGAGGTCCTGCAGTCAAT 374
R.               GGGACCTGGGGTTTCCTACTTGGTTCGGTACATGGGTTGCGTGGAGGTCTTACAGTCAAT 302
Monodelphis      GGGACCTGGGGTTTCCTACCTTGTTCGGTACATGGGTTGTGTGGAAGTGCTCCAGTCAAT 521
Xenopus          GGGCCCCGGAGTTCCCTATCTGGTCAGGTACATGGGATGTGTGGAGGTTCTGCAGTCAAT 315
                                                                             

Mus              GCGAGCCCTTGACTTCAATACCCGGACTCAGGTCACCAGGGAGGCCATCAGTTTGGTGTG 369
M.musculus       ------------------------------------------------------------
H.sapiens        GCGTGCCCTGGACTTCAACACCCGGACTCAGGTCACCAGGGAGGCCATCAGTCTGGTGTG 338
Pan              GCGTGCCCTGGACTTCAACACCCGGACTCAGGTCACCAGGGAGGCCATCAGTCTGGTGTG 499
Macaca           GCGTGCCCTGGACTTCAACACCCGGACTCAGGTTACCAGGGAGGCCATCAGTCTGGTGTG 1133
Pongo            GCGTGCCCTGGACTTCAACACCCGGACTCAGGTCACCAGGGAGGCCATCAGTCTGGTGTG 808
Bos              GCGCGCCCTTGACTTCAACACCCGGACTCAGGTCACCAGGGAGGCCATCAGTCTGGTGTG 329
Canis            GCGTGCCTTGGACTTCAACACCCGCACCCAAGTCACCAGGGAGGCCATCAGTCTGGTGTG 434
R.               GCGAGCCCTTGACTTCAATACCCGGACTCAGGTCACCAGGGAGGCTATCAGTTTGGTGTG 362
Monodelphis      GAGGGCTTTGGATTTCAATACTCGAACACAGGTCACCAGAGAAGCCATCAGTCTGGTGTG 581
Xenopus          GAGAGCCTTGGATTTCAACACCCGGACACAAGTCACAAGGGAAGCCATAAGTCTGGTGTG 375
                                                                             

Mus              TGAAGCTGTGCCTGGTGCCAAAGGGGCGACAAGGAGGAGAAAGCCTTGTAGCCGCCCACT 429
M.musculus       ------------------------------------------------------------
H.sapiens        TGAGGCTGTGCCGGGTGCTAAGGGGGCGACAAGGAGGAGAAAGCCCTGTAGCCGCCCGCT 398
Pan              TGAGGCTGTGCCAGGTGCTAAGGGGGCGACAAGGAGGAGAAAGCCCTGTAGCCGCCCGCT 559
Macaca           TGAGGCTGTGCCGGGTGCTAAGGGGGCGACAAGGAGGAGAAAGCCCTGTAGCCGCCCGCT 1193
Pongo            TGAGGCTGTGCCGGGTGCTAAGGGGGCAACGAGGAGGAGAAAGCCCTGTAGCCGCCCGCT 868
Bos              TGAGGCTGTGCCGGGTGCTAAGGGGGCAACAAGGAGGAGAAAGCCCTGTAGCCGTCCACT 389
Canis            TGAGGCTGTGCCCGGTGCCAAGGGGGCTACAAGAAGGAGAAAGCCCTGTAGCCGCCCACT 494
R.               TGAAGCTGTGCCTGGTGCCAAAGGGGCGATGAGGAGGAGAAAGCCCTGCAGCCGCCCACT 422
Monodelphis      TGAGGCTGTGCCAGGGGCCAAGGGGGCTGCACGGAGGAGAAAGCCCTGTAGTCGCCCGCT 641
Xenopus          TGATGCTGTCCCAGGAGCAAAGGGGGCAATGCGAAGGAGAAAGACTTGCGGACGCTCCTT 435
                                                                             

Mus              CAGCTCCATCCTGGGGAGGAGTAACCTGAAGTTTGCTGGAATGCCAATCACTCTCACTGT 489
M.musculus       ------------------------------------------------------------
H.sapiens        CAGCTCTATCCTGGGGAGGAGTAACCTGAAATTTGCTGGAATGCCAATCACTCTCACCGT 458
Pan              CAGCTCTATCCTGGGGAGGAGTAACCTGAAATTTGCTGGAATGCCAATCACTCTCACCGT 619
Macaca           CAGCTCTATCCTGGGGAGGAGTAACCTGAAATTTGCTGGAATGCCAATCACTCTCACCGT 1253
Pongo            CAGCTCTATCCTGGGGAGGAGTAACCTGAAATTTGCTGGAATGCCAATCACTCTCACCGT 928
Bos              CAGCTCCATTCTGGGGAGGAGTAACCTGAAATTTGCTGGAATGCCAATCACTCTGACCGT 449
Canis            CAGTGCCATCCTGGGGAGGAGTAATCTGAAATTTGCGGGAATGCCAATCACTCTCACCGT 554
R.               CAGCTCTATCCTGGGAAGGAGTAACCTGAAGTTTGCTGGAATGCCGATCACTCTCACTGT 482
Monodelphis      CAGCTCCATACTGGGGAGGAGTAATCTAAAGTTTGCTGGCATGCCCATAACCCTAACTGT 701
Xenopus          AAACTCCATCCTAGGGAAGAGCAACCTGAAGTTTGCAGGCATGCCAATCACACTGACCGT 495
                                                                             

Mus              GTCTACCAGCAGCCTTAACCTCATGGCAGCCGACTGCAAACAGATCATTGCCAACCATCA 549
M.musculus       ------------------------------------------------------------
H.sapiens        CTCCACCAGCAGCCTCAACCTCATGGCCGCAGACTGCAAACAGATCATCGCCAACCACCA 518
Pan              CTCCACCAGCAGCCTCAACCTCATGGCCGCAGACTGCAAACAGATCATCGCCAACCACCA 679
Macaca           CTCCACCAGCAGCCTCAACCTCATGGCCGCAGACTGCAAACAGATCATCGCCAACCACCA 1313
Pongo            CTCCACCAGCAGCCTCAACCTCATGGCCGCAGACTGCAAACAGATCATCGCCAACCACCA 988
Bos              CTCCACCAGCAGCCTCAACCTCATGGCCGCAGACTGCAAACAGATCATCGCCAACCACCA 509
Canis            CTCCACCAGCAGCCTCAACCTTATGGCCGCAGACTGCAAACAGATCATCGCCAACCACCA 614
R.               GTCTACCAGCAGCCTTAACCTCATGGCAGCAGACTGCAAACAGATCATTGCCAACCATCA 542
Monodelphis      TTCTACCAGCAGCCTCAACCTCATGGCTGCAGACTGTAAACAGATCATCGCCAATCACCA 761
Xenopus          GTCCACTAGTAGCCTCAACCTCATGGCTTCCGACTGCAAACAGATCATCGCCAACCACCA 555
                                                                             

Mus              CATGCAATCTATCTCTTTCGCGTCCGGTGGGGATCCGGACACAGCTGAGTATGTTGCCTA 609
M.musculus       -ATGACTTTAGATAGGCTTGCACCAGGGACTGAAGCTGAGTATGTTGCCTATGTTGCCTA 59
H.sapiens        CATGCAATCTATCTCATTTGCATCCGGCGGGGATCCGGACACAGCCGAGTATGTCGCCTA 578
Pan              CATGCAATCTATCTCATTTGCATCCGGCGGGGATCCGGACACAGCCGAGTATGTCGCCTA 739
Macaca           CATGCAATCTATCTCATTTGCATCCGGCGGGGATCCGGACACAGCCGAGTATGTCGCCTA 1373
Pongo            CATGCAATCTATCTCATTTGCATCCGGCGGGGATCCGGACACAGCCGAGTATGTCGCCTA 1048
Bos              CATGCAGTCCATCTCGTTTGCATCCGGCGGGGACCCGGACACAGCCGAGTATGTTGCCTA 569
Canis            CATGCAGTCTATCTCCTTTGCGTCCGGTGGGGACCCGGACACAGCTGAGTACGTCGCCTA 674
R.               CATGCAATCTATCTCATTCGCGTCTGGTGGGGATCCGGACACAGCTGAGTACGTTGCCTA 602
Monodelphis      CATGCAATCAATCTCATTCGCATCTGGTGGGGATCCGGACACTGCCGAATATGTTGCTTA 821
Xenopus          CATGCAGTCAATATCTTTTGCTTCTGGGGGAGATCCGGACACAGCTGAGTATGTTGCGTA 615
                  ***   *         * **  * **    **  * **    *  *  ** ** ** **

Mus              TGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCATATCCTGGAGTGTCCTGAAGGGCT 669
M.musculus       TGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCATATCCTGGAGTGTCCTGAAGGGTT 119
H.sapiens        TGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCACATTCTGGAGTGTCCCGAAGGGCT 638
Pan              TGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCACATTCTGGAGTGTCCCGAAGGGCT 799
Macaca           CGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCACATTCTGGAGTGTCCCGAAGGGCT 1433
Pongo            CGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCACATTCTGGAGTGTCCCGAAGGGCT 1108
Bos              TGTTGCCAAAGACCCGGTGAATCAGAGAGCCTGCCACATCCTGGAGTGTCCCGAAGGGCT 629
Canis            TGTTGCCAAAGACCCGGTGAATCAGAGAGCCTGTCATATCCTGGAATGTCCCGAAGGGCT 734
R.               TGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCATATCCTGGAGTGTCCTGAAGGACT 662
Monodelphis      TGTTGCCAAAGACCCTGTCAATCAGAGAGCCTGCCACATCCTGGAGTGTCCAGAGGGACT 881
Xenopus          TGTGGCCAAAGATCCAGTCAATCAGAGAGCCTGCCATATCTTGGAGTGCCCAGAGGGCCT 675
                  ** ******** ** ** ************** ** **  **** ** ** ** **  *

Mus              TGCTCAGGATGTCATCAGCACCATCGGGCAGGCCTTTGAGTTGCGCTTCAAACAGTATCT 729
M.musculus       TGCTCAGGATGTCATCAGCACCATCGGGCAGGCCTTTGAGTTGTGCTTCAAACAGTATCT 179
H.sapiens        TGCCCAGGATGTCATCAGCACCATTGGCCAGGCCTTCGAGTTGCGCTTCAAACAATACCT 698
Pan              TGCCCAGGATGTCATCAGCACCATTGGCCAGGCCTTCGAGTTGCGCTTCAAACAATACCT 859
Macaca           TGCCCAGGATGTCATCAGCACCATTGGCCAGGCCTTTGAGTTGCGCTTCAAACAATACCT 1493
Pongo            TGCCCAGGATGTCATCAGCACCATTGGCCAGGCCTTCGAGTTGCGCTTCAAACAATACCT 1168
Bos              CGCTCAGGATGTCATCAGCACCATCGGCCAGGCCTTCGAGCTGCGCTTCAAACAGTACCT 689
Canis            TGCTCAGGATGTCATCAGCACCATCGGCCAGGCCTTCGAGTTGCGCTTCAAACAATACCT 794
R.               TGCTCAGGACGTCATCAGCACCATCGGGCAGGCCTTTGAGTTGCGCTTCAAACAGTATCT 722
Monodelphis      AGCACAGGATGTCATCAGCACCATTGGCCAGGCCTTTGAGCTGCGCTTCAAACAATACCT 941
Xenopus          TGCTCAGGACGTGATCAGCACAATAGGACAGGCTTTTGAACTTCGCTTCAAGCAATACCT 735
                  ** ***** ** ******** ** ** ***** ** **  *  ******* ** ** **

