Job Title: Mus musculus PolgA

BLASTN 2.2.16 (Mar-25-2007)
RID: 6601F7XK012


Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
           5,319,389 sequences; 20,775,880,397 total letters

If you have any problems or questions with the results of this search
please refer to the BLAST FAQs Taxonomy reports

Query=  Mus musculus PolgA
Length=4596


Distance tree of resultsNew  
Legend for links to other resources: UniGene GEO Gene Structure Map Viewer Sequences producing significant alignments: (Click headers to sort columns)
Accession Description Max score Total score Query coverage E value Max ident Links
NM_017462.2
Mus musculus polymerase (DNA directed), gamma (Polg), mRNA
84888488100%0.0100% UniGene infoGeoGene info
AK133584.1
Mus musculus adult male pituitary gland cDNA, RIKEN full-length enriched library, clone:5330409N10 product:polymerase (DNA directed), gamma, full insert sequence
8338833898%0.099% UniGene infoGene info
BC053024.1
Mus musculus cDNA clone IMAGE:5721109, containing frame-shift errors
8329832998%0.099% UniGene infoGeoGene info
U53584.1
Mus musculus DNA polymerase gamma mRNA, nuclear gene encoding mitochondrial protein, complete cds
8152815298%0.099% UniGene infoGeoGene info
AK148091.1
Mus musculus B16 F10Y cells cDNA, RIKEN full-length enriched library, clone:G370014F07 product:polymerase (DNA directed), gamma, full insert sequence
8004800494%0.099% UniGene infoGene info
BC131676.1
Mus musculus cDNA clone IMAGE:40110975
7483748388%0.0100%
AB121698.1
Mus musculus Pol gamma mRNA for mitochondrial DNA polymerase catalytic subunit, complete cds
7223722385%0.099% UniGene infoGeoGene info
BC061472.1
Mus musculus polymerase (DNA directed), gamma, mRNA (cDNA clone MGC:69606 IMAGE:6827238), complete cds
6122832898%0.0100% UniGene infoGeoGene info
AJ245646.1
Rattus norvegicus mRNA for DNA polymerase gamma (MIP1 gene)
5614561479%0.094% UniGene infoGeoGene info
NM_053528.1
Rattus norvegicus polymerase (DNA directed), gamma (Polg), mRNA >emb|AJ245647.1|RNO245647 Rattus norvegicus mRNA for DNA polymerase gamma, isolated from Novikoff hepatoma cell line (MIP1 gene)
5609560979%0.094% UniGene infoGeoGene info
BC080291.1
Mus musculus cDNA clone IMAGE:6821261
4663784692%0.0100% UniGene infoGeoGene info
XM_001092360.1
PREDICTED: Macaca mulatta polymerase (DNA directed), gamma (POLG), mRNA
4473447392%0.085% UniGene infoGene info
U60325.1
Human DNA polymerase gamma mRNA, nuclear gene encoding mitochondrial protein, complete cds
4277452690%0.086% UniGene infoGeoGene info
BC042571.1
Homo sapiens polymerase (DNA directed), gamma, mRNA (cDNA clone MGC:21267 IMAGE:4384475), complete cds
4274458392%0.086% UniGene infoGene info
BC050559.1
Homo sapiens polymerase (DNA directed), gamma, mRNA (cDNA clone MGC:57709 IMAGE:6042595), complete cds
4274453589%0.086% UniGene infoGene info
NM_002693.1
Homo sapiens polymerase (DNA directed), gamma (POLG), mRNA >emb|X98093.1|MIHSDNAPL H.sapiens mRNA for DNA polymerase gamma, mitochondrial protein
4274458392%0.086% UniGene infoGeoGene info
D84103.1
Homo sapiens mRNA for mitochondrial DNA polymerase gamma, complete cds
4263447288%0.086% UniGene infoGeoGene info
XM_523149.2
PREDICTED: Pan troglodytes polymerase (DNA directed), gamma (POLG), mRNA
4193445889%0.087% Gene info
XR_028572.1
PREDICTED: Bos taurus similar to DNA polymerase gamma (LOC533090), mRNA
3965396585%0.085% UniGene infoGene info
AK162462.1
Mus musculus 12 days embryo embryonic body between diaphragm region and neck cDNA, RIKEN full-length enriched library, clone:9430069H22 product:polymerase (DNA directed), gamma, full insert sequence
2200344940%0.099% UniGene infoGene info
XM_545850.2
PREDICTED: Canis familiaris similar to DNA polymerase gamma subunit 1 (Mitochondrial DNA polymerase catalytic subunit) (PolG-alpha) (LOC488732), mRNA
2002396181%0.086% UniGene infoGene info
AC110909.10
Mus musculus chromosome 7, clone RP24-186G5, complete sequence
14288645100%0.0100%
AF268970.1
Mus musculus mitochondrial DNA polymerase gamma (Polg) gene, exons 1 and 2 and 5'UTR; nuclear gene for mitochondrial product
1417178421%0.099% Gene info
AK135341.1
Mus musculus 12 days embryo female mullerian duct includes surrounding region cDNA, RIKEN full-length enriched library, clone:6820401J03 product:polymerase (DNA directed), gamma, full insert sequence
1352158619%0.0100% UniGene infoGene info
AK130624.1
Homo sapiens cDNA FLJ27114 fis, clone SPL05987, highly similar to DNA polymerase gamma (EC 2.7.7.7)
1275127526%0.085% UniGene infoGene info
AF268975.1
Mus musculus mitochondrial DNA polymerase gamma (Polg) gene, exons 19 through 23 and complete cds; nuclear gene for mitochondrial product
1190243228%0.0100% Gene info
U60297.1
Gallus gallus DNA polymerase gamma mRNA, nuclear gene encoding mitochondrial protein, partial cds
977 97732%0.078% UniGene infoGene info
L13786.1
Gallus gallus homeobox protein (GH6) mRNA, complete cds
913 91332%0.078%
AL110092.1
Homo sapiens EST from clone 32577, 5' end
852 85214%0.089% UniGene infoGene info
AK181157.1
Mus musculus cDNA, clone:Y0G0117C08, strand:minus, reference:ENSEMBL:Mouse-Transcript-ENST:ENSMUST00000036427, based on BLAT search
758 7589%0.099% UniGene info
NM_145946.2
Mus musculus cDNA sequence BC025462 (BC025462), mRNA
741 7418%0.0100% GeoGene info
BC027836.1
Mus musculus cDNA sequence BC025462, mRNA (cDNA clone MGC:38195 IMAGE:5322726), complete cds
741 7418%0.0100% GeoGene info
AK219254.1
Mus musculus cDNA, clone:Y2G0147O06, strand:minus, reference:ENSEMBL:Mouse-Transcript-ENST:ENSMUST00000036427, based on BLAT search
725 7258%0.099% UniGene infoGene info
AK215702.1
Mus musculus cDNA, clone:Y2G0135O10, strand:plus, reference:ENSEMBL:Mouse-Transcript-ENST:ENSMUST00000036427, based on BLAT search
647 6477%0.099% UniGene infoGene info
AC124068.6
Homo sapiens chromosome 15, clone RP11-217B1, complete sequence
601309855%9e-16894%
AF497906.1
Homo sapiens polymerase (DNA directed), gamma (POLG) gene, complete cds
601309455%9e-16894%
AC005317.2
Homo sapiens chromosome 15q26.1 clone PAC pDJ457j11 containing DNA polymerase gamma (polg) gene, complete sequence
601309455%9e-16894%
AC005316.1
Human Chromosome 15q26.1 PAC clone pDJ10k5 containing human DNA polymerase gamma (polg) gene, complete sequence
601309455%9e-16894%
XM_001234310.1
PREDICTED: Gallus gallus similar to DNA polymerase gamma (LOC770992), mRNA
593 59320%2e-16578% UniGene infoGene info
AK207449.1
Mus musculus cDNA, clone:Y2G0108A16, strand:plus, reference:ENSEMBL:Mouse-Transcript-ENST:ENSMUST00000036427, based on BLAT search
545 5456%4e-15199% UniGene info
U74651.1
Human DNA polymerase gamma (polg) gene, promoter region and partial cds
503 86316%3e-13896% Gene info
AF268974.1
Mus musculus mitochondrial DNA polymerase gamma (Polg) gene, exons 16, 17, and 18; nuclear gene for mitochondrial product
462 92811%5e-126100% GeoGene info
AF268972.1
Mus musculus mitochondrial DNA polymerase gamma (Polg) gene, exons 4 through 10; nuclear gene for mitochondrial product
435202923%1e-117100% Gene info
AK199644.1
Mus musculus cDNA, clone:Y1G0131O21, strand:minus, reference:ENSEMBL:Mouse-Transcript-ENST:ENSMUST00000036427, based on BLAT search
409 4094%6e-11098% UniGene infoGene info
AF268971.1
Mus musculus mitochondrial DNA polymerase gamma (Polg) gene, exon 3; nuclear gene for mitochondrial product
366 3664%4e-97100% Gene info
XM_001092826.1