Mus              CAGGAATCCACCGAAGCTGGTCACCCCCCATGACAGGATGGCTGGCTTTGATGGCTCAGC 789
M.musculus       CAGGAATCCACCGAAGCTGGTCACCCCCCATGACAGGATGGCTGGCTTTGATGGCTCAGC 239
H.sapiens        CAGGAACCCACCCAAACTGGTCACCCCTCATGACAGGATGGCTGGCTTTGATGGCTCAGC 758
Pan              CAGGAACCCACCCAAACTGGTCACCCCTCATGACAGGATGGCTGGCTTTGATGGCTCAGC 919
Macaca           CAGGAACCCACCCAAACTGGTCACCCCTCATGACAGGATGGCTGGCTTTGATGGCTCAGC 1553
Pongo            CAGGAACCCACCCAAACTGGTCACCCCTCATGACAGGATGGCTGGCTTTGATGGCTCAGC 1228
Bos              CAGGAACCCGCCCAGGCTCGTCACCCCCCACGACAGGATGGCTGGCTTTGATGGCTCAGC 749
Canis            CAGGAACCCGCCCAAGCTGGTCACCCCTCATGACAGGATGGCTGGTTTTGACGGCTCAGC 854
R.               CAGGAATCCACCCAAGCTGGTCACCCCCCATGACAGGATGGCTGGCTTTGATGGCTCAGC 782
Monodelphis      CAGGAACCCACCCAAGCTTGTCACTCCCCATGACAGGATGGCTGGTTTTGATGGCTCAGC 1001
Xenopus          CAAAAATCCCCCCAAACTGGTCACCCCCCATGACAGAATGGCTGGTTTTGATGGGTCGGC 795
                 **  ** ** ** *  ** ***** ** ** ***** ******** ***** ** ** **

Mus              TTGGGATGAGGAGGAAGAAGAGCCCCCTGACCATCAGTACTACAATGACTTTCCAGGGAA 849
M.musculus       TTGGGATGAGGAGGAAGAAGAGCCCCCTGACCATCAGTACTACAATGACTTTCCAGGGAA 299
H.sapiens        ATGGGATGAGGAGGAGGAAGAGCCACCTGACCATCAGTACTATAATGACTTCCCGGGGAA 818
Pan              ATGGGATGAGGAGGAGGAAGAGCCACCTGACCATCAGTACTATAATGACTTCCCGGGGAA 979
Macaca           GTGGGATGAGGAGGAGGAAGAGCCACCTGACCATCAGTACTATAATGACTTCCCGGGGAA 1613
Pongo            ATGGGATGAGGAGGAGGAAGAGCCACCTGACCATCAGTACTATAATGACTTCCCGGGGAA 1288
Bos              TTGGGATGAGGAGGAGGAAGAGCCCCCTGACCATCAGTACTATAATGACTTCCCGGGGAA 809
Canis            TTGGGATGAGGAGGAGGAAGAGCCACCTGACCACCAGTACTATAATGACTTCCCGGGGAA 914
R.               TTGGGATGAGGAGGAAGAAGAGCTCCCTGACCATCAGTACTACAATGACTTCCCAGGGAA 842
Monodelphis      TTGGGATGAGGAGGAAGAAGATCCACCTGACCATCAATACTACAATGACTTCCCAGGGAA 1061
Xenopus          GTGGGACGAGGAAGAGGAGGAGCTCCCAGACCACGCCTATTACAATGATTTCCCAGGGAA 855
                  ***** ***** ** ** ** *  ** *****    ** ** ***** ** ** *****

Mus              GGAACCCCCTCTTGGTGGGGTGGTAGATATGAGGCTTCGGGAAGG------------GGC 897
M.musculus       GGAACCCCCTCTTGGTGGGGTGGTAGATATGAGGCCTCGGGAAGG------------GGC 347
H.sapiens        GGAACCCCCCTTGGGGGGGGTGGTAGACATGAGGCTTCGGGAAGGAGCCGCTCCAGGGGC 878
Pan              GGAACCCCCCTTGGGGGGGGTGGTAGACATGAGGCTTCGGGAAGGAGCCGCTCCAGGGGC 1039
Macaca           GGAACCCCCCCTGGGTGGGGTGGTAGACATGAGGCTTCGGGAAGGAGCTGCTCCAGGGGC 1673
Pongo            GGAACCCCCCCTGGGGGGGGTGGTAGACATGAGGCTTCGGGAAGGAGCCGCTCCAGGGGC 1348
Bos              GGAACCACCTCTTGGGGGTGTGGTGGACATGAGGCTTCGGGAAGGAGCCCTCCCAGGGGC 869
Canis            GGAGCCCCCTCTTGGGGGAGTGGTGGACATGAGGCTTCGGGAAGCAGCCCCCCTGGGGGC 974
R.               GGAACCCCCTCTTGGTGGAGTGGTAGATATGAGGCTTCGGGAAGG------------GGC 890
Monodelphis      GGAGCCCCCCCTTGGTGGGGTAGTAGACATGAGGCTTCGGGATGGACCTGCCCCAGGGAG 1121
Xenopus          AGAGCCCCCTATTGGGGGAGTAGTAGATATGAGGCTGCGAGATGG------------GGC 903
                  ** ** **  * ** ** ** ** ** *******  ** ** *             *  

Mus              TGCTCGACCCACTCTGCCTAGTGCCCAGATGTCCAGCCACTTGGGAGCTACACTGCCTAT 957
M.musculus       TGCTCGACCCACTCTGCCTAGTGCCCAGATGTCCAGCCACTTGGGAGCTACACTGCCTAT 407
H.sapiens        TGCTCGACCCACTGCACCCAATGCCCAGACCCCCAGCCACTTGGGAGCTACATTGCCTGT 938
Pan              TGCTCGACCCACTGCACCCAATGCCCAGACCCCCAGCCACTTGGGAGCTACACTGCCTGT 1099
Macaca           TGCTCGATCCACTGCACCCAGTGCCCAGACCCCTAGCCACTTGGGAGCTACACTGCCTGT 1733
Pongo            TGCTCGATCCACCGCACCCAGTGCCCAGACCCCCAGCCACTTGGGAGCTACACTGCCTGT 1408
Bos              TGCTCGACCCACTCCGCCCAGTGCCCAGACCCCCAGCCACCTGGGAGCCACGCTGCCTGT 929
Canis            TGTTCGGCCCACCCCACACGTTGTCCAGACCCCCAGCCACCTGGGAGCAACGCTGCCTGT 1034
R.               TGCTCGACCCACTCTGCCCAGTACCCAGATGCCCAGCCACTTGGGAGCTACACTGCCAAT 950
Monodelphis      TCCTTGGCCACCCACACCCAACACCCAGACCACCAACCACCTAGGAGCCACCTTGCCCGT 1181
Xenopus          TGC---GCCCGCAGTTCTGAGG---CAGAGTCCAAATCACATGGGTGCCACCCTGCCAGT 957
                 *       *  *    *        ****   * *  *** * ** ** **  ****  *

Mus              AGGGCAGCATGCTGCAGGAGACCATGAAGTCCGTAAACAGATGTTGCCTCCGCCGCCTTG 1017
M.musculus       AGGGCAGCATGCTGCAGGAGACCATGAAGTCCGTAAACAGATGTTGCCTCCGCCACGTTG 467
H.sapiens        AGGACAGCCTGTTGGGGGAGATCCAGAAGTCCGCAAACAGATGCCACCTCCACCACCCTG 998
Pan              AGGACAGCCTGTTGGGGGAGATCCAGAAGTCCGCAAACAGATGCCACCTCCACCACCCTG 1159
Macaca           AGGACAGCCTGTTGGGGGAGATCCAGAAGTCCGAAAACAGATGCCACCTCCACCACCCTG 1793
Pongo            AGGACAGCCTGTTGGGGGAGATCCAGAAGTCCGCAAACAGATGCCACCTCCACCACCCTG 1468
Bos              GGGGCAGCCTGCTGGGGGAGACCCAGAAGCCCGCAGACAGATGCCGCCCCCGCCACCCAG 989
Canis            GGGGCAGCCTGTTGGGGGAGACCCAGAAATTCGCAAACAGATGCCACCTCCACCACCCTG 1094
R.               AGGGCAGCATGTTACAGGAGACCATGAAGTCCGTAAACAGATGCTGCCTCCACCACCGTG 1010
Monodelphis      TGGACAGCTAGCTGGTGGGGACCCTGATATTCGAAAACAGTTGCCAACTCC------TGG 1235
Xenopus          GGGACAGGTTTCTGGTGCAGAACAAGATTCCCGGA---AGATGCAGCCCACACTGCAAGG 1014
                  ** ***     *   *  ** *  **    ** *   ** **    *  *        *

Mus              CCCAGGCAGAGAACTC---TTCGATGACCCCTCCTATGTCAACATCCAGAATC--TAGAC 1072
M.musculus       CCCAGGCAGAGAACTC---TTCGATGACCCCTCCTATGTCAACATCCAGAATC--TAGAC 522
H.sapiens        TCCAGGCAGAGAGCTT---TTTGATGATCCCTCCTATGTCAACGTCCAGAACC--TAGAC 1053
Pan              TCCAGGCAGAGAGCTT---TTTGATGATCCCTCCTATGTCAACGTCCAGAACC--TAGAC 1214
Macaca           TCCAGGCAGAGAGCTC---TTTGACGATCCCTCCTATGTCAACGTCCAGAACC--TAGAC 1848
Pongo            TCCAGGTAGAGAGCTC---TTTGATGATCCCTCCTATGTCAACGTCCAGAACC--TAGAC 1523
Bos              CTCAGGCAGAGAGCTC---TTTGATGACCCCTCCTATGTCAATGTCCAGAACC--TAGAC 1044
Canis            CCCAGGTAAAGAGCTC---TTTGATGATCCATCCTACGTCAATGTCCAGAACC--TAGAC 1149
R.               CCCAGGCAGAGAACTC---TTCGATGATCCTTCCTATGTCAACATCCAGAATC--TAGAC 1065
Monodelphis      ACCAGGTAGAGAACTA---TTTGACGATCCTTCCTATGTCAATGTCCAGAACC--TGGAA 1290
Xenopus          --CAGGGAGAGGTTCCCAGTTCCCTGCAGTCGGCCTCCTAATCGCCCTGATCTCTTTGAT 1072
                   **** * **        **    *       *    * *    ** **     * ** 

Mus              AAGGCCCGGCAGGCTGGGGGT--GGGGCTGGGCCCCCAAATCCTTCTCTTAATGGCAGTG 1130
M.musculus       AAGGCCCGGCAGGCTGGGGGT--GGGGCTGGGCCCCCAAATCCTTCTCTTAATGGCAGTG 580
H.sapiens        AAGGCCCGGCAAGCAGTGGGT--GGTGCTGGGCCCCCCAATCCTGCTATCAATGGCAGTG 1111
Pan              AAGGCCCGGCAAGCAGTGGGT--GGTGCTGGGCCCCCCAATCCTGCTGTCAATGGCAGTG 1272
Macaca           AAGGTCCGGCAAGCAGTGGGT--GGTGCTGGGCTCCCCAATCCTGCTGTCAATGGCAGTG 1906
Pongo            AAGGCCCGGCAAGCAGTGGGT--GGTGCTGGGCCCCCTAATCCTGCTGTCAATGGCAGTG 1581
Bos              AAGGCCCGGCAAGCAGGGGCT--GGGGCCGGGCCCCCCAATCCTACCATCAATGGCAGTG 1102
Canis            AGGGCCCGGCAAGCAGGGGGT--GGGGCTGGGCCCCCCAATCCTGCCATCAATGGCAGCG 1207
R.               AAGGCCCGGCAAGCTGGTGGT--GGGGCTGGACCCCCAAATCCTTCTGTTAATGGCAGTG 1123
Monodelphis      AAAGTCCGGCAAGGAGCTGGT--GGT------CCTTCGAACCCTACTACCAATGGCAGTG 1342
Xenopus          GACCCCTCCTACGTCAATGTCCAGAACCTGGAGAAGTCACGGCAGCCTCTGCGGGCAGCA 1132
                      *    * *     *    *              *   *  *       *****  

Mus              CACCCC----GAGACCTTTTTGACATGAAGCCCTTTGAAGATGCACTTCGGGTGCCACCC 1186
M.musculus       CACCCC----GAGACCTTTTTGACATGAAGCCCTTTGAAGATACACTTCGGGTGCCATCC 636
H.sapiens        CACCCC----GGGACCTGTTTGACATGAAGCCCTTCGAAGATGCTCTTCGGGTGCCTCCA 1167
Pan              TACCCC----GGGACCTGTTTGACATGAAGCCCTTCGAAGATGCTCTTCGGGTGCCTCCA 1328
Macaca           CACCCC----GTGACCTGTTTGATATGAAGCCCTTTGAAGATGCTCTTCGGGTGCCTCCA 1962
Pongo            CACCCC----GGGACCTGTTTGACATGAGGCCCTTCGAAGATGCTCTTCGGGTGCCTCCA 1637
Bos              CACCCC----GAGACCTCTTTGACATGAAGCCCTTTGAAGATGCCTTGCGAATGCCTCCA 1158
Canis            TGCCCC----GAGATCTCTTTGATATGAAGCCCTTCGAAGATGCGCTTCGGGTGCCTCCA 1263
R.               CACCCC----GAGACCTCTTTGACATGAAGCCCTTCGAAGATGCACTCCGGGTGCCGCCA 1179
Monodelphis      CTCCAC----GTGACCTCTTTGATATGAAGCCATTTGAAGATGCGCTTCGGGTCCCCCCA 1398
Xenopus          AACGGCCAAAGGGACATCTTCGACATGAAGCCATTTGATGATGCTCT------GCCCTCG 1186
                   *  *    * **  * ** ** **** *** ** ** *** *  *       **  * 

Mus              CCACCGCAGTCCATGTCCATGGCTGAGCAGCTGCAAGGGGAGCCCTGGTTCCACGGGAAG 1246
M.musculus       CCACTGCAGTCCATGTTCATGGCTGAGCAGCTGCAAGGGGAGCCCTGGTTCCACGGGAAG 696
H.sapiens        CCTCCCCAGTCGGTGTCCATGGCTGAGCAGCTCCGAGGGGAGCCCTGGTTCCATGGGAAG 1227
Pan              CCTCCCCAGTCGGTGTCCATGGCTGAGCAGCTCCGAGGGGAGCCCTGGTTCCATGGGAAG 1388
Macaca           CCTCCCCAGTCAGTGTCCATGGCTGAGCAGCTCCGAGGGGAGCCCTGGTTCCATGGGAAG 2022
Pongo            CCTCCCCAGTCGGTGTCCATGGCTGAGCAGCTCCGAGGGGAGCCCTGGTTCCACGGGAAG 1697
Bos              CCTCCCCAGTCAACAGCCATGGCTGAGCAGCTCCGAGGGGAGCCCTGGTTCCACGGGAAG 1218
Canis            CCTCCCCAGGCGGTGGCCATGGCTGAGCAGCTCCGAGGGGAGCCCTGGTTCCATGGGAAG 1323
R.               GCTCCCCAGTCCATGTCCATGGCTGAGCAGCTCCAAGGGGAGTCCTGGTTTCATGGGAAA 1239
Monodelphis      CCATCCCCTACACCACCAATGGCTGAGCAACTCCGGGCAGAGCCCTGGTTTCATGGCAAG 1458
Xenopus          GCTCAGGCAATAGTGAGTATGGAGGATCAGCTGAAGCGGGAGCCCTGGTACCAGGGTAAG 1246
                  *                ****  ** ** **       *** ******  ** ** ** 

Mus              CTGAGCCGGAGGGAGGCCGAGGCGCTGCTGCAGCTCAATGGTGACTTCTTGGTGCGAGAG 1306
M.musculus       CTGAGCCGGAGGGAGGCCAAGGCACTGCTGCAGCTCAATGGTGACTTCTTGGTGCGAGAG 756
H.sapiens        CTGAGCCGGCGGGAGGCTGAGGCACTGCTGCAGCTCAATGGGGACTTCTTGGTACGGGAG 1287
Pan              CTGAGCCGGCGGGAGGCTGAGGCACTGCTGCAGCTCAATGGGGACTTCCTGGTGCGGGAG 1448
Macaca           CTGAGTCGGCGGGAGGCTGAGGCACTGCTGCAGCTCAACGGGGACTTCCTGGTGCGGGAG 2082
Pongo            CTGAGCCGGCGGGAGGCTGAGGCACTGCTGCAGCTCAACGGGGACTTCCTGGTGCGGGAG 1757
Bos              CTGAGCCGGCGGGAGGCTGAGGCATTGCTACAAGTCAACGGGGACTTCCTTGTGCGGGAA 1278
Canis            CTGAGCCGGCGGGAGGCCGAGGCCCTGCTGCAGCTCAATGGGGACTTCCTGGTGCGGGAG 1383
R.               CTCAGCCGGCGGGAGGCTGAGGCGCTGCTGCAGCTCAACGGTGACTTCTTGGTGCGAGAG 1299
Monodelphis      TTGAATAGGAGGGAAGCAGAAGGACAGCTGAGGCTCAATGGGGACTTCCTGGTTCGGGAG 1518
Xenopus          ATGAGCCGCAAGGAAGCAGAAAGGCTGCTGAAAGTGAATGGAGACTTCCTGGTGCGGGAG 1306
                  * *   *   *** **  *      ***     * ** ** ****** * ** ** ** 

Mus              AGCACGACCACGCCTGGCCAGTATGTGCTCACTGGCCTGCAGAGTGGGCAGCCCAAGCAC 1366
M.musculus       AGCACGACCACACCTGGCCAGTATGTGCTCACTGACCTGCAGAGTGGGCAGCCCAAGCAC 816
H.sapiens        AGCACGACCACACCTGGCCAGTATGTGCTCACTGGCTTGCAGAGTGGGCAGCCTAAGCAT 1347
Pan              AGCACGACCACACCTGGCCAGTATGTGCTCACTGGCTTGCAGAGTGGGCAGCCTAAGCAT 1508
Macaca           AGCACGACCACACCTGGCCAGTATGTGCTCACTGGCTTGCAGAGTGGGCAGCCCAAGCAT 2142
Pongo            AGCACGACCACACCTGGCCAGTATGTGCTCACTGGCTTGCAGAGTGGGCAGCCCAAGCAT 1817
Bos              AGCACAACCACGCCGGGCCAGTACGTGCTCACCGGCCTGCAGAGTGGGCAGCCCAAGCAC 1338
Canis            AGCACGACCACACCCGGCCAGTACGTGCTCACTGGCTTGCAGAGTGGGCAGCCCAAGCAC 1443
R.               AGTACAACCACACCTGGCCAGTACGTGCTCACTGGTCTGCAGAGTGGGCAGCCCAAGCAC 1359
Monodelphis      AGTACAACCACTCCAGGCCAGTATGTCCTTACTGGCCTGCAGAGTGGCCAGCCCAAACAT 1578
Xenopus          AGTACCACCACCCCGGGGCAATACGTACTGACCGGCCTGCAGTGTGGCCAGCCCAAACAC 1366
                 ** ** ***** ** ** ** ** ** ** ** *   ***** **** ***** ** ** 

Mus              TTGCTGCTGGTGGACCCTGAAGGTGTGGTTCGGACAAAGGATCACCGCTTTGAGAGTGTC 1426
M.musculus       TTGCTGCTGGTGGACCCTGAAGGTGTGGTTCGGACAAAGGATCACTGCTTTGAGAGTGTC 876
H.sapiens        TTGCTACTGGTGGACCCTGAGGGTGTGGTTCGGACTAAGGATCACCGCTTTGAAAGTGTC 1407
Pan              TTGCTACTGGTGGACCCTGAGGGTGTGGTTCGGACTAAGGATCACCGCTTTGAAAGTGTC 1568
Macaca           CTGCTACTGGTGGACCCTGAGGGTGTGGTTCGGACTAAGGATCACCGCTTTGAGAGTGTC 2202
Pongo            TTGCTACTGGTGGACCCTGAGGGTGTGGTTCGGACTAAGGATCACCGCTTTGAGAGTGTC 1877
Bos              CTGCTCCTGGTGGACCCTGAGGGTGTGGTTCGGACAAAGGATCACCGCTTTGAGAGTGTC 1398
Canis            CTGCTGCTGGTGGACCCGGAGGGTGTGGTTCGAACAAAGGATCACCGCTTTGAGAGTGTC 1503
R.               TTGCTTCTGGTGGACCCTGAAGGTGTGGTTCGGACAAAGGATCACCGCTTTGAGAGTGTC 1419
Monodelphis      TTGCTGCTTGTCGACCCTGAAGGTGTGGTTCGGACAAAGGATCACCGATTTGAGAGTGTC 1638
Xenopus          TTGCTGCTTGTGGACCCTGAAGGGGTGGTTCGAACCAAAGACCACAGGTTTGAGAGTGTC 1426
                  **** ** ** ***** ** ** ******** ** ** ** *** * ***** ******