PREDICTED: Macaca mulatta similar to CG13745-PA, transcript variant 2 (LOC699878), mRNA
311 3118%2e-8081% UniGene infoGene info
XM_001093053.1
PREDICTED: Macaca mulatta similar to CG13745-PA, transcript variant 3 (LOC699878), mRNA
311 3118%2e-8081% UniGene infoGene info
XM_001092590.1
PREDICTED: Macaca mulatta similar to CG13745-PA, transcript variant 1 (LOC699878), mRNA
311 3118%2e-8081% UniGene infoGene info
XM_425079.2
PREDICTED: Gallus gallus polymerase (DNA directed), gamma (POLG), mRNA
303 30312%3e-7877% UniGene infoGene info
AF268973.1
Mus musculus mitochondrial DNA polymerase gamma (Polg) gene, exons 11 through 15; nuclear gene for mitochondrial product
303 99111%3e-78100% Gene info
NM_018193.2
Homo sapiens Fanconi anemia, complementation group I (FANCI), mRNA
302 3027%1e-7782% UniGene infoGeoGene info
AK027564.1
Homo sapiens cDNA FLJ14658 fis, clone NT2RP2002549
296 2967%5e-7682% UniGene infoGeoGene info
AB058697.1
Homo sapiens mRNA for KIAA1794 protein, partial cds
296 2967%5e-7682% UniGene infoGeoGene info
XM_001166865.1
PREDICTED: Pan troglodytes similar to KIAA1794 protein, transcript variant 2 (LOC453636), mRNA
291 2917%2e-7482% Gene info
XM_001166926.1
PREDICTED: Pan troglodytes similar to KIAA1794 protein, transcript variant 3 (LOC453636), mRNA
291 2917%2e-7482% Gene info
XM_001167075.1
PREDICTED: Pan troglodytes similar to KIAA1794 protein, transcript variant 7 (LOC453636), mRNA
291 2917%2e-7482% Gene info
XM_001166767.1
PREDICTED: Pan troglodytes similar to KIAA1794 protein, transcript variant 1 (LOC453636), mRNA
291 2917%2e-7482% Gene info
XM_510581.2
PREDICTED: Pan troglodytes similar to KIAA1794 protein, transcript variant 8 (LOC453636), mRNA
291 2917%2e-7482% Gene info
XM_001167020.1
PREDICTED: Pan troglodytes similar to KIAA1794 protein, transcript variant 6 (LOC453636), mRNA
291 2917%2e-7482% Gene info
XM_001166991.1
PREDICTED: Pan troglodytes similar to KIAA1794 protein, transcript variant 5 (LOC453636), mRNA
291 2917%2e-7482% Gene info
XM_001166960.1
PREDICTED: Pan troglodytes similar to KIAA1794 protein, transcript variant 4 (LOC453636), mRNA
291 2917%2e-7482% Gene info
DQ285413.1
Homo sapiens mitochondrial DNA polymerase gamma (POLG) gene, POLG-1085G allele, exon 3 and partial cds; nuclear gene for mitochondrial product
250 2504%4e-6289% Gene info
DQ285412.1
Homo sapiens mitochondrial DNA polymerase gamma (POLG) gene, POLG-1085C allele, exon 3 and partial cds; nuclear gene for mitochondrial product
244 2444%2e-6089% Gene info
XM_600723.3
PREDICTED: Bos taurus hypothetical LOC522442 (LOC522442), mRNA
239 2398%8e-5978% UniGene infoGene info
AK186656.1
Mus musculus cDNA, clone:Y0G0138D14, strand:plus, reference:ENSEMBL:Mouse-Transcript-ENST:ENSMUST00000036427, based on BLAT search
163 1631%5e-3698% Gene info
AK204663.1
Mus musculus cDNA, clone:Y1G0149D17, strand:minus, reference:ENSEMBL:Mouse-Transcript-ENST:ENSMUST00000036427, based on BLAT search
152 2713%1e-32100% UniGene infoGene info
AK185475.1
Mus musculus cDNA, clone:Y0G0134C24, strand:minus, reference:ENSEMBL:Mouse-Transcript-ENST:ENSMUST00000036427, based on BLAT search
152 2713%1e-32100% UniGene infoGene info
Alignments
>ref|NM_017462.2| UniGene infoGeoGene info Mus musculus polymerase (DNA directed), gamma (Polg), mRNA Length=4596 Score = 8488 bits (4596), Expect = 0.0 Identities = 4596/4596 (100%), Gaps = 0/4596 (0%) Strand=Plus/Plus Query 1 ATTGGCGGCGCTCTTATTGGACGCTCGGGGGAGTCTCCCGCCTGCCTCTGGGTAGCCGCG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1 ATTGGCGGCGCTCTTATTGGACGCTCGGGGGAGTCTCCCGCCTGCCTCTGGGTAGCCGCG 60 Query 61 GGACCCAGTTCGCGCAGACGGGAAGTTGCGGCTGCTCCCGAGACCGCACGCCACCCTGAG 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 61 GGACCCAGTTCGCGCAGACGGGAAGTTGCGGCTGCTCCCGAGACCGCACGCCACCCTGAG 120 Query 121 GCTGCGTGGGCCGCGCGCCGCGGACGCCGCGTCGTCGCCGGGGCTGTGGGCTGCCGCAGA 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 121 GCTGCGTGGGCCGCGCGCCGCGGACGCCGCGTCGTCGCCGGGGCTGTGGGCTGCCGCAGA 180 Query 181 ACGGGAAGCGCGAAGCGGACCGAGGACTTGTGTGAGGAAGGCAGGCATGGTGAGACCTAT 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 181 ACGGGAAGCGCGAAGCGGACCGAGGACTTGTGTGAGGAAGGCAGGCATGGTGAGACCTAT 240 Query 241 TTCACTGACAGGAGCACAGAGAGGGGACGCGTCTCTCTCTGAGTCTTTCGGCCACTAAAA 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 241 TTCACTGACAGGAGCACAGAGAGGGGACGCGTCTCTCTCTGAGTCTTTCGGCCACTAAAA 300 Query 301 GCAGTCAAGCTGGAGCCCAAAGCCCGGTGCCCCGACTCACAGCGGGGGGCTCCCTGCACC 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 301 GCAGTCAAGCTGGAGCCCAAAGCCCGGTGCCCCGACTCACAGCGGGGGGCTCCCTGCACC 360 Query 361 AACCATGAGCCGCCTGCTCTGGAAGAAGGTGGCTGGCGCCAAGGTCGCCTCAGGGCCAGT 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 361 AACCATGAGCCGCCTGCTCTGGAAGAAGGTGGCTGGCGCCAAGGTCGCCTCAGGGCCAGT 420 Query 421 ACCAGCAACCGCGCGCTGGGTCTCCAGCTCCGTCCTCGACCCCGTCCCCAGCGACGGGCG 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 421 ACCAGCAACCGCGCGCTGGGTCTCCAGCTCCGTCCTCGACCCCGTCCCCAGCGACGGGCG 480 Query 481 GCCGCCGTCGCAAATGCCCTCCTCCGAGAATGGGCAGCTGCGGCTCAACCCTCTGCTCAT 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 481 GCCGCCGTCGCAAATGCCCTCCTCCGAGAATGGGCAGCTGCGGCTCAACCCTCTGCTCAT 540 Query 541 CCAGATGTTGTCGAGAGGCCTGCACGAGCAGATCTTCGGGTGCGGCGGGGAAATGCCCGA 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 541 CCAGATGTTGTCGAGAGGCCTGCACGAGCAGATCTTCGGGTGCGGCGGGGAAATGCCCGA 600 Query 601 CGAGGCCGCGGTGCAGCGCAGCGTAGAGCACCTGCAGAAGCACGGGCTCTGGGGGCAGCC 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 601 CGAGGCCGCGGTGCAGCGCAGCGTAGAGCACCTGCAGAAGCACGGGCTCTGGGGGCAGCC 660 Query 661 GGCCACGCCCTTGCCAGACGTGGAGCTGCGCCTGCCCCGGCTCTTCGGGGGCAACCTGGA 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 661 GGCCACGCCCTTGCCAGACGTGGAGCTGCGCCTGCCCCGGCTCTTCGGGGGCAACCTGGA 720 Query 721 CCAGCACTTCCGCCTCCTGGCCCAGAAGCAGAGCCTGCCTTACTTGGAGGCGGCCGCCTC 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 721 CCAGCACTTCCGCCTCCTGGCCCAGAAGCAGAGCCTGCCTTACTTGGAGGCGGCCGCCTC 780 Query 781 GTTATTGGAGGCCCAATTGCCCCCCGAGCCCAAGAGCTGGGCCTGGGCGGAGGGCTGGAC 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 781 GTTATTGGAGGCCCAATTGCCCCCCGAGCCCAAGAGCTGGGCCTGGGCGGAGGGCTGGAC 840 Query 841 CCGGTACGGCCCCGAGGGGGAGGCCGAACCCGTGGCCATCCCCGAGGAGCGGGCCCTGGT 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 841 CCGGTACGGCCCCGAGGGGGAGGCCGAACCCGTGGCCATCCCCGAGGAGCGGGCCCTGGT 900 Query 901 GTTCGACGTGGAGGTCTGCTTGGCAGAGGGAACCTGCCCCACTTTGGCGGTGGCCATATC 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 901 GTTCGACGTGGAGGTCTGCTTGGCAGAGGGAACCTGCCCCACTTTGGCGGTGGCCATATC 960 Query 961 CCCCTCGGCCTGGTATTCCTGGTGCAGCCGGCGGCTGGTGGAAGAGCGTTACTCTTGGAC 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 961 CCCCTCGGCCTGGTATTCCTGGTGCAGCCGGCGGCTGGTGGAAGAGCGTTACTCTTGGAC 1020 Query 1021 CAGCCAGCTATCGCCGGCTGACCTAATCCCTTTGGGGGGCTCCACTAGTGCCAGCAGCTC 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1021 CAGCCAGCTATCGCCGGCTGACCTAATCCCTTTGGGGGGCTCCACTAGTGCCAGCAGCTC 1080 Query 1081 CACCAAGCAGGATGGGCAGGAACAGTTAGTGGTGGGGCACAATGTTTCCTTTGACCGAGC 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1081 CACCAAGCAGGATGGGCAGGAACAGTTAGTGGTGGGGCACAATGTTTCCTTTGACCGAGC 1140 Query 1141 CCATATCAGGGAACAGTATCTGATTCAGGACTCCCGGATGCGTTTTCTCGATACTATGAG 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1141 CCATATCAGGGAACAGTATCTGATTCAGGACTCCCGGATGCGTTTTCTCGATACTATGAG 1200 Query 1201 CATGCACATGGCCATCTCGGGGCTGAGCAGCTTCCAGCGCAGCCTGTGGATGGGAGCCAA 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1201 