Mus              AGTCACCTGATCAGCTACCACATGGACAATCACTTGCCCATCATCTCTGCGGGCAGCGAA 1486
M.musculus       AGTCACCTGATCAGCTACCACATGGACAATCACTTGCCCATCATCTCTGCGGGCAGCGAA 936
H.sapiens        AGTCACCTTATCAGCTACCACATGGACAATCACTTGCCCATCATCTCTGCGGGCAGCGAA 1467
Pan              AGTCACCTTATCAGCTACCACATGGACAATCACTTGCCCATCATCTCTGCGGGCAGCGAA 1628
Macaca           AGTCACCTCATCAGCTACCATATGGACAATCACTTGCCCATCATCTCTGCGGGCAGCGAA 2262
Pongo            AGTCACCTTATCGGCTACCACATGGACAATCACTTGCCCATCATCTCTGCGGGCAGCGAA 1937
Bos              AGTCACCTCATCAGCTACCACATGGACAATCACTTGCCCATCATCTCTGCGGGCAGCGAA 1458
Canis            AGCCACCTCATCAGCTACCACGTGGACAATCACTTGCCTATCATCTCTGCGGGCAGTGAA 1563
R.               AGTCACCTGATCAGCTACCACATGGACAATCACTTACCCATCATCTCTGCAGGCAGTGAG 1479
Monodelphis      AGTCACCTTATCAGCTACCACATGGACAATCACCTCCCCATCATCTCTGCAGGCAGCGAG 1698
Xenopus          AGTCACCTGATCAGCTATCACATGGACAATCACTTGCCCATCATCTCCGCTGGCAGTGAG 1486
                 ** ***** *** **** **  *********** * ** ******** ** ***** ** 

Mus              CTGTGCCTACAGCAACCCGTGGATCGGAAAGTGTGATCCT---TCTCAGC---------T 1534
M.musculus       CTGTGCCTACAGCAACCCGTGGATCGGAAAGTGTGATCCT---TCTCAGC---------T 984
H.sapiens        CTGTGTCTACAGCAACCTGTGGAGCGGAAACTGTGATCTG---CCCTAGCG------CTC 1518
Pan              CTGTGTCTACAGCAACCTGTGGAGCGGAAACTGTGATCTG---CCCTAGCG------CTC 1679
Macaca           CTGTGTCTACAGCAACCTGTGGAGCGGAAACTGTGATCTG---CCCCAGAC------CTC 2313
Pongo            CTGTGTCTACAGCAACCTGTGGAGCGGAAACTGTGATCTG---CCCTAGCG------CTC 1988
Bos              CTGTGTCTCCAGCAGCCTGTGGAGCGGAAACTGTGACCTG---TTCCAGTG------CTT 1509
Canis            CTCTGTCTCCAACAGCCTGTGGAGCGGAAGCTGTGATCCA---TCTCAGTG------CTT 1614
R.               CTGTGTCTACAGCAACCTGTGGATCGAAAAGTGTGATCCT---TCTTAGC---------C 1527
Monodelphis      CTATGTCTTCAGCAGCCTGTGGAAAGGAAGCTGTAA------------------------ 1734
Xenopus          CTCTGCCTTCAGCAGCCGGTGGAGCGGAGACAGTGACCCCGCCTTCTAGCTGGGCTCCGC 1546
                 ** ** ** ** ** ** *****  * *    ** *                        

Mus              TCTCCAACA---GGATGCTCTCCATTTCCGTCTCCCGTATTCTCTAACTTGTGGGACCTC 1591
M.musculus       TCTCCAACA---AGATGCTCTTCATTCCCGTTTCCCATATTCTCTAACTTGTGGGACCTC 1041
H.sapiens        TCTTCCAGA---AGATGCCCTCCAATCCTTTCCACCCTATTCCCTAACTCTCGGGACCTC 1575
Pan              TCTTCCAGA---AGATGCCCTCCAATCCTTTCCACCCTATTCCCTAACTCTCGGGACCTC 1736
Macaca           TCTTCCAGA---AGATGCCCTCCAATCCCTTCCACCCTATTCCCTAACTCTTGGGACCTC 2370
Pongo            TCTTCCAGA---AGATGCCCTCCAATCCTTTCCACCCTATTCCCTAACTCTCGGGACCTC 2045
Bos              TCTCTCAGA---AGATGCCCTGCGGTCCCTTCCACCCTATTCCCTGACTCTTAGGACCTC 1566
Canis            TCTCCCCGA---AGGGGTCCTTCCACCACTTCCACTCTATTCCTTGAGTCTCAGGACCTC 1671
R.               TCTCCTGGA---GGACGCTCTCCACTCCCTTCTACCGTGT------ACTCGTGGGGCCGC 1578
Monodelphis      ------------------------------------------------------------
Xenopus          CCCTTCACACTTGAGCCGTCACCAACACTACCCACACCTCTGTTTGTCTTTCCTTTCTCC 1606
                                                                             

Mus              ---------TGTTTTGTGGGTCTGGCCTTGG---GTG----GGAACTGGGAGCAACGA-- 1633
M.musculus       ---------TGTTTTGTGGGTCTGGCCTTGG---GTG----GGAACTGGGAGCAACGA-- 1083
H.sapiens        GTTTGGGAGTGTTCTGTGGGCTTGGCCTTGT---GTC----AGAGCTGGGAGTAGCAT-- 1626
Pan              GTTTGGGAGTGTTCTGTGGGCTTGGCCTTGT---GTC----AGAGCTGGGAGTAGCAT-- 1787
Macaca           ATTTGGGAGTGTTCTGTGGGCTTGGCCTTGT---GTC----AGAGCTGGGAGTAGTGT-- 2421
Pongo            GTTTGGGAGTGTTCTGTGGGCTTGGCCTTGT---GTC----AGAGCTGGGAGTAGCGT-- 2096
Bos              ACTTGGGAGTGCTCCATGGGCCTGGCCTTGT---GT-----AGGGCTGGAGATACTGT-- 1616
Canis            ATTTGAGGGTGTTCTGTGGGCTTGGCCTTGTTGTGTT----GGAGCTGGGGATAGTGT-- 1725
R.               ---------TGCTTGGTGGG-----------------------AACTG--AGCGGCAA-- 1602
Monodelphis      ------------------------------------------------------------
Xenopus          AGA-GCAAGTGACTCCTGGCCACGCCTCTGGCTGGCCCTACTGTAGTAGGAGGAGCCTTA 1665
                                                                             

Mus              --GGACA-----TGGGTTTAGTGCCC---ACTTGAGAGAGAGAAAAA-------GAGGGT 1676
M.musculus       --GGACA-----TGGGTTTAGTGCCC---ACTTGAGAGAGAGAAAAA-------GAGGGT 1126
H.sapiens        --GGACTC----TGGGTTTCATATCC---AGCTGAGTGAG---------------AGGGT 1662
Pan              --GGACTC----TGGGTTTCATATCC---AGCTGAGTGAG---------------AGGGT 1823
Macaca           --GGACTC----TGGGTTTCATATCC---AGCTGAGTGAGGGTTT---------GAGGGT 2463
Pongo            --GGACTC----TGGGTTTCATATCC---AGCTGAGTGAG---------------AGGGT 2132
Bos              --GGACAC----TGGGTTCAGCATGC---AGCTGAGTGAG---------------AGGGT 1652
Canis            --GGACA------TGGTTCAGCATCC---AGCTGAATGAG---------------AGGTT 1759
R.               --GGACA-----CGGCTTTAGTGCCC---ACTTGAGAGAG-----------------GAT 1635
Monodelphis      ------------------------------------------------------------
Xenopus          TGGGGCCCCAGCTTGGCTCCGTCTCTGATAACTGCACAAGAGCCAGGGCAATGTAAGAAC 1725
                                                                             

Mus              TTCAGTAAGGAGCCTGGGGTAGCATCC--TGCCTCTG----GCCAAACT----TCACCAA 1726
M.musculus       TTCAGTAAGGAGCCTGGGGTAGCATCC--TGCCTCTG----CCCAAACT----TCACCAA 1176
H.sapiens        TTGAGTCAAAAGCCTGGGTGAGAATCC--TGCCTCTC----CCCAAACATTAATCACCAA 1716
Pan              TTGAGTCAGAAGCCTGGGTGAGAATCC--TGCCTCTC----CCCAAACATTAATCACCAA 1877
Macaca           TTGAGTCAGAAGCCTGGGGGAGAATCC--TGCCTCTC----CCCAAACATTGATCACCAA 2517
Pongo            TTGAGTCAGAAGCCTGGGTGAGAATCC--TGCCTCTC----CCCAAACATTAATCACCAA 2186
Bos              TTGAGTCAGGAACCAGGGGTAGAGTCC--TGCTTCTC----CCCAGACC----TCACCAA 1702
Canis            TT--GTCAGAAGCCTGGGGTAGAATTT--TGTTTCTC----CCCAAACC----TTACCAA 1807
R.               TT---TTAGGAGCCTGGGAAAGCATCC--TTCTTCTG----CCCAAACC----TCACCAA 1682
Monodelphis      ------------------------------------------------------------
Xenopus          TGCCCCCAGAAGCCCCAAGCTCCACCCATTGCACCTGAAGTCACAGACTATGATCAGCTG 1785
                                                                             

Mus              AGTATTAATGTGCAGAGTGGTCCC-TTGTCTGGGCCTTG-CCTGTGC-CAACCTGATGCC 1783
M.musculus       AGTATTAATATGCAGAGTGGTCCC-TTGTCTGGGCCT-G-CCTGTGC-CAACCTGATGCC 1232
H.sapiens        AGTATTAATGTACAGAGTGGCCCC-TCACCTGGGCCTTT-CCTGTGC-CAACCTGATGCC 1773
Pan              AGTATTAATGTACAGAGTGGCCCC-TCACCTGGGCCTTT-CCTGTGC-CAACCTGATGCC 1934
Macaca           AGTATTAATGTACAGAGTGGCCCT-TCACCTGGGCCTTT-CCTGTGC-CAACCTGATGCC 2574
Pongo            AGTATTCATGTACAGAGTGGCCCC-TCACTTGGGCCTTTTCCTGTGC-CAACCTGATGCC 2244
Bos              AGTATTAATGTACAGAGTGGCCCCCTTCCCTGGGCCTTT-CCTGTGC-CAACTTGATACC 1760
Canis            AGTATTAATGTACAGAGTGGCCCCCTTCCCTGGGCCCTT-CCTGTGC-CAATCTGATACC 1865
R.               AGTATTAATGTGCAGAGTGGTCCC-TTGTCTGGGCCTTG-CCTGTGC-CAACCTGATGCC 1739
Monodelphis      ------------------------------------------------------------
Xenopus          GGCCTTACTGTGTTCCCTCTTCCA-TGGGCACTGCCAGTGTCTGTATTCAGCACAATGCC 1844
                                                                             