CATGCACATGGCCATCTCGGGGCTGAGCAGCTTCCAGCGCAGCCTGTGGATGGGAGCCAA 1260 Query 1261 GCAGGGAAAGCACAAGACCCAGCAGTCCACAAAGCGAGGGCAGAAGTCCCCGAGGAAAGC 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1261 GCAGGGAAAGCACAAGACCCAGCAGTCCACAAAGCGAGGGCAGAAGTCCCCGAGGAAAGC 1320 Query 1321 CAATGGTCCAGCGATCTCATCTTGGGACTGGATGGATATCAGCAGTGCCAATAATCTTGC 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1321 CAATGGTCCAGCGATCTCATCTTGGGACTGGATGGATATCAGCAGTGCCAATAATCTTGC 1380 Query 1381 AGATGTGCACAACCTTTATGTGGGGGGACCTCCCTTAGAGAAGGAGCCTCGGGAGCTGTT 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1381 AGATGTGCACAACCTTTATGTGGGGGGACCTCCCTTAGAGAAGGAGCCTCGGGAGCTGTT 1440 Query 1441 CGTCAAAGGCAGCATGAGGGATATCCGAGAGAACTTCCAGGATCTGATGCAGTACTGCGC 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1441 CGTCAAAGGCAGCATGAGGGATATCCGAGAGAACTTCCAGGATCTGATGCAGTACTGCGC 1500 Query 1501 CCGTGATGTGTGGGCCACCTTTGAGGTTTTCCAGCAGCAGCTGCCACTCTTCTTGGAGAG 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1501 CCGTGATGTGTGGGCCACCTTTGAGGTTTTCCAGCAGCAGCTGCCACTCTTCTTGGAGAG 1560 Query 1561 GTGTCCCCACCCAGTGACTCTGGCTGGCATGCTGGAGATGGGTGTGTCCTACCTGCCTGT 1620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1561 GTGTCCCCACCCAGTGACTCTGGCTGGCATGCTGGAGATGGGTGTGTCCTACCTGCCTGT 1620 Query 1621 CAACCAGAACTGGGAGCGTTACCTGACAGAGGCACAGAACACATATGAGGAGCTCCAGCG 1680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1621 CAACCAGAACTGGGAGCGTTACCTGACAGAGGCACAGAACACATATGAGGAGCTCCAGCG 1680 Query 1681 GGAGATGAAGAAGTCGCTGATGGATCTGGCTAATGATGCCTGTCAGTTGCTCTCAGGAGA 1740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1681 GGAGATGAAGAAGTCGCTGATGGATCTGGCTAATGATGCCTGTCAGTTGCTCTCAGGAGA 1740 Query 1741 GAGGTACAAAGAAGACCCTTGGCTCTGGGACCTAGAATGGGATTTGCAGGAGTTTAAGCA 1800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1741 GAGGTACAAAGAAGACCCTTGGCTCTGGGACCTAGAATGGGATTTGCAGGAGTTTAAGCA 1800 Query 1801 GAAAAAGGCAAAGAAGGTGAAGAAGCCAGCCTCAGCCAGCAAGTTGCCCATCGAGGGAGC 1860 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1801 GAAAAAGGCAAAGAAGGTGAAGAAGCCAGCCTCAGCCAGCAAGTTGCCCATCGAGGGAGC 1860 Query 1861 TGGGCCCTTTGGGGATCCCATGGATCAGGAAGATCCTGGCCCGCCCAGCGAGGAGGAGGA 1920 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1861 TGGGCCCTTTGGGGATCCCATGGATCAGGAAGATCCTGGCCCGCCCAGCGAGGAGGAGGA 1920 Query 1921 GCTTCAGCGAAGTGTAACAGCCCACAACCGGTTACAGCAGCTGAGGAGCACCACGGACCT 1980 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1921 GCTTCAGCGAAGTGTAACAGCCCACAACCGGTTACAGCAGCTGAGGAGCACCACGGACCT 1980 Query 1981 CCTGCCTAAGCGACCCCAGCACCTTCCAGGACACCCTGGGTGGTACCGGAAGCTCTGCCC 2040 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1981 CCTGCCTAAGCGACCCCAGCACCTTCCAGGACACCCTGGGTGGTACCGGAAGCTCTGCCC 2040 Query 2041 TCGACTAGATGACCCTGCCTGGGCTCCCGGCCCCAGCCTCCTCAGCCTGCAAATGCGGGT 2100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2041 TCGACTAGATGACCCTGCCTGGGCTCCCGGCCCCAGCCTCCTCAGCCTGCAAATGCGGGT 2100 Query 2101 CACTCCTAAGCTCATGGCACTGACCTGGGATGGTTTTCCTCTACACTACTCAGACTCTCA 2160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2101 CACTCCTAAGCTCATGGCACTGACCTGGGATGGTTTTCCTCTACACTACTCAGACTCTCA 2160 Query 2161 TGGTTGGGGCTACCTAGTGCCTGGGCGTCGGGATAATCTGACCGAGCCGCCAGTGAGCCC 2220 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2161 TGGTTGGGGCTACCTAGTGCCTGGGCGTCGGGATAATCTGACCGAGCCGCCAGTGAGCCC 2220 Query 2221 CACTGTAGAATCCGCTGCAGTAACCTGCCCCTACAGAGCCATCGAGTCCTTATACAGGAA 2280 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2221 CACTGTAGAATCCGCTGCAGTAACCTGCCCCTACAGAGCCATCGAGTCCTTATACAGGAA 2280 Query 2281 GCACTGCCTTGAACAGGGGAAGCAGCAATTGGAGCCCCAGGAGGTAGACCTGGCTGAGGA 2340 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2281 GCACTGCCTTGAACAGGGGAAGCAGCAATTGGAGCCCCAGGAGGTAGACCTGGCTGAGGA 2340 Query 2341 GTTCTTACTCACTGACAGTAGTGCCATGTGGCAAACGGTAGAAGAACTGGGCTGCTTAGA 2400 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2341 GTTCTTACTCACTGACAGTAGTGCCATGTGGCAAACGGTAGAAGAACTGGGCTGCTTAGA 2400 Query 2401 CGTAGAGGCTGAGGCCAAGATGGAGAATTCAGGGCTGAGCCAACCTCTAGTTCTGCCTGC 2460 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2401 CGTAGAGGCTGAGGCCAAGATGGAGAATTCAGGGCTGAGCCAACCTCTAGTTCTGCCTGC 2460 Query 2461 TGCTTGTGCCCCCAAATCCAGCCAGCCCACGTATCACCATGGCAACGGACCTTATAATGA 2520 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2461 TGCTTGTGCCCCCAAATCCAGCCAGCCCACGTATCACCATGGCAACGGACCTTATAATGA 2520 Query 2521 TGTGAATATCCCTGGTTGCTGGTTTTTCAAGCTGCCTCACAAGGACGGTAACAACTACAA 2580 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2521 TGTGAATATCCCTGGTTGCTGGTTTTTCAAGCTGCCTCACAAGGACGGTAACAACTACAA 2580 Query 2581 TGTGGGCAGTCCCTTTGCCAAAGATTTCCTGCCCAAGATGGAGGATGGCACCCTGCAGGC 2640 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2581 TGTGGGCAGTCCCTTTGCCAAAGATTTCCTGCCCAAGATGGAGGATGGCACCCTGCAGGC 2640 Query 2641 TGGCCCAGGAGGTGCCAGTGGGCCTCGTGCCCTGGAAATAAATAAAATGATTTCTTTTTG 2700 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2641 TGGCCCAGGAGGTGCCAGTGGGCCTCGTGCCCTGGAAATAAATAAAATGATTTCTTTTTG 2700 Query 2701 GAGGAATGCTCATAAACGTATCAGTTCCCAGATGGTGGTATGGCTCCCCAGGTCAGCTCT 2760 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2701 GAGGAATGCTCATAAACGTATCAGTTCCCAGATGGTGGTATGGCTCCCCAGGTCAGCTCT 2760 Query 2761 GCCCCGGGTTGTGACCAGGCACCCCAGCTTCGATGAGGAAGGCCACTATGGGGCCATCCT 2820 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2761 GCCCCGGGTTGTGACCAGGCACCCCAGCTTCGATGAGGAAGGCCACTATGGGGCCATCCT 2820 Query 2821 ACCCCAGGTGGTGACTGCTGGCACCATCACCCGTCGAGCTGTGGAGCCCACGTGGCTCAC 2880 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2821 ACCCCAGGTGGTGACTGCTGGCACCATCACCCGTCGAGCTGTGGAGCCCACGTGGCTCAC 2880 Query 2881 TGCCAGTAATGCTCGGCCTGACCGGGTAGGCAGTGAGTTGAAAGCCATGGTGCAGGCTCC 2940 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2881 TGCCAGTAATGCTCGGCCTGACCGGGTAGGCAGTGAGTTGAAAGCCATGGTGCAGGCTCC 2940 Query 2941 ACCTGGCTATGTCCTTGTGGGTGCTGATGTGGACTCACAGGAACTGTGGATCGCAGCTGT 3000 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2941 ACCTGGCTATGTCCTTGTGGGTGCTGATGTGGACTCACAGGAACTGTGGATCGCAGCTGT 3000 Query 3001 ACTTGGAGATGCTCACTTTGCTGGGATGCATGGCTGCACGGCCTTTGGCTGGATGACTCT 3060 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3001 ACTTGGAGATGCTCACTTTGCTGGGATGCATGGCTGCACGGCCTTTGGCTGGATGACTCT 3060 Query 3061 GCAGGGCAGGAAGAGCAGAGGCACTGATCTGCACAGCAAGACAGCTGCCACTGTGGGCAT 3120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3061 GCAGGGCAGGAAGAGCAGAGGCACTGATCTGCACAGCAAGACAGCTGCCACTGTGGGCAT 3120 Query 3121 CAGCCGAGAGCATGCCAAAATCTTCAACTATGGCCGCATCTATGGGGCTGGGCAGTCCTT 3180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3121 CAGCCGAGAGCATGCCAAAATCTTCAACTATGGCCGCATCTATGGGGCTGGGCAGTCCTT 3180 Query 3181 TGCTGAGCGCCTACTGATGCAGTTCAACCACAGGCTCACAAGGCAGGAGGCAGCTGAGAA 3240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3181 TGCTGAGCGCCTACTGATGCAGTTCAACCACAGGCTCACAAGGCAGGAGGCAGCTGAGAA 3240 Query 3241 GGCCCAGCAGATGTATGCAGTCACAAAAGGCCTGCGCCGGTATCGGCTGTCTGCGGATGG 3300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3241 GGCCCAGCAGATGTATGCAGTCACAAAAGGCCTGCGCCGGTATCGGCTGTCTGCGGATGG 3300 Query 3301 TGAGTGGCTGGTGAAACAGTTGAATCTTCCTGTGGACAGGACAGAGGACGGCTGGGTCTC 3360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3301 TGAGTGGCTGGTGAAACAGTTGAATCTTCCTGTGGACAGGACAGAGGACGGCTGGGTCTC 3360 Query 3361 CCTACAAGATCTTCGAATGATCCGAAGAGAAGCTTCAAGGAAGTCACGATGGAAGAAGTG 3420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3361 CCTACAAGATCTTCGAATGATCCGAAGAGAAGCTTCAAGGAAGTCACGATGGAAGAAGTG 3420 Query 3421 GGAGGTAGCCTCTGAACGAGCATGGACAGGGGGCACAGAGTCAGAAATGTTTAATAAGCT 3480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3421 