Mus              ---CTTCCCCCCCAA---------------------AGGGTGGGTTCTTATAA--TGGAA 1817
M.musculus       ---GTTCCCCCC-AA---------------------AGGGTGGGTTCTTATAA--TGGAA 1265
H.sapiens        ---C-CTTCCCCAAG---------------------AAGGTGAGTGCTTGTCA--TGGAA 1806
Pan              ---C-CTTCCCCAAG---------------------AAGGTGAGTGCTTGTCA--TGGAA 1967
Macaca           ---C-CTTCCCCAAG---------------------AAAGTGAGTGGTTGTCA--TGGAA 2607
Pongo            ---C-CTTCCCCAAG---------------------AAGGTGAGTGCTTGTCA--TGGAA 2277
Bos              ---CTCTTCCCCAAGGTGGGTGCTGGAGGCCTGGGCAGGATGCCTCCTGGTCA--TGGAA 1815
Canis            ---CCCTTCCCCAAG---------------------AAGGTGGGTGCTTGAGGCCTAGGC 1901
R.               ---C-TTCCCCCAAA---------------------AGGGTGGGT-TTTATAA--TGGAA 1771
Monodelphis      ------------------------------------------------------------
Xenopus          AGGCTGATTCCTGAAAGCACACTCACACTCATACTCACACTCCATGTGACCAATCTCTCT 1904
                                                                             

Mus              AATG-----CCCTGTGATGATA--GGCCCAGTGG-AGCAACTGCCCTTTGGGGGAAGGGA 1869
M.musculus       AATG-----CCCTGTGATGATA--GGCCCAGTGG-AGCAACTGCCCTTTGGGGGAAGGGA 1317
H.sapiens        AATG-----TCCTGTGGTGACA--GGCCCAGTGG-AACAGTCACCCTTCTGGGCAAGGGG 1858
Pan              AATG-----TCCTGTGGTGACA--GGCCCAGTGG-AACAGTCACCCTTCTGGGCAAGGGG 2019
Macaca           AATG-----TCCTGTGGTGACA--GGCCCAGTGG-AACAGTCACCCTTTTGGGCAAGGGG 2659
Pongo            AATG-----TCCTGTGGTGACA--GGCCCAGTGG-AACAGTCACTCTTCTGGGCAAGGGG 2329
Bos              GATG-----CTCTGTGGCGATA--GGCCCAGCGG-AGCAATCACCCTTTCAGGGAAGGGG 1867
Canis            AGTGTGCCTCCTTGAAGTGAGAAAGGCCTAATGG-GGCAATCACCTTCCCAGGGAAGGGG 1960
R.               AATA-----CCCTGTGGTGTTA--GACCCAGTGG-AGTAATTGCCCTTTGGGGGAAGGGA 1823
Monodelphis      ------------------------------------------------------------
Xenopus          TGTG---CCTTCACAAGCAGCACCTACATACAGGCAGGAGCTTGACTCTTACCCACTTAT 1961
                                                                             

Mus              AAT--AATTATACCTCTGGTTTACTCCTGGGTCTTCAGGGTACC---CCAGATCCCGCAT 1924
M.musculus       AAT--AATTATACCTCTGGTTTACTCCTGGGTCTTCAGGGTACC---CCAGATCCCGCGA 1372
H.sapiens        GAACAAATCACACCTCTGGGCT------------TCAGGGTATC---CCAGACCCCTCTC 1903
Pan              GAACAAATCACACCTCTGGGCT------------TCAGGGTATC---CCAGACCCCTCTC 2064
Macaca           GAACAAATCACACTTCTGCGCT------------TCAGGGTATC---CCAGACCCTTCTC 2704
Pongo            GAACAAATCACACCTCTGGGCT------------TCAGGGTATC---CCAGACCCCTCTC 2374
Bos              AACTGAATCATACCTTTAGTCTACCCCTGGGC--TCAGGGTACC---CCAGACTCCTCTC 1922
Canis            ACT-GAATCACACCTTTGGTCTATTCCTGGGC--TCAGGGTATC---CCAGACCCCTCTC 2014
R.               AAT--AATCATACCTCTGGTTTACTCCTGGTC-TTCAGGGTACC---CCAGACCCCTTTT 1877
Monodelphis      ------------------------------------------------------------
Xenopus          GCCTGGCACCCACCCTGGGACTGGCTCACAACTGCCAGAGGAGGGAACCATATGATCTGT 2021
                                                                             

Mus              AACATATCCCACTCCCTCTGCTTCCCCTT-AAACTTTGTGCCTTTGACTATC--ATAGGT 1981
M.musculus       AACATATCCCACTCCCTCTGCTTCCCCTT-AAACTTTGTGCCTTTGACTATC--ATAGGT 1429
H.sapiens        AACACCCGCCCCCC-CCATGTTT-------AAACTTTGTGCCTTTGACCATCTCTTAGGT 1955
Pan              AACAC---TCCCCC-CCACGTTT-------AAACTTTGTGCCTTTGACCATCTCTTAGGT 2113
Macaca           AACACCCCCACCCCACCATGTTT-------AAACTTTGTGCCTTTGACCATCTCTTAGGT 2757
Pongo            AACACCCCCCGGACCCCATGTTT-------AAACTTTGTGCCTTTGACCATCTCTTAGGT 2427
Bos              AACAACCCTCCCTCCCAGCATTC-------AAACTTTGTGCCTTTGACCATCTCCTAGGT 1975
Canis            AACAACTCTCCCTCCCAGTGGTT-------AAACTTTGTGCCTTTGACCATCTTCTAGGT 2067
R.               AACATATCCTACTCCCTATGCATCTCCTTAAAACTTTGTGCCTTCGACTATCAAAAAAAA 1937
Monodelphis      ------------------------------------------------------------
Xenopus          GCTTTCTTACTATTGGTTGGTTTGCTCTGAGGACTTCCCACCCCAAACCTGCCATGTGCT 2081
                                                                             

Mus              CTGCAGATACTTAATGCA--GAGTTCTCAGGCCCTTCACGT----GTGGACAGGGGT--T 2033
M.musculus       CTGCAGATACTTAATGCA--GAGTTCTCAGGCTCTTCACGT----GTGGACAGGGGT--T 1481
H.sapiens        CTAATGATATTTTATGCAAACAGTTCTTGGACCCCTGAATTCTTCAATGACAGGGATGCC 2015
Pan              CTAATGATATTTTATGCAAACAGTTCTTGGACCCCTGAATT---CAATGACAGGGATGCC 2170
Macaca           CTGATGATATTTTATGCA--GAGTTCTTGGGCCCCTGAGTT---CAATGACAGGGATGCC 2812
Pongo            CTGATGATATTTTATGCAAAGAGTTCTTGGACCCCTGAATT---CAATGACAGGGATGCC 2484
Bos              CTGAAGATATTTTATGCAAAGAGTTCTTGGGCCCCTGAAGT---CAAGGATGGGGGTGCT 2032
Canis            CTGAAGACATTTTATGCAAAGAATTCTTGAGCCCCTGAAGTG---GAGGGTGGGAGTGCT 2124
R.               AAAAAAAAAAAAAAAAAA------------------------------------------ 1955
Monodelphis      ------------------------------------------------------------
Xenopus          TCCTGTAGGAGACAGACGGACAAGCTTTAGTGCCCAGCCATGA-ATCCCACGTTCCTTCC 2140
                                                                             

Mus              ACTGCCACCTTGGCTTCTGGAGCCCT------GTCCTATTCAGCACCCCTTCCTGTGT-- 2085
M.musculus       ACTGCCACCTTGGCTTCTGGAGCCCT------GTCCTATTCAGCACCCCTTCCTGTGT-- 1533
H.sapiens        AACACCTTCTTGGCTTCTGGGACCTG----TGTTCTTGCTGAGCACCCTCTCCGGTTTGG 2071
Pan              AACACCTTCTTGGCTTCTGGGACCTG----TGTTCTTGCTGAGCACCCTCTCCGGTTTGG 2226
Macaca           AACACCTTCTTGGCTTCTGGGACCTG----TCTTCTTGCTCAGCACTCTTTCCGGTTTGG 2868
Pongo            AACACCTTCTTGGCTTCTGGGACCTG----TGTTCTTGCTGAGCACCCTCTCCGGTTTGG 2540
Bos              GACAGCTTCTTGGCTTCTGGGACCCCGTCCTCTCCTCGCTCAGCACCTCCTCCAGTTTAG 2092
Canis            GACACTTTCTTGGCTTCTGGAACCCTGTCCTCTCATTGCTCAGCAACCGCTCTGCTTTAA 2184
R.               ------------------------------------------------------------
Monodelphis      ------------------------------------------------------------
Xenopus          CCTCCATCTTCAGCTGATGGTATCCT--CCCTGTGCCTCAGGGCAAGAGACTGGCATCTG 2198
                                                                             

Mus              CTAGGGAGAATAGGGACAGGAGTGGCCGCTATCTGCTCTGCCTTTCGGATGTGCAGCCCT 2145
M.musculus       CTAGGGAGAATAGGGACAGGAGTGGCCGCTATCTGCTCTGCCTTTCGGATGTGCAGCCCT 1593
H.sapiens        GTTGGGATAACAGAGGCAGGAGTGGCAGCTGTCCCCTCT-CCCTGGGGATATGCAACCCT 2130
Pan              GTTGGGATAACAGAGGCAGGAGTGGCAGCTGTCCCCTCT-CCCTGGGGATATGCAACCCT 2285
Macaca           TTTGGGATAACAGAGGCAGGAGTGGCAGCTGTCCCCTCT-CCCTGGGGATATGCAACCCT 2927
Pongo            GTTGGGATAACAGAGGCAGGAGTGGCAGCTGTCCCCTCT-CCCTGGGGATATGCAACCCT 2599
Bos              GTTGGGCCAGCAGAGGCAGGAGTAGCAGCTGTCCCCTCT-CCCTGGG-ATGTGCAGCCCT 2150
Canis            GTTGGGAGACCAGAGGCAGGAATGGCAGCTGTCCCCTCT--CCGGGGGATAGGCAACCCT 2242
R.               ------------------------------------------------------------
Monodelphis      ------------------------------------------------------------
Xenopus          GGGAATGTGCCAATGCTGAGTATTGGGGGTGTCCCACAC-TCTGTGCCTTAGCCAGGGCC 2257
                                                                             