GGAGGTAGCCTCTGAACGAGCATGGACAGGGGGCACAGAGTCAGAAATGTTTAATAAGCT 3480 Query 3481 GGAGAGTATTGCCATGTCTGATACACCACGTACCCCAGTACTGGGCTGCTGCATCAGCAG 3540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3481 GGAGAGTATTGCCATGTCTGATACACCACGTACCCCAGTACTGGGCTGCTGCATCAGCAG 3540 Query 3541 AGCCTTGGAGCCCTCAGTTGTCCAGGGAGAGTTTATAACCAGTCGTGTGAACTGGGTGGT 3600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3541 AGCCTTGGAGCCCTCAGTTGTCCAGGGAGAGTTTATAACCAGTCGTGTGAACTGGGTGGT 3600 Query 3601 ACAGAGCTCTGCTGTAGACTACTTACATCTCATGCTTGTGGCCATGAAGTGGCTGTTTGA 3660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3601 ACAGAGCTCTGCTGTAGACTACTTACATCTCATGCTTGTGGCCATGAAGTGGCTGTTTGA 3660 Query 3661 GGAATTTGCCATTGATGGGCGCTTCTGCATCAGCATCCACGACGAGGTTCGCTACCTGGT 3720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3661 GGAATTTGCCATTGATGGGCGCTTCTGCATCAGCATCCACGACGAGGTTCGCTACCTGGT 3720 Query 3721 GCGTGAGGAGGACCGCTACCGTGCCGCCCTGGCACTGCAGATCACCAATCTCCTGACCAG 3780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3721 GCGTGAGGAGGACCGCTACCGTGCCGCCCTGGCACTGCAGATCACCAATCTCCTGACCAG 3780 Query 3781 GTGCATGTTTGCCTATAAGCTGGGTCTGAATGATCTGCCCCAGTCAGTCGCCTTTTTCAG 3840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3781 GTGCATGTTTGCCTATAAGCTGGGTCTGAATGATCTGCCCCAGTCAGTCGCCTTTTTCAG 3840 Query 3841 TGCAGTAGACATTGACCAGTGCCTCAGGAAGGAAGTGACCATGGACTGTAAAACTCCTTC 3900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3841 TGCAGTAGACATTGACCAGTGCCTCAGGAAGGAAGTGACCATGGACTGTAAAACTCCTTC 3900 Query 3901 TAACCCAACTGGGATGGAAAGGAGATATGGGATCCCCCAGGGTGAAGCACTGGATATTTA 3960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3901 TAACCCAACTGGGATGGAAAGGAGATATGGGATCCCCCAGGGTGAAGCACTGGATATTTA 3960 Query 3961 CCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACGAAGCCAGCCTGGACCCTAGCT 4020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3961 CCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACGAAGCCAGCCTGGACCCTAGCT 4020 Query 4021 CTGTCTGGAGGTTCTGTATTTGCTCCTGTGGAGCTTTATTGGAGCGGTGCAGGTTCCTAA 4080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4021 CTGTCTGGAGGTTCTGTATTTGCTCCTGTGGAGCTTTATTGGAGCGGTGCAGGTTCCTAA 4080 Query 4081 ACTCAGGCTTTCAGATGTGCTTTTTTGCAAAAGGCAGCCATTTTTCTGTAGCAGGACCTG 4140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4081 ACTCAGGCTTTCAGATGTGCTTTTTTGCAAAAGGCAGCCATTTTTCTGTAGCAGGACCTG 4140 Query 4141 CCCAGGAAAGTCCTCCTAACGGAAGGCACAATTCAGTGCGTTCAGAACCAGGACACCAAC 4200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4141 CCCAGGAAAGTCCTCCTAACGGAAGGCACAATTCAGTGCGTTCAGAACCAGGACACCAAC 4200 Query 4201 ATCAGTGCAGGCTGTGTGACAAGGGGTACTGTTGGGCACAAATGAAGCAGATGCCCCAAA 4260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4201 ATCAGTGCAGGCTGTGTGACAAGGGGTACTGTTGGGCACAAATGAAGCAGATGCCCCAAA 4260 Query 4261 GGTCACATTAACTCAGGCATTTCTTCCTCCTCTTCTTGGCTGGTTCTCTGTCCTGCTGTG 4320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4261 GGTCACATTAACTCAGGCATTTCTTCCTCCTCTTCTTGGCTGGTTCTCTGTCCTGCTGTG 4320 Query 4321 TATGTGCTGATGCAGTGCCCTAGAAGGGGAGAGTAGAAATTTTGACAACCTTGTTCTAAG 4380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4321 TATGTGCTGATGCAGTGCCCTAGAAGGGGAGAGTAGAAATTTTGACAACCTTGTTCTAAG 4380 Query 4381 GTGATGGGAATAAAAACAAACACCAAACTCCTGGAACAGTTGTGCTTTCCCGTCTGCTGC 4440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4381 GTGATGGGAATAAAAACAAACACCAAACTCCTGGAACAGTTGTGCTTTCCCGTCTGCTGC 4440 Query 4441 CCAGGTTGTGACTTAGAACTCCGTCCTGAGTAGATGGACGAGATGCTGGGAGCCCGGAGC 4500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4441 CCAGGTTGTGACTTAGAACTCCGTCCTGAGTAGATGGACGAGATGCTGGGAGCCCGGAGC 4500 Query 4501 ATCACAGCTACAGACGGCCTGGGGCACAGTGATGTACGGAACTCCGCATCAGCCGGCTAG 4560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4501 ATCACAGCTACAGACGGCCTGGGGCACAGTGATGTACGGAACTCCGCATCAGCCGGCTAG 4560 Query 4561 CCAGATTATTTTATATAAATGTCTAATTTTGACTGG 4596 |||||||||||||||||||||||||||||||||||| Sbjct 4561 CCAGATTATTTTATATAAATGTCTAATTTTGACTGG 4596 >dbj|AK133584.1| UniGene infoGene info Mus musculus adult male pituitary gland cDNA, RIKEN full-length enriched library, clone:5330409N10 product:polymerase (DNA directed), gamma, full insert sequence Length=4523 Score = 8338 bits (4515), Expect = 0.0 Identities = 4519/4521 (99%), Gaps = 0/4521 (0%) Strand=Plus/Plus Query 76 AGACGGGAAGTTGCGGCTGCTCCCGAGACCGCACGCCACCCTGAGGCTGCGTGGGCCGCG 135 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2 AGACGGGAAGTTGCGGCTGCTCCCGAGACCGCACGCCACCCTGAGGCTGCGTGGGCCGCG 61 Query 136 CGCCGCGGACGCCGCGTCGTCGCCGGGGCTGTGGGCTGCCGCAGAACGGGAAGCGCGAAG 195 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 62 CGCCGCGGACGCCGCGTCGTCGCCGGGGCTGTGGGCTGCCGCAGAACGGGAAGCGCGAAG 121 Query 196 CGGACCGAGGACTTGTGTGAGGAAGGCAGGCATGGTGAGACCTATTTCACTGACAGGAGC 255 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 122 CGGACCGAGGACTTGTGTGAGGAAGGCAGGCATGGTGAGACCTATTTCACTGACAGGAGC 181 Query 256 ACAGAGAGGGGACGCGTCTCTCTCTGAGTCTTTCGGCCACTAAAAGCAGTCAAGCTGGAG 315 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 182 ACAGAGAGGGGACGCGTCTCTCTCTGAGTCTTTCGGCCACTAAAAGCAGTCAAGCTGGAG 241 Query 316 CCCAAAGCCCGGTGCCCCGACTCACAGCGGGGGGCTCCCTGCACCAACCATGAGCCGCCT 375 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 242 CCCAAAGCCCGGTGCCCCGACTCACAGCGGGGGGCTCCCTGCACCAACCATGAGCCGCCT 301 Query 376 GCTCTGGAAGAAGGTGGCTGGCGCCAAGGTCGCCTCAGGGCCAGTACCAGCAACCGCGCG 435 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 302 GCTCTGGAAGAAGGTGGCTGGCGCCAAGGTCGCCTCAGGGCCAGTACCAGCAACCGCGCG 361 Query 436 CTGGGTCTCCAGCTCCGTCCTCGACCCCGTCCCCAGCGACGGGCGGCCGCCGTCGCAAAT 495 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 362 CTGGGTCTCCAGCTCCGTCCTCGACCCCGTCCCCAGCGACGGGCGGCCGCCGTCGCAAAT 421 Query 496 GCCCTCCTCCGAGAATGGGCAGCTGCGGCTCAACCCTCTGCTCATCCAGATGTTGTCGAG 555 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 422 GCCCTCCTCCGAGAATGGGCAGCTGCGGCTCAACCCTCTGCTCATCCAGATGTTGTCGAG 481 Query 556 AGGCCTGCACGAGCAGATCTTCGGGTGCGGCGGGGAAATGCCCGACGAGGCCGCGGTGCA 615 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 482 AGGCCTGCACGAGCAGATCTTCGGGTGCGGCGGGGAAATGCCCGACGAGGCCGCGGTGCA 541 Query 616 GCGCAGCGTAGAGCACCTGCAGAAGCACGGGCTCTGGGGGCAGCCGGCCACGCCCTTGCC 675 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 542 GCGCAGCGTAGAGCACCTGCAGAAGCACGGGCTCTGGGGGCAGCCGGCCACGCCCTTGCC 601 Query 676 AGACGTGGAGCTGCGCCTGCCCCGGCTCTTCGGGGGCAACCTGGACCAGCACTTCCGCCT 735 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 602 AGACGTGGAGCTGCGCCTGCCCCGGCTCTTCGGGGGCAACCTGGACCAGCACTTCCGCCT 661 Query 736 CCTGGCCCAGAAGCAGAGCCTGCCTTACTTGGAGGCGGCCGCCTCGTTATTGGAGGCCCA 795 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 662 CCTGGCCCAGAAGCAGAGCCTGCCTTACTTGGAGGCGGCCGCCTCGTTATTGGAGGCCCA 721 Query 796 ATTGCCCCCCGAGCCCAAGAGCTGGGCCTGGGCGGAGGGCTGGACCCGGTACGGCCCCGA 855 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 722 ATTGCCCCCCGAGCCCAAGAGCTGGGCCTGGGCGGAGGGCTGGACCCGGTACGGCCCCGA 781 Query 856 GGGGGAGGCCGAACCCGTGGCCATCCCCGAGGAGCGGGCCCTGGTGTTCGACGTGGAGGT 915 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 782 GGGGGAGGCCGAACCCGTGGCCATCCCCGAGGAGCGGGCCCTGGTGTTCGACGTGGAGGT 841 Query 916 CTGCTTGGCAGAGGGAACCTGCCCCACTTTGGCGGTGGCCATATCCCCCTCGGCCTGGTA 975 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 842 CTGCTTGGCAGAGGGAACCTGCCCCACTTTGGCGGTGGCCATATCCCCCTCGGCCTGGTA 901 Query 976 TTCCTGGTGCAGCCGGCGGCTGGTGGAAGAGCGTTACTCTTGGACCAGCCAGCTATCGCC 1035 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 902 TTCCTGGTGCAGCCGGCGGCTGGTGGAAGAGCGTTACTCTTGGACCAGCCAGCTATCGCC 961 Query 1036 GGCTGACCTAATCCCTTTGGGGGGCTCCACTAGTGCCAGCAGCTCCACCAAGCAGGATGG 