Mus              TAAGAGATTGCCCCAAGCCTGAATATGGTGGCGCACGCCTTTAATCACAGCACTCAGGAG 2205
M.musculus       TAAGAGATTGCCCCAAGCCAGAATATGGTGGCACACGCCTTTAATCACAGCACTCAGGAG 1653
H.sapiens        TAGA-------------------------------------------------------- 2134
Pan              TAGA-------------------------------------------------------- 2289
Macaca           TAGA-------------------------------------------------------- 2931
Pongo            TAGA-------------------------------------------------------- 2603
Bos              TAGA-------------------------------------------------------- 2154
Canis            TAGA-------------------------------------------------------- 2246
R.               ------------------------------------------------------------
Monodelphis      ------------------------------------------------------------
Xenopus          CAGGAATATTGCACACTCACCTGTGACCCTGTTACCTGTAGTTTCTCCCTCCCATTAGTC 2317
                                                                             

Mus              GCAGAGACAGGAGGAATTGTGAGGCCATCCGATCTACAACAGAGTGAGTTCCAGGACAGC 2265
M.musculus       GCAGAGACAGGAGGATTTGTGAGGCCATCCCATCTACAACAGAGTGAGTTCCAGGACAGC 1713
H.sapiens        ------------------------------------------------------------
Pan              ------------------------------------------------------------
Macaca           ------------------------------------------------------------
Pongo            ------------------------------------------------------------
Bos              ------------------------------------------------------------
Canis            ------------------------------------------------------------
R.               ------------------------------------------------------------
Monodelphis      ------------------------------------------------------------
Xenopus          ACATGCTCAGTTGTGGGCTTTAGTTACTGCTGTTGGTAGTCTTTAGGTGGCACTTACCCC 2377
                                                                             

Mus              CAGGGCTATGGAGAGAGAACCTGTCTCCAAAAACCAAAAAGAGCGATTACCCCAGAG--C 2323
M.musculus       CAGGGCTATGGAGAGAGAACCTGTCTCCAAAAACCAAAAAGAGCGATTACCCCAGAG--C 1771
H.sapiens        --------------------------------------------GATTGCCCCAGAG--C 2148
Pan              --------------------------------------------GATTGCCCCAGAG--C 2303
Macaca           --------------------------------------------GATTGCCCCAGAG--C 2945
Pongo            --------------------------------------------GATTGCCCCAGAG--C 2617
Bos              --------------------------------------------GACTGCCGCGGCG--C 2168
Canis            --------------------------------------------GATTGCCTCAGAGTCC 2262
R.               ------------------------------------------------------------
Monodelphis      ------------------------------------------------------------
Xenopus          CAGTCACCTGGATCTCCAATGGATCTCCTGATTACAGGCTTGTGCCCCTCCAGCTGGAGT 2437
                                                                             

Mus              CTTCTTCCTGATGGTAGCGGGGAGGGGCAGGACTGGACCCATCTTGCTCAGTGCCTCCTG 2383
M.musculus       CTTCTTCCTGATGGTAGCGGGGAGGGGCAGGACTGGACCCATCTTGCTCAGTGCCTCCTG 1831
H.sapiens        CCCACTCCCGGC-----CAGGCGGGAGATGGACC---CCTCCCTTGCTCAGTGCCTCCTG 2200
Pan              CCCCCTCCCGGC-----CAGGGGGGAGATGGACC---CCTCCCTTGCTCAGTGCCTCCTG 2355
Macaca           CCCCCTCCCGGC-----CAGGGGGGAGATGGATC---CCTCCCTTGCTCAGTGCCTCCTG 2997
Pongo            CCCCCTCCCGGC-----CAGGGGGGAGATGGACC---CCTCCCTTGCTCAGTGCCTCCTG 2669
Bos              CCTGCTCTCAGC-----CAGTGGGGAGATGGACC---CCTCCCCTGCTCAGTGCCTCGTG 2220
Canis            CTCCTTCCTGGC-----CAGCGGGGAGATGGACC---CCTCCCTTGCTCAGTGCCTCCTG 2314
R.               ------------------------------------------------------------
Monodelphis      ------------------------------------------------------------
Xenopus          TGCGCTATTGGTTGGCTCGTGTGGGGGAGG--------TCCTGTAGCGCAACATTTAGAG 2489
                                                                             

Mus              ACC---TCAATGCCTTTCCTCC-AAGG--GGTCTGTATA--CATTTCTCAAGC------- 2428
M.musculus       ACC---TCAATGCCTTTCC----AAGG--GGTCTGTATA--CATTTCTCAAGC------- 1873
H.sapiens        GCC---GGGGCCCCTCACCCC--AAGG--GGTCTGTATATACATTTCATAAGG------- 2246
Pan              GCC---GGGGCCCCTCACCCC--AAGG--GGTCTGTATATACATTTCATAAGG------- 2401
Macaca           GCC---GGGGCCCCTCACCCC--AAGG--GGTCTGTATATACATTTCATAAGG------- 3043
Pongo            GCC---GGGGCCCCTCACCCC--AAGG--GGTCTGTATATACATTTCATAAGG------- 2715
Bos              GCC---GGGGCCCCTCACCC----AGG--GGTCTGTATATACATTTCGTAAG-------- 2263
Canis            GCCAGAGGGGCCCCTCACCC---AAGG--GGTCTGTATATACATTTCGTATGTCGACCCA 2369
R.               ------------------------------------------------------------
Monodelphis      ------------------------------------------------------------
Xenopus          GCGGAGGCAAGTCTGTATCAGATAATGCTGGTCAGATTAAACATTTCCCTAAAATCCTGT 2549
                                                                             

Mus              ---CTG---------CTCCT-------CCCATGTTTGCATGTGTGTTATAGTCTAC---- 2465
M.musculus       ---CTG---------CTCCT-------CCCATGTTTGCATGTGTGTTATAGTCTAC---- 1910
H.sapiens        ---CCT---------GCCCT-------CCCATGTT-GCATGCCTAT-GTACTCTGC---- 2281
Pan              ---CCT---------GCCCT-------CCCATGTT-GCATGCCTAT-GTACTCTAT---- 2436
Macaca           ---CCT---------GCCCTC-----TCCCATGTT-GCATGCCTATTGTACTCTAC---- 3081
Pongo            ---CCC---------GCCCT-------CCCATGTT-GCATGCCTGT-GTACTCTAC---- 2750
Bos              ---CCC---------CCCCT-------CCCATGTT-GCATGCATGCTATACTCTAC---- 2299
Canis            TCACCC---------CCCCTCACCCCTCCCATATT-GCCTGCATGTTATGCTCTAC---- 2415
R.               ------------------------------------------------------------
Monodelphis      ------------------------------------------------------------
Xenopus          GCAGTTTTAAGGGAGGCCGTCCTTTCCTTCATCTT-ACTCATTCATTCTCCTCTGCCAAA 2608
                                                                             

Mus              AGCCAAAGTATAGCCCTCACT---GTAACCCC-ATCC-TGCCTCCCTCCTTTGGGATA-- 2518
M.musculus       AGCCAAAGTATAGCCCTCACT---GTAACCCC-ATCC-AGCCTCCCTCCTTTGGGATA-- 1963
H.sapiens        -GCCAAAGTGCAGCCCTTCCTCCTGAAGCCTCTGCCC-TGCCTCCCTTTCTGGGAGGG-- 2337
Pan              -GCCAAAGTGCAGCCCTTCCTCCTGAAGCCTCTGCCC-TGCCTCCCTTTCTGGGAGGG-- 2492
Macaca           AGCCAAAGTGTAGCCCTTCCT---GGAGCCTCTGCCC-TGCCTCCCTTTCTGGCAGGG-- 3135
Pongo            AGCCAAAGTGTAGCCCTTCCTCCTGGAGCCTCTGCCC-TGGCTCCCTTTCTGGGAGGA-- 2807
Bos              AGCCAAAGTACAGCCCTTCCTCCTG--GCCTCTGCCC-TGCCTCCCCCTGCAGGGGTG-- 2354
Canis            AGCCAAAGCATAGTCCTTGGTCCTGCAGCCTCTACCCCTGCCTCCTCCTGCTGGGGTGGG 2475
R.               ------------------------------------------------------------
Monodelphis      ------------------------------------------------------------
Xenopus          AATGAAACTGCAACTGTCAATTTTGGGGCCCAAACCTCACTCCCAGTCTGATGCTGGGG- 2667
                                                                             

Mus              -----GGTGTGTGCGTCTGACTTGGG------------------CCTCCAGGGTGTGTAC 2555
M.musculus       -----GGTGTATGCGTCTGACTTGGG------------------CCTCCAGGGTGTGTAC 2000
H.sapiens        --CGGGGTGGGGGTGACTGAATTTGGGCCTCTTGTACAGTTAACTCTCCCAGGTGGATTT 2395
Pan              --CGGGGTGGGGGTGACTGAATTTGGGCCTCTTGTACAGTTAACTCTCCCAGGTGGATTT 2550
Macaca           --TGGGGTAGGGGTGACTGAATTTGGGCCTCTTGTACAGTTCACTCTCCCAGGTGGATTT 3193
Pongo            --TGGGGTGGGGGTGACTGAATTTGGGCCTCTTGTACAGTTAACTCTCCCAGGTGGATTT 2865
Bos              --CTGGG-GGGGATGATGGAGCT---------------GTCA----TCCCAGCTGGATTT 2392
Canis            TGTGGGGGGCGGGCAACTGGACTCTGGCTTCCTGAACTGGTAACTGTGCCAGGTGAATTT 2535
R.               ------------------------------------------------------------
Monodelphis      ------------------------------------------------------------
Xenopus          --CCCAACCAAAATGCAGGGGAGCCGCCATCTTGTT---TCATGTTCCCAGCGCATGTGC 2722
                                                                             

Mus              AGTCAGTGTGGGTTTTGTGGAGGCAATAAGACT---GAAGCAGTAGA--CAATCCCCA-A 2609
M.musculus       AGTCAGTGTGGGTTTTGTGGAGGCAATAAGACT---GAAGCAGTAGA--CAATCCCCA-A 2054
H.sapiens        TGTGGAGGTGAGA---AAAGGGGCATTGAGACTAT-AAAGCAGTAGA--CAATCCCCACA 2449
Pan              TGTGGAGGTGAGA---AAAGGGGCATTGAGACTAT-AAAGCAGTAGA--CAATCCCCAGA 2604
Macaca           TGTGGAGGTGGGA---AAAAGGGCATTGAGACTCTTAAAGCAGTAGA--CAATCCCCAAA 3248
Pongo            TGTGGAGGTGGGA---AAAGGGGCATTGAGACTCT-AAAGCAGTAGA--CAATCCCCAAA 2919
Bos              GGTAGAGGTGGGA---ACAGGGGCATTGAGACTTT-AAAGCAGTAGA--CAATCCCCAGA 2446
Canis            -GTGGAGGCAGGA---ATAGGGGCATTGAGACT---AAAGCAGTAGA--CAATCCCCAAA 2586
R.               ------------------------------------------------------------
Monodelphis      ------------------------------------------------------------
Xenopus          TGGCATAGGGTGACACAATGAAACAAGCTGGCGTCTCTCTCATTGGCTCCACCCACTGCA 2782
                                                                             