1095 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 962 GGCTGACCTAATCCCTTTGGGGGGCTCCACTAGTGCCAGCAGCTCCACCAAGCAGGATGG 1021 Query 1096 GCAGGAACAGTTAGTGGTGGGGCACAATGTTTCCTTTGACCGAGCCCATATCAGGGAACA 1155 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1022 GCAGGAACAGTTAGTGGTGGGGCACAATGTTTCCTTTGACCGAGCCCATATCAGGGAACA 1081 Query 1156 GTATCTGATTCAGGACTCCCGGATGCGTTTTCTCGATACTATGAGCATGCACATGGCCAT 1215 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1082 GTATCTGATTCAGGACTCCCGGATGCGTTTTCTCGATACTATGAGCATGCACATGGCCAT 1141 Query 1216 CTCGGGGCTGAGCAGCTTCCAGCGCAGCCTGTGGATGGGAGCCAAGCAGGGAAAGCACAA 1275 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1142 CTCGGGGCTGAGCAGCTTCCAGCGCAGCCTGTGGATGGGAGCCAAGCAGGGAAAGCACAA 1201 Query 1276 GACCCAGCAGTCCACAAAGCGAGGGCAGAAGTCCCCGAGGAAAGCCAATGGTCCAGCGAT 1335 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1202 GACCCAGCAGTCCACAAAGCGAGGGCAGAAGTCCCCGAGGAAAGCCAATGGTCCAGCGAT 1261 Query 1336 CTCATCTTGGGACTGGATGGATATCAGCAGTGCCAATAATCTTGCAGATGTGCACAACCT 1395 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1262 CTCATCTTGGGACTGGATGGATATCAGCAGTGCCAATAATCTTGCAGATGTGCACAACCT 1321 Query 1396 TTATGTGGGGGGACCTCCCTTAGAGAAGGAGCCTCGGGAGCTGTTCGTCAAAGGCAGCAT 1455 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1322 TTATGTGGGGGGACCTCCCTTAGAGAAGGAGCCTCGGGAGCTGTTCGTCAAAGGCAGCAT 1381 Query 1456 GAGGGATATCCGAGAGAACTTCCAGGATCTGATGCAGTACTGCGCCCGTGATGTGTGGGC 1515 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1382 GAGGGATATCCGAGAGAACTTCCAGGATCTGATGCAGTACTGCGCCCGTGATGTGTGGGC 1441 Query 1516 CACCTTTGAGGTTTTCCAGCAGCAGCTGCCACTCTTCTTGGAGAGGTGTCCCCACCCAGT 1575 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1442 CACCTTTGAGGTTTTCCAGCAGCAGCTGCCACTCTTCTTGGAGAGGTGTCCCCACCCAGT 1501 Query 1576 GACTCTGGCTGGCATGCTGGAGATGGGTGTGTCCTACCTGCCTGTCAACCAGAACTGGGA 1635 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1502 GACTCTGGCTGGCATGCTGGAGATGGGTGTGTCCTACCTGCCTGTCAACCAGAACTGGGA 1561 Query 1636 GCGTTACCTGACAGAGGCACAGAACACATATGAGGAGCTCCAGCGGGAGATGAAGAAGTC 1695 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1562 GCGTTACCTGACAGAGGCACAGAACACATATGAGGAGCTCCAGCGGGAGATGAAGAAGTC 1621 Query 1696 GCTGATGGATCTGGCTAATGATGCCTGTCAGTTGCTCTCAGGAGAGAGGTACAAAGAAGA 1755 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1622 GCTGATGGATCTGGCTAATGATGCCTGTCAGTTGCTCTCAGGAGAGAGGTACAAAGAAGA 1681 Query 1756 CCCTTGGCTCTGGGACCTAGAATGGGATTTGCAGGAGTTTAAGCAGAAAAAGGCAAAGAA 1815 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1682 CCCTTGGCTCTGGGACCTAGAATGGGATTTGCAGGAGTTTAAGCAGAAAAAGGCAAAGAA 1741 Query 1816 GGTGAAGAAGCCAGCCTCAGCCAGCAAGTTGCCCATCGAGGGAGCTGGGCCCTTTGGGGA 1875 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1742 GGTGAAGAAGCCAGCCTCAGCCAGCAAGTTGCCCATCGAGGGAGCTGGGCCCTTTGGGGA 1801 Query 1876 TCCCATGGATCAGGAAGATCCTGGCCCGCCCAGCGAGGAGGAGGAGCTTCAGCGAAGTGT 1935 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1802 TCCCATGGATCAGGAAGATCCTGGCCCGCCCAGCGAGGAGGAGGAGCTTCAGCGAAGTGT 1861 Query 1936 AACAGCCCACAACCGGTTACAGCAGCTGAGGAGCACCACGGACCTCCTGCCTAAGCGACC 1995 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1862 AACAGCCCACAACCGGTTACAGCAGCTGAGGAGCACCACGGACCTCCTGCCTAAGCGACC 1921 Query 1996 CCAGCACCTTCCAGGACACCCTGGGTGGTACCGGAAGCTCTGCCCTCGACTAGATGACCC 2055 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1922 CCAGCACCTTCCAGGACACCCTGGGTGGTACCGGAAGCTCTGCCCTCGACTAGATGACCC 1981 Query 2056 TGCCTGGGCTCCCGGCCCCAGCCTCCTCAGCCTGCAAATGCGGGTCACTCCTAAGCTCAT 2115 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1982 TGCCTGGGCTCCCGGCCCCAGCCTCCTCAGCCTGCAAATGCGGGTCACTCCTAAGCTCAT 2041 Query 2116 GGCACTGACCTGGGATGGTTTTCCTCTACACTACTCAGACTCTCATGGTTGGGGCTACCT 2175 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2042 GGCACTGACCTGGGATGGTTTTCCTCTACACTACTCAGACTCTCATGGTTGGGGCTACCT 2101 Query 2176 AGTGCCTGGGCGTCGGGATAATCTGACCGAGCCGCCAGTGAGCCCCACTGTAGAATCCGC 2235 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2102 AGTGCCTGGGCGTCGGGATAATCTGACCGAGCCGCCAGTGAGCCCCACTGTAGAATCCGC 2161 Query 2236 TGCAGTAACCTGCCCCTACAGAGCCATCGAGTCCTTATACAGGAAGCACTGCCTTGAACA 2295 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2162 TGCAGTAACCTGCCCCTACAGAGCCATCGAGTCCTTATACAGGAAGCACTGCCTTGAACA 2221 Query 2296 GGGGAAGCAGCAATTGGAGCCCCAGGAGGTAGACCTGGCTGAGGAGTTCTTACTCACTGA 2355 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2222 GGGGAAGCAGCAATTGGAGCCCCAGGAGGTAGACCTGGCTGAGGAGTTCTTACTCACTGA 2281 Query 2356 CAGTAGTGCCATGTGGCAAACGGTAGAAGAACTGGGCTGCTTAGACGTAGAGGCTGAGGC 2415 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2282 CAGTAGTGCCATGTGGCAAACGGTAGAAGAACTGGGCTGCTTAGACGTAGAGGCTGAGGC 2341 Query 2416 CAAGATGGAGAATTCAGGGCTGAGCCAACCTCTAGTTCTGCCTGCTGCTTGTGCCCCCAA 2475 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2342 CAAGATGGAGAATTCAGGGCTGAGCCAACCTCTAGTTCTGCCTGCTGCTTGTGCCCCCAA 2401 Query 2476 ATCCAGCCAGCCCACGTATCACCATGGCAACGGACCTTATAATGATGTGAATATCCCTGG 2535 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2402 ATCCAGCCAGCCCACGTATCACCATGGCAACGGACCTTATAATGATGTGAATATCCCTGG 2461 Query 2536 TTGCTGGTTTTTCAAGCTGCCTCACAAGGACGGTAACAACTACAATGTGGGCAGTCCCTT 2595 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2462 TTGCTGGTTTTTCAAGCTGCCTCACAAGGACGGTAACAACTACAATGTGGGCAGTCCCTT 2521 Query 2596 TGCCAAAGATTTCCTGCCCAAGATGGAGGATGGCACCCTGCAGGCTGGCCCAGGAGGTGC 2655 ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2522 TGCAAAAGATTTCCTGCCCAAGATGGAGGATGGCACCCTGCAGGCTGGCCCAGGAGGTGC 2581 Query 2656 CAGTGGGCCTCGTGCCCTGGAAATAAATAAAATGATTTCTTTTTGGAGGAATGCTCATAA 2715 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2582 CAGTGGGCCTCGTGCCCTGGAAATAAATAAAATGATTTCTTTTTGGAGGAATGCTCATAA 2641 Query 2716 ACGTATCAGTTCCCAGATGGTGGTATGGCTCCCCAGGTCAGCTCTGCCCCGGGTTGTGAC 2775 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2642 ACGTATCAGTTCCCAGATGGTGGTATGGCTCCCCAGGTCAGCTCTGCCCCGGGTTGTGAC 2701 Query 2776 CAGGCACCCCAGCTTCGATGAGGAAGGCCACTATGGGGCCATCCTACCCCAGGTGGTGAC 2835 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2702 CAGGCACCCCAGCTTCGATGAGGAAGGCCACTATGGGGCCATCCTACCCCAGGTGGTGAC 2761 Query 2836 TGCTGGCACCATCACCCGTCGAGCTGTGGAGCCCACGTGGCTCACTGCCAGTAATGCTCG 2895 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2762 TGCTGGCACCATCACCCGTCGAGCTGTGGAGCCCACGTGGCTCACTGCCAGTAATGCTCG 2821 Query 2896 GCCTGACCGGGTAGGCAGTGAGTTGAAAGCCATGGTGCAGGCTCCACCTGGCTATGTCCT 2955 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2822 GCCTGACCGGGTAGGCAGTGAGTTGAAAGCCATGGTGCAGGCTCCACCTGGCTATGTCCT 2881 Query 2956 TGTGGGTGCTGATGTGGACTCACAGGAACTGTGGATCGCAGCTGTACTTGGAGATGCTCA 3015 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2882 TGTGGGTGCTGATGTGGACTCACAGGAACTGTGGATCGCAGCTGTACTTGGAGATGCTCA 2941 Query 3016 CTTTGCTGGGATGCATGGCTGCACGGCCTTTGGCTGGATGACTCTGCAGGGCAGGAAGAG 3075 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2942 CTTTGCTGGGATGCATGGCTGCACGGCCTTTGGCTGGATGACTCTGCAGGGCAGGAAGAG 3001 Query 3076 CAGAGGCACTGATCTGCACAGCAAGACAGCTGCCACTGTGGGCATCAGCCGAGAGCATGC 3135 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3002 CAGAGGCACTGATCTGCACAGCAAGACAGCTGCCACTGTGGGCATCAGCCGAGAGCATGC 3061 Query 3136 CAAAATCTTCAACTATGGCCGCATCTATGGGGCTGGGCAGTCCTTTGCTGAGCGCCTACT 3195 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3062 CAAAATCTTCAACTATGGCCGCATCTATGGGGCTGGGCAGTCCTTTGCTGAGCGCCTACT 3121 Query 3196 GATGCAGTTCAACCACAGGCTCACAAGGCAGGAGGCAGCTGAGAAGGCCCAGCAGATGTA 3255 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3122 GATGCAGTTCAACCACAGGCTCACAAGGCAGGAGGCAGCTGAGAAGGCCCAGCAGATGTA 