Mus              T-------ACCATTTGCAGGTCTGGAACTG-CACTCTCTTTTTTAAAAAACATGTATACA 2661
M.musculus       T-------ACCATTTGCAGGTCTGGAACTG-CACTCTCTTTTTTAAAAAACATGTATACA 2106
H.sapiens        T-------ACCATCTGTAGAGTTGGAACTG-CATTCT-TTTAAAGTTTTATATGCATATA 2500
Pan              T-------ACCATCTGTAGAGTTGGAACTG-CATTCT-TTTAAAGTTTTATATGCATATA 2655
Macaca           T-------ACCATCTGTAGAGTTGGAACTG-CATTCT-TTTAAAGTTTTATATGCATATA 3299
Pongo            T-------ACCATCTGTAGAGTTGGAACTG-CATTCT-TTTAAAGTTTTATATGCATATA 2970
Bos              T-------ACCATCGGTAGGTTTGGAACTG-CATTTA-TTTTTTATTTTATATGTGTATA 2497
Canis            T-------ACCATC-GTACATTTGGGACTG-CATTTA--TTTTTATTTTATATGCATATA 2635
R.               ------------------------------------------------------------
Monodelphis      ------------------------------------------------------------
Xenopus          TTTTTTTTGCCCTTTAAAGGGGTGTATCTCTCAATGAATGTTTAGTATCTTCCTGATCTG 2842
                                                                             

Mus              TTTTAGG-GCTG-TAGATTTATTTTCCTGGTTTTGTTTTTCATTGCTGACTTTTGAGCAC 2719
M.musculus       TTTTAGG-GCTA-TAGATTTATTTTCCTGTTTTTGTTTTTCATTACTGACTTTTGAGCAC 2164
H.sapiens        TTTTAGG-GCTGCTAGACTTACTTTCCTA-TTTTCTTTTCCATTGCTTATTCTTGAGCAC 2558
Pan              TTTTAGG-GCTG-TAGACTTACTTTCCTA-TTTTGTTTTCCATTGCTTATTCTTGAGCAC 2712
Macaca           TTTTAGG-GCTG-TAGACTTACTTTCCTA-TTTTGTTTTCCATGGCTTATTCTCGAGCAC 3356
Pongo            TTTTAGG-GCTG-TAGACTTACTTTCCTA-TTTTGTTTTCCATGGCTTATTCTTAAGCAC 3027
Bos              TTTTAGG-GCTG-TAGATTTACTTTCCTA-ATTTGTTTTCCATAGCTTATTCCTGAGCAC 2554
Canis            TTTTAGG-GCTG-TAGATTTCCTTATCTG------TTTTCCATGGCTTAC-CTTGAGCAC 2686
R.               ------------------------------------------------------------
Monodelphis      ------------------------------------------------------------
Xenopus          CTTTCGGTGAGGTGAGGTGTGTTAAAGGGGCAGTACACCCCGGGGCTT-TACATAAGAAC 2901
                                                                             

Mus              AGAATTATGATAATCAATTACATTTATACATCACCTCGATGACTTTTCCAA--------- 2770
M.musculus       AGAATTATGATAATCAACTACATTTATACATCACCTCGATGACTTTTCCAA--------- 2215
H.sapiens        AAAATGATAATCAATTATTACATTTATACATCACCTTTTTGACTTTTCCAA-GCCCTTTT 2617
Pan              AAAATGATAATCAATTATTACATTTATACATCACCTTTTTGACTTTTCCAA-GCCCTTTT 2771
Macaca           AAAATGGTAATCAATTATTACATTTATACATCACCTTTTTGACTTTTCCAA-GCCCTTTT 3415
Pongo            AAAATGATACTCAATTATTACATTTATACATCACCTTTTTGACTTTTCCAA-GCCCTTTT 3086
Bos              AAAATGATGATAATCGATGACATTTATACATCACCTCTTTGACTTTTTCAAAGCCCTTTT 2614
Canis            AAAATGATTATCGACGACAACGTGTACACAACGCCTCTGTGACTTTTCAAA--------- 2737
R.               ------------------------------------------------------------
Monodelphis      ------------------------------------------------------------
Xenopus          AATCT-ATATTTTATGTTTGCTTTCACTTGCCACTTCCCGGTCTTTTGGAGAAATGGTGT 2960
                                                                             

Mus              ---ACTTTTATTTTTTTTTTTAAACAA--CTGT--------TGGGATTT-TACTCCCTGG 2816
M.musculus       ---ACTTT--TTTTTTTTTTTAAACAA--CTGT--------TGGGATTT-TACTCCCTGG 2259
H.sapiens        ACAGCTCTTGGCATTTTCCTCGCCTAGGCCTGTGAGGTAACTGGGATCG-CACCTTTTAT 2676
Pan              ACAGCTCTTGGCATTTTCCTCGCCTAGGCCTGTGAGGTAACTGGGATCG-CACCTTTTAT 2830
Macaca           ACAGCTGTTGGCATTTTCCTCGCCCAGGCCTGTGAGGTAACTGGGATCG-CACCTTTTAT 3474
Pongo            ACAGCTCTTGGTATTTTCCTCGCCTAGGCCTGTGAGGTAACTGGGATCG-CGCCTTTTAT 3145
Bos              ACGACTCTTGGCATTTTCCTCACCCTGGCCTGTGGGGCAGTTGGAACCG-GTAGCTTTAT 2673
Canis            ------------GCCCCCTTCCAGTGA-----T--------TGGTATTT-TACTCCTCCC 2771
R.               ------------------------------------------------------------
Monodelphis      ------------------------------------------------------------
Xenopus          CAGGCAG--AGAAGGCAGTTAATCTAATTATAAGGCTACCCTATAATAAACTCCTCCTTC 3018
                                                                             

Mus              CCT--TAACTAGGACAGGATTGTACCCCACTCCTCCCCCCCCC--------CTTTTT-CT 2865
M.musculus       CCT--TAACTAGGACAGGGTTGTACCCCACTCCTCCCTCCCCC--------CTTTTTTCT 2309
H.sapiens        ACCAGAGACCTGAGGCAGAT-GAAATTTATTTCCATCTAGGACTAGAAAAACTTGGGTCT 2735
Pan              ACCAGAGACCTGAGGCAGAT-GAAATTTATTTCCATCTAGGACTAGAAAAACTTGGGTCT 2889
Macaca           ACC--AGACCTGAGGCAGAT-GAAATTTATTTCCATCTAGGACTAGAAAAACTTGGGTCT 3531
Pongo            ACCCGAGACCTGAGGCAGAT-GAAATTTATTTTCATCTAGGACTAGAAAAACGTGTGTCT 3204
Bos              CTTTTCTACCAGAGACCCAGAGAAGTGGAGTGTAAGCTAGGACTAGAGAAACTTGGCCCT 2733
Canis            AGC----CTTTGAGGCAGGGGGAGCCCCCCTCAGCATTA------------------TCT 2809
R.               ------------------------------------------------------------
Monodelphis      ------------------------------------------------------------
Xenopus          TCTGTAAGCCTGAGTGACAGGCAACATTGGCTGGAACTTTACACTGAGT--TCATCTCCT 3076
                                                                             

Mus              TTTTCGCCAAGACAACTGAGCAGAAATTTG-------GCTGAGCAGTGTTGTGGGACTAT 2918
M.musculus       TTTTCGCCAAGACAACTGAGCAGAAATTTG-------GCTGAGCAGTGTTGTGGGACTAT 2362
H.sapiens        CTTACCGCGAGACTGAGAGGCAGAAGTCAGCCCGAATGCCTGTCAGTTTCATGGAGGGGA 2795
Pan              CTTACCGCGAGACTGAGAGGCAGAAGTCAGCCCGAATGCCTGTCAGTTTCATGGAGGGGA 2949
Macaca           CTTACCGCGAGACTGAGAGGCAGAAGTCAGCTCGAATGCCTGTCAGTTTCATGGAGGGGA 3591
Pongo            CTTACCGCGAGACTGAGAGGCAGAAGTCAGCCCGAATGCCTGTCAGTTTCATGGAGGGGA 3264
Bos              CCCACTGCGAGGCGGGGAGGCATAAGTT--------TGGCTGTTGGTTTCACAGGAGG-- 2783
Canis            CTAAAGGCAGAGACCTGGGGCACGGCG----------GGCGGGGAGGCCCCCGGGGCG-- 2857
R.               ------------------------------------------------------------
Monodelphis      ------------------------------------------------------------
Xenopus          GATTCCTTAGGGGCAGGGGGTACAGTGTAA---AAACTTCAAATGTTCTACAAAGGGTTT 3133
                                                                             

Mus              GATGTGATAGTTTTAGATCCT-ACCTTCTGCTTTCGGGCAGCTGCAGCCAGCACAGAAAC 2977
M.musculus       GATGTGATAGTTTTAGATCCT-ACCTTCTGCTTTCGGGCAGCTGCAGCCAGCACAGAAAC 2421
H.sapiens        AACGCAAAACCTGCAGTTCCTGAGTACCTTCTACAGGCCCGGCCCAGCCTAGGCCCGGGG 2855
Pan              AACGCAAAACCTGCAGTTCCTGAGTACCTTCTACAGGCCCGGCCCAGCCTAGGCCCGGGG 3009
Macaca           AACGCAAAACCTGCAGTTCCTGAGTACCTTCTACAGGCCCGGCCCAGCCTGGGCCC---- 3647
Pongo            AACGCAAAACCTGCAGTTCCTGAGTACCTTCTACAGGCCCGGCCCAGCCTAGGCCCGGGG 3324
Bos              ----CGTGGGTCACGGTTATTTAATCCCTTCTCCAGGCCTCGCCCTGCAGCAGCAACAGA 2839
Canis            --CACCAGGCCT-CACCCCTGAAGTGACAGCCCCCTGGGCAGCACGCCCTGCCCCCG--- 2911
R.               ------------------------------------------------------------
Monodelphis      ------------------------------------------------------------
Xenopus          GTAGAGGCGGCTACTGCCCCTTTAAAGGACCCTTAGGGCCCCATTTCCAGAGAGCCAGAT 3193
                                                                             

Mus              CTTGCAAGCT------------CACTCTGTGTGTAGGCTTTCTGGACAAGGAATGGTCGC 3025
M.musculus       CTTGCAAGCT------------CACTCTGTATGTAGGCTTTCTGGACAAGGAATGGTCGC 2469
H.sapiens        TGGCCACACCACAGCAAGCCGGCCCCCCCTCTTTTGGCCTTGTGGATAAGGGAGAGTTGA 2915
Pan              TGGCCACACCACAGCAAGCCGGCCCCCA-TCTTTTGGCCTTGTGGATAAGGGAGAGTTGA 3068
Macaca           ---------------------------C-TCTTTTGGCCTTGTGGATAAGGGACAGTTGA 3679
Pongo            TGGCCACACCACAGCAAGCTGGCCCCCC-TCTTTTAGCCTTGTGGATAAGGGAGAGTTGA 3383
Bos              GGATCCGGTCCTG-----------CTCTGTCTTTAGGCCTTGTAGATAAGGGAGAGTGGA 2888
Canis            ----------------------CACTTAATGTCTCAGCCCTG------------GGTTTT 2937
R.               ------------------------------------------------------------
Monodelphis      ------------------------------------------------------------
Xenopus          CTGCACATCCATAG-----GGGCATCTCATGAATATGTCTTGAATATAATGG--TGTGGG 3246
                                                                             

Mus              CAA----------------------ATTTT----TGGTTTGGATGT-------------- 3045
M.musculus       CAA----------------------ATTTT----TGGTTTGGATGT-------------- 2489
H.sapiens        CCG--TTTTCATCC----TGGCCTCCTTTTGCTGTT---TGGATGTTTCCACGGGTCTCA 2966
Pan              CCG--TTTTCATCC----TGGCCTCCTTTTGCTGTTGTTTGGATGTTTCCACGGGTCTCA 3122
Macaca           CCG--TTTTCATCC----TGGACTCCTTTTGCTGTTGTTTAGATGTTTCCACGGGTCTCA 3733
Pongo            CCG--TTTTCATCC----TGGCCTCCTTTTGCTGTTGTTTGGATGTTTCCACGGGTCTCA 3437
Bos              CTAAATCCTCGCCTCCCTTTTTTTTCTTTTCTTTTTGTTTGGATGTTTTCACGGGTCTCA 2948
Canis            TCA----------------------CTTCC--------TCCGATGCGTCCATGGCGCTCA 2967
R.               ------------------------------------------------------------
Monodelphis      ------------------------------------------------------------
Xenopus          CGGGGCTTTGTTTA-----GGCAACACCTCAAAGAAGCACAAGCAGTGCAATAAAATCCA 3301
                                                                             

Mus              CTTATACCAAAGGGAAATAGTCTTCATTAAA----GTTC-GTATTTCTTTTAAAAAAAAA 3100
M.musculus       CTTATACCAAAGGGAAATAGCCTTCATTAAA----GTTC-GTATTTCTTTAAAAAAAAAA 2544
H.sapiens        CTTATACCAAAGGGAAA-ACTCTTCATTAAA----GTCCCGTATTTCTTCTAAAAAAAAA 3021
Pan              CTTATACCAAAGGGAAA-ACTCTTCATTAAA----GTCC-GTATTTCTTCTACCTCTGCC 3176
Macaca           CTTATACCAAAGGGAAA-ACTCTTCATTAAA----GTCC-GTATTTCTTCTA-------- 3779
Pongo            CTTATACCAAAGGGAAA-ACTCTTCATTAAA----GTCC-GTATTTCTTCTAAAAAAAAA 3491
Bos              CTTATACCAAAGGGAAAGAATCTTCATTAAA----GTCC-ATATTTCTTCTACCTCGAAA 3003
Canis            CTTATACCAAAGGGAAATTCTCTTCATTAAA----GTCC-CTATTTCTTGT--------- 3013
R.               ------------------------------------------------------------
Monodelphis      ------------------------------------------------------------
Xenopus          CTCCAGGAGGAGGGGGATCATGGGAAATGTATAGTGTTCAGTTTCCCCATCAAAACAGAA 3361
                                                                             

Mus              AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA----------------- 3143
M.musculus       AAAAAAGAGAGAGAAA-------------------------------------------- 2560
H.sapiens        AAAAAAAAAA-------------------------------------------------- 3031
Pan              TCTTAACCCTTCTGGGAAGCCTATTGTGTACGCCGCGGGCCCTCAGCGGCAGACGGGGAG 3236
Macaca           ------------------------------------------------------------
Pongo            AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGAAAAAGAAAAAAAAAAAAAAA 3551
Bos              AAAAAAAAAAAAAAAAAAAAAA-------------------------------------- 3025
Canis            ------------------------------------------------------------
R.               ------------------------------------------------------------
Monodelphis      ------------------------------------------------------------
Xenopus          TCATTTAAATCTAGTAATAATAATAATGATTAGCAAATGTAATAAACTGCTGCCTGTGGG 3421
                                                                             

Mus              ------------------------------------------------------------
M.musculus       ------------------------------------------------------------
H.sapiens        ------------------------------------------------------------
Pan              GCGGGAGGTCGCGGCC-------------------------------------------- 3252
Macaca           ------------------------------------------------------------
Pongo            AAA--------------------------------------------------------- 3554
Bos              ------------------------------------------------------------
Canis            ------------------------------------------------------------
R.               ------------------------------------------------------------
Monodelphis      ------------------------------------------------------------
Xenopus          GAGTCCAGCCCAAGTCCCTTGCACTATTGCTGCGCCTCAGTGGGGCTGCTGGGAATTGTA 3481
                                                                             

Mus              ------------------------------------------------------------
M.musculus       ------------------------------------------------------------
H.sapiens        ------------------------------------------------------------
Pan              ------------------------------------------------------------
Macaca           ------------------------------------------------------------
Pongo            ------------------------------------------------------------
Bos              ------------------------------------------------------------
Canis            ------------------------------------------------------------
R.               ------------------------------------------------------------
Monodelphis      ------------------------------------------------------------
Xenopus          GTTTAACAACGACGAGACACGCACTTCCCTGCTCTACAACATTGTATAAGTCAGTGGTGA 3541
                                                                             

Mus              ------------------------------------------------------------
M.musculus       ------------------------------------------------------------
H.sapiens        ------------------------------------------------------------
Pan              ------------------------------------------------------------
Macaca           ------------------------------------------------------------
Pongo            ------------------------------------------------------------
Bos              ------------------------------------------------------------
Canis            ------------------------------------------------------------
R.               ------------------------------------------------------------
Monodelphis      ------------------------------------------------------------
Xenopus          GAGTAACTTCCCCTTTAAAAGCATTTGAACCTCTGCCCCCTCCATAGCCGGGTGCAAGTG 3601
                                                                             

Mus              ------------------------------------------------------------
M.musculus       ------------------------------------------------------------
H.sapiens        ------------------------------------------------------------
Pan              ------------------------------------------------------------
Macaca           ------------------------------------------------------------
Pongo            ------------------------------------------------------------
Bos              ------------------------------------------------------------
Canis            ------------------------------------------------------------
R.               ------------------------------------------------------------
Monodelphis      ------------------------------------------------------------
Xenopus          ATAGTTGTGCTGCTCCCACAGTCTGGGGCATAAGACAATCAGCTGCGGAGCAGAGAGTGG 3661
                                                                             

Mus              ------------------------------------------------------------
M.musculus       ------------------------------------------------------------
H.sapiens        ------------------------------------------------------------
Pan              ------------------------------------------------------------
Macaca           ------------------------------------------------------------
Pongo            ------------------------------------------------------------
Bos              ------------------------------------------------------------
Canis            ------------------------------------------------------------
R.               ------------------------------------------------------------
Monodelphis      ------------------------------------------------------------
Xenopus          GGTGCAGGGGGGAAGGGAATGGGCTGTACCCCGCTCTCTGTATTGGGGATATAATGATTC 3721
                                                                             

Mus              ------------------------------------------------------------
M.musculus       ------------------------------------------------------------
H.sapiens        ------------------------------------------------------------
Pan              ------------------------------------------------------------
Macaca           ------------------------------------------------------------
Pongo            ------------------------------------------------------------
Bos              ------------------------------------------------------------
Canis            ------------------------------------------------------------
R.               ------------------------------------------------------------
Monodelphis      ------------------------------------------------------------
Xenopus          ACCCCCCAATCATGTACATAAATCTGGTCTTTGTATTGCATGTCACTTTGTACCCCACCA 3781
                                                                             

Mus              ------------------------------------------------------------
M.musculus       ------------------------------------------------------------
H.sapiens        ------------------------------------------------------------
Pan              ------------------------------------------------------------
Macaca           ------------------------------------------------------------
Pongo            ------------------------------------------------------------
Bos              ------------------------------------------------------------
Canis            ------------------------------------------------------------
R.               ------------------------------------------------------------
Monodelphis      ------------------------------------------------------------
Xenopus          CTAAAGTCTCACCCCTGCACACATTCTGCATATCTTACATGCACACGCGTGTACCCCCGA 3841
                                                                             

Mus              ------------------------------------------------------------
M.musculus       ------------------------------------------------------------
H.sapiens        ------------------------------------------------------------
Pan              ------------------------------------------------------------
Macaca           ------------------------------------------------------------
Pongo            ------------------------------------------------------------
Bos              ------------------------------------------------------------
Canis            ------------------------------------------------------------
R.               ------------------------------------------------------------
Monodelphis      ------------------------------------------------------------
Xenopus          CCCCCCGTGTATATGTCCCACTTTCTTATTGTTTTAATCATATGCCTCGATTATACCAAA 3901
                                                                             

Mus              ------------------------------------------------------------
M.musculus       ------------------------------------------------------------
H.sapiens        ------------------------------------------------------------
Pan              ------------------------------------------------------------
Macaca           ------------------------------------------------------------
Pongo            ------------------------------------------------------------
Bos              ------------------------------------------------------------
Canis            ------------------------------------------------------------
R.               ------------------------------------------------------------
Monodelphis      ------------------------------------------------------------
Xenopus          GGAACTCAGATATTCTGCTTCTTATTGTTATTAAAGTAGTATTTCTATACAAAGCAAAAA 3961
                                                                             

Mus              ------------------
M.musculus       ------------------
H.sapiens        ------------------
Pan              ------------------
Macaca           ------------------
Pongo            ------------------
Bos              ------------------
Canis            ------------------
R.               ------------------
Monodelphis      ------------------
Xenopus          AAAAAAAAAAAAAAAAAA 3979
                                   
PLEASE NOTE: Showing colors on large alignments is slow.




Guide Tree

(
(
(
Mus:-0.03786,
M.musculus:0.07302)
:0.16472,
(
(
(
H.sapiens:0.00000,
Pan:0.03753)
:0.02754,
(
Macaca:0.04517,
Pongo:0.02546)
:0.01078)
:0.04340,
Bos:0.07244)
:0.01591)
:0.02281,
(
R.:0.03547,
(
Monodelphis:0.01975,
Xenopus:0.36549)
:0.16089)
:0.00306,
Canis:0.12807);


Cladogram

Right-click on the above tree to see display options.
Problems printing? Read how to print a Phylogram or Cladogram.
spacer
spacer