3181 Query 3256 TGCAGTCACAAAAGGCCTGCGCCGGTATCGGCTGTCTGCGGATGGTGAGTGGCTGGTGAA 3315 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3182 TGCAGTCACAAAAGGCCTGCGCCGGTATCGGCTGTCTGCGGATGGTGAGTGGCTGGTGAA 3241 Query 3316 ACAGTTGAATCTTCCTGTGGACAGGACAGAGGACGGCTGGGTCTCCCTACAAGATCTTCG 3375 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3242 ACAGTTGAATCTTCCTGTGGACAGGACAGAGGACGGCTGGGTCTCCCTACAAGATCTTCG 3301 Query 3376 AATGATCCGAAGAGAAGCTTCAAGGAAGTCACGATGGAAGAAGTGGGAGGTAGCCTCTGA 3435 |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3302 AATGATCCAAAGAGAAGCTTCAAGGAAGTCACGATGGAAGAAGTGGGAGGTAGCCTCTGA 3361 Query 3436 ACGAGCATGGACAGGGGGCACAGAGTCAGAAATGTTTAATAAGCTGGAGAGTATTGCCAT 3495 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3362 ACGAGCATGGACAGGGGGCACAGAGTCAGAAATGTTTAATAAGCTGGAGAGTATTGCCAT 3421 Query 3496 GTCTGATACACCACGTACCCCAGTACTGGGCTGCTGCATCAGCAGAGCCTTGGAGCCCTC 3555 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3422 GTCTGATACACCACGTACCCCAGTACTGGGCTGCTGCATCAGCAGAGCCTTGGAGCCCTC 3481 Query 3556 AGTTGTCCAGGGAGAGTTTATAACCAGTCGTGTGAACTGGGTGGTACAGAGCTCTGCTGT 3615 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3482 AGTTGTCCAGGGAGAGTTTATAACCAGTCGTGTGAACTGGGTGGTACAGAGCTCTGCTGT 3541 Query 3616 AGACTACTTACATCTCATGCTTGTGGCCATGAAGTGGCTGTTTGAGGAATTTGCCATTGA 3675 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3542 AGACTACTTACATCTCATGCTTGTGGCCATGAAGTGGCTGTTTGAGGAATTTGCCATTGA 3601 Query 3676 TGGGCGCTTCTGCATCAGCATCCACGACGAGGTTCGCTACCTGGTGCGTGAGGAGGACCG 3735 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3602 TGGGCGCTTCTGCATCAGCATCCACGACGAGGTTCGCTACCTGGTGCGTGAGGAGGACCG 3661 Query 3736 CTACCGTGCCGCCCTGGCACTGCAGATCACCAATCTCCTGACCAGGTGCATGTTTGCCTA 3795 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3662 CTACCGTGCCGCCCTGGCACTGCAGATCACCAATCTCCTGACCAGGTGCATGTTTGCCTA 3721 Query 3796 TAAGCTGGGTCTGAATGATCTGCCCCAGTCAGTCGCCTTTTTCAGTGCAGTAGACATTGA 3855 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3722 TAAGCTGGGTCTGAATGATCTGCCCCAGTCAGTCGCCTTTTTCAGTGCAGTAGACATTGA 3781 Query 3856 CCAGTGCCTCAGGAAGGAAGTGACCATGGACTGTAAAACTCCTTCTAACCCAACTGGGAT 3915 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3782 CCAGTGCCTCAGGAAGGAAGTGACCATGGACTGTAAAACTCCTTCTAACCCAACTGGGAT 3841 Query 3916 GGAAAGGAGATATGGGATCCCCCAGGGTGAAGCACTGGATATTTACCAGATAATTGAACT 3975 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3842 GGAAAGGAGATATGGGATCCCCCAGGGTGAAGCACTGGATATTTACCAGATAATTGAACT 3901 Query 3976 CACCAAAGGCTCCTTGGAAAAACGAAGCCAGCCTGGACCCTAGCTCTGTCTGGAGGTTCT 4035 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3902 CACCAAAGGCTCCTTGGAAAAACGAAGCCAGCCTGGACCCTAGCTCTGTCTGGAGGTTCT 3961 Query 4036 GTATTTGCTCCTGTGGAGCTTTATTGGAGCGGTGCAGGTTCCTAAACTCAGGCTTTCAGA 4095 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3962 GTATTTGCTCCTGTGGAGCTTTATTGGAGCGGTGCAGGTTCCTAAACTCAGGCTTTCAGA 4021 Query 4096 TGTGCTTTTTTGCAAAAGGCAGCCATTTTTCTGTAGCAGGACCTGCCCAGGAAAGTCCTC 4155 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4022 TGTGCTTTTTTGCAAAAGGCAGCCATTTTTCTGTAGCAGGACCTGCCCAGGAAAGTCCTC 4081 Query 4156 CTAACGGAAGGCACAATTCAGTGCGTTCAGAACCAGGACACCAACATCAGTGCAGGCTGT 4215 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4082 CTAACGGAAGGCACAATTCAGTGCGTTCAGAACCAGGACACCAACATCAGTGCAGGCTGT 4141 Query 4216 GTGACAAGGGGTACTGTTGGGCACAAATGAAGCAGATGCCCCAAAGGTCACATTAACTCA 4275 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4142 GTGACAAGGGGTACTGTTGGGCACAAATGAAGCAGATGCCCCAAAGGTCACATTAACTCA 4201 Query 4276 GGCATTTCTTCCTCCTCTTCTTGGCTGGTTCTCTGTCCTGCTGTGTATGTGCTGATGCAG 4335 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4202 GGCATTTCTTCCTCCTCTTCTTGGCTGGTTCTCTGTCCTGCTGTGTATGTGCTGATGCAG 4261 Query 4336 TGCCCTAGAAGGGGAGAGTAGAAATTTTGACAACCTTGTTCTAAGGTGATGGGAATAAAA 4395 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4262 TGCCCTAGAAGGGGAGAGTAGAAATTTTGACAACCTTGTTCTAAGGTGATGGGAATAAAA 4321 Query 4396 ACAAACACCAAACTCCTGGAACAGTTGTGCTTTCCCGTCTGCTGCCCAGGTTGTGACTTA 4455 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4322 ACAAACACCAAACTCCTGGAACAGTTGTGCTTTCCCGTCTGCTGCCCAGGTTGTGACTTA 4381 Query 4456 GAACTCCGTCCTGAGTAGATGGACGAGATGCTGGGAGCCCGGAGCATCACAGCTACAGAC 4515 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4382 GAACTCCGTCCTGAGTAGATGGACGAGATGCTGGGAGCCCGGAGCATCACAGCTACAGAC 4441 Query 4516 GGCCTGGGGCACAGTGATGTACGGAACTCCGCATCAGCCGGCTAGCCAGATTATTTTATA 4575 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4442 GGCCTGGGGCACAGTGATGTACGGAACTCCGCATCAGCCGGCTAGCCAGATTATTTTATA 4501 Query 4576 TAAATGTCTAATTTTGACTGG 4596 ||||||||||||||||||||| Sbjct 4502 TAAATGTCTAATTTTGACTGG 4522 >gb|BC053024.1| UniGene infoGeoGene info Mus musculus cDNA clone IMAGE:5721109, containing frame-shift errors Length=4536 Score = 8329 bits (4510), Expect = 0.0 Identities = 4517/4520 (99%), Gaps = 2/4520 (0%) Strand=Plus/Plus Query 73 CGCAGACGGGAAGTTGCGGCTGCTCCCGAGACCGCACGCCACCCTGAGGCTGCGTGGGCC 132 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1 CGCAGACGGGAAGTTGCGGCTGCTCCCGAGACCGCACGCCACCCTGAGGCTGCGTGGGCC 60 Query 133 GCGCGCCGCGGACGCCGCGTCGTCGCCGGGGCTGTGGGCTGCCGCAGAACGGGAAGCGCG 192 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 61 GCGCGCCGCGGACGCCGCGTCGTCGCCGGGGCTGTGGGCTGCCGCAGAACGGGAAGCGCG 120 Query 193 AAGCGGACCGAGGACTTGTGTGAGGAAGGCAGGCATGGTGAGACCTATTTCACTGACAGG 252 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 121 AAGCGGACCGAGGACTTGTGTGAGGAAGGCAGGCATGGTGAGACCTATTTCACTGACAGG 180 Query 253 AGCACAGAGAGGGGACGCGTCTCTCTCTGAGTCTTTCGGCCACTAAAAGCAGTCAAGCTG 312 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 181 AGCACAGAGAGGGGACGCGTCTCTCTCTGAGTCTTTCGGCCACTAAAAGCAGTCAAGCTG 240 Query 313 GAGCCCAAAGCCCGGTGCCCCGACTCACAGCGGGGGGCTCCCTGCACCAACCATGAGCCG 372 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 241 GAGCCCAAAGCCCGGTGCCCCGACTCACAGCGGGGGGCTCCCTGCACCAACCATGAGCCG 300 Query 373 CCTGCTCTGGAAGAAGGTGGCTGGCGCCAAGGTCGCCTCAGGGCCAGTACCAGCAACCGC 432 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 301 CCTGCTCTGGAAGAAGGTGGCTGGCGCCAAGGTCGCCTCAGGGCCAGTACCAGCAACCGC 360 Query 433 GCGCTGGGTCTCCAGCTCCGTCCTCGACCCCGTCCCCAGCGACGGGCGGCCGCCGTCGCA 492 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 361 GCGCTGGGTCTCCAGCTCCGTCCTCGACCCCGTCCCCAGCGACGGGCGGCCGCCGTCGCA 420 Query 493 AATGCCCTCCTCCGAGAATGGGCAGCTGCGGCTCAACCCTCTGCTCATCCAGATGTTGTC 552 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 421 AATGCCCTCCTCCGAGAATGGGCAGCTGCGGCTCAACCCTCTGCTCATCCAGATGTTGTC 480 Query 553 GAGAGGCCTGCACGAGCAGATCTTCGGGTGCGGCGGGGAAATGCCCGACGAGGCCGCGGT 612 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 481 GAGAGGCCTGCACGAGCAGATCTTCGGGTGCGGCGGGGAAATGCCCGACGAGGCCGCGGT 540 Query 613 GCAGCGCAGCGTAGAGCACCTGCAGAAGCACGGGCTCTGGGGGCAGCCGGCCACGCCCTT 672 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 541 GCAGCGCAGCGTAGAGCACCTGCAGAAGCACGGGCTCTGGGGGCAGCCGGCCACGCCCTT 600 Query 673 GCCAGACGTGGAGCTGCGCCTGCCCCGGCTCTTCGGGGGCAACCTGGACCAGCACTTCCG 732 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 601 GCCAGACGTGGAGCTGCGCCTGCCCCGGCTCTTCGGGGGCAACCTGGACCAGCACTTCCG 660 Query 733 CCTCCTGGCCCAGAAGCAGAGCCTGCCTTACTTGGAGGCGGCCGCCTCGTTATTGGAGGC 792 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 661 CCTCCTGGCCCAGAAGCAGAGCCTGCCTTACTTGGAGGCGGCCGCCTCGTTATTGGAGGC 720 Query 793 CCAATTGCCCCCCGAGCCCAAGAGCTGGGCCTGGGCGGAGGGCTGGACCCGGTACGGCCC 852 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 721 CCAATTGCCCCCCGAGCCCAAGAGCTGGGCCTGGGCGGAGGGCTGGACCCGGTACGGCCC 780 Query 853 CGAGGGGGAGGCCGAACCCGTGGCCATCCCCGAGGAGCGGGCCCTGGTGTTCGACGTGGA 912 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 781 CGAGGGGGAGGCCGAACCCGTGGCCATCCCCGAGGAGCGGGCCCTGGTGTTCGACGTGGA 840 Query 913 GGTCTGCTTGGCAGAGGGAACCTGCCCCACTTTGGCGGTGGCCATATCCCCCTCGGCCTG 972 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 841 GGTCTGCTTGGCAGAGGGAACCTGCCCCACTTTGGCGGTGGCCATATCCCCCTCGGCCTG 900 Query 973 GTATTCCTGGTGCAGCCGGCGGCTGGTGGAAGAGCGTTACTCTTGGACCAGCCAGCTATC 1032 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 901 GTATTCCTGGTGCAGCCGGCGGCTGGTGGAAGAGCGTTACTCTTGGACCAGCCAGCTATC 960 Query 1033 GCCGGCTGACCTAATCCCTTTGGGGGGCTCCACTAGTGCCAGCAGCTCCACCAAGCAGGA 1092 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 961 GCCGGCTGACCTAATCCCTTTGGGGGGCTCCACTAGTGCCAGCAGCTCCACCAAGCAGGA 1020 Query 1093 TGGGCAGGAACAGTTAGTGGTGGGGCACAATGTTTCCTTTGACCGAGCCCATATCAGGGA 1152 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1021 TGGGCAGGAACAGTTAGTGGTGGGGCACAATGTTTCCTTTGACCGAGCCCATATCAGGGA 1080 Query 1153 ACAGTATCTGATTCAGGACTCCCGGATGCGTTTTCTCGATACTATGAGCATGCACATGGC 1212 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1081 ACAGTATCTGATTCAGGACTCCCGGATGCGTTTTCTCGATACTATGAGCATGCACATGGC 1140 Query 1213 CATCTCGGGGCTGAGCAGCTTCCAGCGCAGCCTGTGGATGGGAGCCAAGCAGGGAAAGCA 1272 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1141 CATCTCGGGGCTGAGCAGCTTCCAGCGCAGCCTGTGGATGGGAGCCAAGCAGGGAAAGCA 1200 Query 1273 CAAGACCCAGCAGTCCACAAAGCGAGGGCAGAAGTCCCCGAGGAAAGCCAATGGTCCAGC 1332 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1201 CAAGACCCAGCAGTCCACAAAGCGAGGGCAGAAGTCCCCGAGGAAAGCCAATGGTCCAGC 1260 Query 1333 GATCTCATCTTGGGACTGGATGGATATCAGCAGTGCCAATAATCTTGCAGATGTGCACAA 1392 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1261 GATCTCATCTTGGGACTGGATGGATATCAGCAGTGCCAATAATCTTGCAGATGTGCACAA 1320 Query 1393 CCTTTATGTGGGGGGACCTCCCTTAGAGAAGGAGCCTCGGGAGCTGTTCGTCAAAGGCAG 1452 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1321 CCTTTATGTGGGGGGACCTCCCTTAGAGAAGGAGCCTCGGGAGCTGTTCGTCAAAGGCAG 1380 Query 1453 CATGAGGGATATCCGAGAGAACTTCCAGGATCTGATGCAGTACTGCGCCCGTGATGTGTG 1512 ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1381 CATGA--GATATCCGAGAGAACTTCCAGGATCTGATGCAGTACTGCGCCCGTGATGTGTG 1438 Query 1513 GGCCACCTTTGAGGTTTTCCAGCAGCAGCTGCCACTCTTCTTGGAGAGGTGTCCCCACCC 1572 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1439 GGCCACCTTTGAGGTTTTCCAGCAGCAGCTGCCACTCTTCTTGGAGAGGTGTCCCCACCC 1498 Query 1573 AGTGACTCTGGCTGGCATGCTGGAGATGGGTGTGTCCTACCTGCCTGTCAACCAGAACTG 1632 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1499 AGTGACTCTGGCTGGCATGCTGGAGATGGGTGTGTCCTACCTGCCTGTCAACCAGAACTG 1558 Query 1633 GGAGCGTTACCTGACAGAGGCACAGAACACATATGAGGAGCTCCAGCGGGAGATGAAGAA 1692 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1559 GGAGCGTTACCTGACAGAGGCACAGAACACATATGAGGAGCTCCAGCGGGAGATGAAGAA 1618 Query 1693 GTCGCTGATGGATCTGGCTAATGATGCCTGTCAGTTGCTCTCAGGAGAGAGGTACAAAGA 1752 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1619 GTCGCTGATGGATCTGGCTAATGATGCCTGTCAGTTGCTCTCAGGAGAGAGGTACAAAGA 1678 Query 1753 AGACCCTTGGCTCTGGGACCTAGAATGGGATTTGCAGGAGTTTAAGCAGAAAAAGGCAAA 1812 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1679 AGACCCTTGGCTCTGGGACCTAGAATGGGATTTGCAGGAGTTTAAGCAGAAAAAGGCAAA 1738 Query 1813 GAAGGTGAAGAAGCCAGCCTCAGCCAGCAAGTTGCCCATCGAGGGAGCTGGGCCCTTTGG 1872 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1739 GAAGGTGAAGAAGCCAGCCTCAGCCAGCAAGTTGCCCATCGAGGGAGCTGGGCCCTTTGG 1798 Query 1873 GGATCCCATGGATCAGGAAGATCCTGGCCCGCCCAGCGAGGAGGAGGAGCTTCAGCGAAG 1932 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1799 GGATCCCATGGATCAGGAAGATCCTGGCCCGCCCAGCGAGGAGGAGGAGCTTCAGCGAAG 1858 Query 1933 TGTAACAGCCCACAACCGGTTACAGCAGCTGAGGAGCACCACGGACCTCCTGCCTAAGCG 1992 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1859 TGTAACAGCCCACAACCGGTTACAGCAGCTGAGGAGCACCACGGACCTCCTGCCTAAGCG 1918 Query 1993 ACCCCAGCACCTTCCAGGACACCCTGGGTGGTACCGGAAGCTCTGCCCTCGACTAGATGA 2052 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1919 ACCCCAGCACCTTCCAGGACACCCTGGGTGGTACCGGAAGCTCTGCCCTCGACTAGATGA 1978 Query 2053 CCCTGCCTGGGCTCCCGGCCCCAGCCTCCTCAGCCTGCAAATGCGGGTCACTCCTAAGCT 2112 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1979 CCCTGCCTGGGCTCCCGGCCCCAGCCTCCTCAGCCTGCAAATGCGGGTCACTCCTAAGCT 2038 Query 2113 CATGGCACTGACCTGGGATGGTTTTCCTCTACACTACTCAGACTCTCATGGTTGGGGCTA 2172 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2039 CATGGCACTGACCTGGGATGGTTTTCCTCTACACTACTCAGACTCTCATGGTTGGGGCTA 2098 Query 2173 CCTAGTGCCTGGGCGTCGGGATAATCTGACCGAGCCGCCAGTGAGCCCCACTGTAGAATC 2232 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2099 CCTAGTGCCTGGGCGTCGGGATAATCTGACCGAGCCGCCAGTGAGCCCCACTGTAGAATC 2158 Query 2233 CGCTGCAGTAACCTGCCCCTACAGAGCCATCGAGTCCTTATACAGGAAGCACTGCCTTGA 2292 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2159 CGCTGCAGTAACCTGCCCCTACAGAGCCATCGAGTCCTTATACAGGAAGCACTGCCTTGA 2218 Query 2293 ACAGGGGAAGCAGCAATTGGAGCCCCAGGAGGTAGACCTGGCTGAGGAGTTCTTACTCAC 2352 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2219 ACAGGGGAAGCAGCAATTGGAGCCCCAGGAGGTAGACCTGGCTGAGGAGTTCTTACTCAC 2278 Query 2353 TGACAGTAGTGCCATGTGGCAAACGGTAGAAGAACTGGGCTGCTTAGACGTAGAGGCTGA 2412 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2279 TGACAGTAGTGCCATGTGGCAAACGGTAGAAGAACTGGGCTGCTTAGACGTAGAGGCTGA 2338 Query 2413 GGCCAAGATGGAGAATTCAGGGCTGAGCCAACCTCTAGTTCTGCCTGCTGCTTGTGCCCC 2472 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2339 GGCCAAGATGGAGAATTCAGGGCTGAGCCAACCTCTAGTTCTGCCTGCTGCTTGTGCCCC 2398 Query 2473 CAAATCCAGCCAGCCCACGTATCACCATGGCAACGGACCTTATAATGATGTGAATATCCC 2532 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2399 CAAATCCAGCCAGCCCACGTATCACCATGGCAACGGACCTTATAATGATGTGAATATCCC 2458 Query 2533 TGGTTGCTGGTTTTTCAAGCTGCCTCACAAGGACGGTAACAACTACAATGTGGGCAGTCC 2592 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2459 TGGTTGCTGGTTTTTCAAGCTGCCTCACAAGGACGGTAACAACTACAATGTGGGCAGTCC 2518 Query 2593 CTTTGCCAAAGATTTCCTGCCCAAGATGGAGGATGGCACCCTGCAGGCTGGCCCAGGAGG 2652 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2519 CTTTGCCAAAGATTTCCTGCCCAAGATGGAGGATGGCACCCTGCAGGCTGGCCCAGGAGG 2578 Query 2653 TGCCAGTGGGCCTCGTGCCCTGGAAATAAATAAAATGATTTCTTTTTGGAGGAATGCTCA 2712 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2579 TGCCAGTGGGCCTCGTGCCCTGGAAATAAATAAAATGATTTCTTTTTGGAGGAATGCTCA 2638 Query 2713 TAAACGTATCAGTTCCCAGATGGTGGTATGGCTCCCCAGGTCAGCTCTGCCCCGGGTTGT 2772 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2639 TAAACGTATCAGTTCCCAGATGGTGGTATGGCTCCCCAGGTCAGCTCTGCCCCGGGTTGT 2698 Query 2773 GACCAGGCACCCCAGCTTCGATGAGGAAGGCCACTATGGGGCCATCCTACCCCAGGTGGT 2832 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2699 GACCAGGCACCCCAGCTTCGATGAGGAAGGCCACTATGGGGCCATCCTACCCCAGGTGGT 2758 Query 2833 GACTGCTGGCACCATCACCCGTCGAGCTGTGGAGCCCACGTGGCTCACTGCCAGTAATGC 2892 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2759 GACTGCTGGCACCATCACCCGTCGAGCTGTGGAGCCCACGTGGCTCACTGCCAGTAATGC 2818 Query 2893 TCGGCCTGACCGGGTAGGCAGTGAGTTGAAAGCCATGGTGCAGGCTCCACCTGGCTATGT 2952 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2819 TCGGCCTGACCGGGTAGGCAGTGAGTTGAAAGCCATGGTGCAGGCTCCACCTGGCTATGT 2878 Query 2953 CCTTGTGGGTGCTGATGTGGACTCACAGGAACTGTGGATCGCAGCTGTACTTGGAGATGC 3012 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2879 CCTTGTGGGTGCTGATGTGGACTCACAGGAACTGTGGATCGCAGCTGTACTTGGAGATGC 2938 Query 3013 TCACTTTGCTGGGATGCATGGCTGCACGGCCTTTGGCTGGATGACTCTGCAGGGCAGGAA 3072 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2939 TCACTTTGCTGGGATGCATGGCTGCACGGCCTTTGGCTGGATGACTCTGCAGGGCAGGAA 2998 Query 3073 GAGCAGAGGCACTGATCTGCACAGCAAGACAGCTGCCACTGTGGGCATCAGCCGAGAGCA 3132 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2999 GAGCAGAGGCACTGATCTGCACAGCAAGACAGCTGCCACTGTGGGCATCAGCCGAGAGCA 3058 Query 3133 TGCCAAAATCTTCAACTATGGCCGCATCTATGGGGCTGGGCAGTCCTTTGCTGAGCGCCT 3192 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3059 TGCCAAAATCTTCAACTATGGCCGCATCTATGGGGCTGGGCAGTCCTTTGCTGAGCGCCT 3118 Query 3193 ACTGATGCAGTTCAACCACAGGCTCACAAGGCAGGAGGCAGCTGAGAAGGCCCAGCAGAT 3252 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3119 ACTGATGCAGTTCAACCACAGGCTCACAAGGCAGGAGGCAGCTGAGAAGGCCCAGCAGAT 3178 Query 3253 GTATGCAGTCACAAAAGGCCTGCGCCGGTATCGGCTGTCTGCGGATGGTGAGTGGCTGGT 3312 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3179 GTATGCAGTCACAAAAGGCCTGCGCCGGTATCGGCTGTCTGCGGATGGTGAGTGGCTGGT 3238 Query 3313 GAAACAGTTGAATCTTCCTGTGGACAGGACAGAGGACGGCTGGGTCTCCCTACAAGATCT 3372 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3239 GAAACAGTTGAATCTTCCTGTGGACAGGACAGAGGACGGCTGGGTCTCCCTACAAGATCT 3298 Query 3373 TCGAATGATCCGAAGAGAAGCTTCAAGGAAGTCACGATGGAAGAAGTGGGAGGTAGCCTC 3432 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3299 TCGAATGATCCGAAGAGAAGCTTCAAGGAAGTCACGATGGAAGAAGTGGGAGGTAGCCTC 3358 Query 3433 TGAACGAGCATGGACAGGGGGCACAGAGTCAGAAATGTTTAATAAGCTGGAGAGTATTGC 3492 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3359 TGAACGAGCATGGACAGGGGGCACAGAGTCAGAAATGTTTAATAAGCTGGAGAGTATTGC 3418 Query 3493 CATGTCTGATACACCACGTACCCCAGTACTGGGCTGCTGCATCAGCAGAGCCTTGGAGCC 3552 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3419 CATGTCTGATACACCACGTACCCCAGTACTGGGCTGCTGCATCAGCAGAGCCTTGGAGCC 3478 Query 3553 CTCAGTTGTCCAGGGAGAGTTTATAACCAGTCGTGTGAACTGGGTGGTACAGAGCTCTGC 3612 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3479 CTCAGTTGTCCAGGGAGAGTTTATAACCAGTCGTGTGAACTGGGTGGTACAGAGCTCTGC 3538 Query 3613 TGTAGACTACTTACATCTCATGCTTGTGGCCATGAAGTGGCTGTTTGAGGAATTTGCCAT 3672 ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| Sbjct 3539 TGTAGACTACTTACATCTCATGCTTGTGGTCATGAAGTGGCTGTTTGAGGAATTTGCCAT 3598 Query 3673 TGATGGGCGCTTCTGCATCAGCATCCACGACGAGGTTCGCTACCTGGTGCGTGAGGAGGA 3732 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3599 TGATGGGCGCTTCTGCATCAGCATCCACGACGAGGTTCGCTACCTGGTGCGTGAGGAGGA 3658 Query 3733 CCGCTACCGTGCCGCCCTGGCACTGCAGATCACCAATCTCCTGACCAGGTGCATGTTTGC 3792 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3659 CCGCTACCGTGCCGCCCTGGCACTGCAGATCACCAATCTCCTGACCAGGTGCATGTTTGC 3718 Query 3793 CTATAAGCTGGGTCTGAATGATCTGCCCCAGTCAGTCGCCTTTTTCAGTGCAGTAGACAT 3852 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3719 CTATAAGCTGGGTCTGAATGATCTGCCCCAGTCAGTCGCCTTTTTCAGTGCAGTAGACAT 3778 Query 3853 TGACCAGTGCCTCAGGAAGGAAGTGACCATGGACTGTAAAACTCCTTCTAACCCAACTGG 3912 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3779 TGACCAGTGCCTCAGGAAGGAAGTGACCATGGACTGTAAAACTCCTTCTAACCCAACTGG 3838 Query 3913 GATGGAAAGGAGATATGGGATCCCCCAGGGTGAAGCACTGGATATTTACCAGATAATTGA 3972 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3839 GATGGAAAGGAGATATGGGATCCCCCAGGGTGAAGCACTGGATATTTACCAGATAATTGA 3898 Query 3973 ACTCACCAAAGGCTCCTTGGAAAAACGAAGCCAGCCTGGACCCTAGCTCTGTCTGGAGGT 4032 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3899 ACTCACCAAAGGCTCCTTGGAAAAACGAAGCCAGCCTGGACCCTAGCTCTGTCTGGAGGT 3958 Query 4033 TCTGTATTTGCTCCTGTGGAGCTTTATTGGAGCGGTGCAGGTTCCTAAACTCAGGCTTTC 4092 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3959 TCTGTATTTGCTCCTGTGGAGCTTTATTGGAGCGGTGCAGGTTCCTAAACTCAGGCTTTC 4018 Query 4093 AGATGTGCTTTTTTGCAAAAGGCAGCCATTTTTCTGTAGCAGGACCTGCCCAGGAAAGTC 4152 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4019 AGATGTGCTTTTTTGCAAAAGGCAGCCATTTTTCTGTAGCAGGACCTGCCCAGGAAAGTC 4078 Query 4153 CTCCTAACGGAAGGCACAATTCAGTGCGTTCAGAACCAGGACACCAACATCAGTGCAGGC 4212 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4079 CTCCTAACGGAAGGCACAATTCAGTGCGTTCAGAACCAGGACACCAACATCAGTGCAGGC 4138 Query 4213 TGTGTGACAAGGGGTACTGTTGGGCACAAATGAAGCAGATGCCCCAAAGGTCACATTAAC 4272 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4139 TGTGTGACAAGGGGTACTGTTGGGCACAAATGAAGCAGATGCCCCAAAGGTCACATTAAC 4198 Query 4273 TCAGGCATTTCTTCCTCCTCTTCTTGGCTGGTTCTCTGTCCTGCTGTGTATGTGCTGATG 4332 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4199 TCAGGCATTTCTTCCTCCTCTTCTTGGCTGGTTCTCTGTCCTGCTGTGTATGTGCTGATG 4258 Query 4333 CAGTGCCCTAGAAGGGGAGAGTAGAAATTTTGACAACCTTGTTCTAAGGTGATGGGAATA 4392 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4259 CAGTGCCCTAGAAGGGGAGAGTAGAAATTTTGACAACCTTGTTCTAAGGTGATGGGAATA 4318 Query 4393 AAAACAAACACCAAACTCCTGGAACAGTTGTGCTTTCCCGTCTGCTGCCCAGGTTGTGAC 4452 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4319 AAAACAAACACCAAACTCCTGGAACAGTTGTGCTTTCCCGTCTGCTGCCCAGGTTGTGAC 4378 Query 4453 TTAGAACTCCGTCCTGAGTAGATGGACGAGATGCTGGGAGCCCGGAGCATCACAGCTACA 4512 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4379 TTAGAACTCCGTCCTGAGTAGATGGACGAGATGCTGGGAGCCCGGAGCATCACAGCTACA 4438 Query 4513 GACGGCCTGGGGCACAGTGATGTACGGAACTCCGCATCAGCCGGCTAGCCAGATTATTTT 4572 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4439 GACGGCCTGGGGCACAGTGATGTACGGAACTCCGCATCAGCCGGCTAGCCAGATTATTTT 4498 Query 4573 ATATAAATGTCTAATTTTGA 4592 |||||||||||||||||||| Sbjct 4499 ATATAAATGTCTAATTTTGA 4518 >gb|U53584.1|MMU53584 UniGene infoGeoGene info Mus musculus DNA polymerase gamma mRNA, nuclear gene encoding mitochondrial protein, complete cds Length=4523 Score = 8152 bits (4414), Expect = 0.0 Identities = 4488/4524 (99%), Gaps = 15/4524 (0%) Strand=Plus/Plus Query 80 GGGAAGTTGCGGCTGCTCCCGAGACCGCACGCCACCCTGAGGCTGCGTGGGCCGCGCGCC 139 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1 GGGAAGTTGCGGCTGCTCCCGAGACCGCACGCCACCCTGAGGCTGCGTGGGCCGCGCGCC 60 Query 140 GCGGACGCCGCGTCGTCGCCGGGGCTGTGGGCTGCCGCAGAACGGGAAGCGCGAAGCGGA 199 || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 61 GC-GACGCCGCGTCGTCGCCGGGGCTGTGGGCTGCCGCAGAACGGGAAGCGCGAAGCGGA 119 Query 200 CCGAGGACTTGTGTGAGGAAGGCAGGCATGGTGAGACCTATTTCACTGACAGGAGCACAG 259 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 120 CCGAGGACTTGTGTGAGGAAGGCAGGCATGGTGAGACCTATTTCACTGACAGGAGCACAG 179 Query 260 AGAGGGGACGCGTCTCTCTCTGAGTCTTTCGGCCACTAAAAGCAGTCAAGCTGGAGCCCA 319 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 180 AGAGGGGACGCGTCTCTCTCTGAGTCTTTCGGCCACTAAAAGCAGTCAAGCTGGAGCCCA 239 Query 320 AAGCCCGGTGCCCCGACTCACAGCGGGGGGCTCCCTGCACCAACCATGAGCCGCCTGCTC 379 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 240 AAGCCCGGTGCCCCGACTCACAGCGGGGGGCTCCCTGCACCAACCATGAGCCGCCTGCTC 299 Query 380 TGGAAGAAGGTGGCTGGCGCCAAGGTCGCCTCAGGGCCAGTACCAGCAACCGCGCGCTGG 439 |||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| Sbjct 300 TGGAAGAAGGTGGCTGGCGCCAAGGTCGCCTCAGGGCCAGTACCAGCAACCGAGGGCTGG 359 Query 440 GTCTCCAGCTCCGTCCTCGAC-CCCGTCCCCAGCGACGGGCGGCCGCCGTCGCAAATGCC 498 ||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||| Sbjct 360 GTCTCCAGCTCCGTCCTCG-CACCCGTCCCCAGCGACGGGCGGCCGCCGTCGCAAATGCC 418 Query 499 CTCCTCCGAGAATGGGCAGCTGCGGCTCAACCCTCTGCTCATCCAGATGTTGTCGAGAGG 558 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 419 CTCCTCCGAGAATGGGCAGCTGCGGCTCAACCCTCTGCTCATCCAGATGTTGTCGAGAGG 478 Query 559 CCTGCACGAGCAGATCTTCGGGTGCGGCGGGGAAATGCCCGACGAGGCCGCGGTGCAGCG 618 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 479 CCTGCACGAGCAGATCTTCGGGTGCGGCGGGGAAATGCCCGACGAGGCCGCGGTGCAGCG 538 Query 619 CAGCGTAGAGCACCTGCAGAAGCACGGGCTCTGGGGGCAGCCGGCCACGCCCTTGCCAGA 678 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 539 CAGCGTAGAGCACCTGCAGAAGCACGGGCTCTGGGGGCAGCCGGCCACGCCCTTGCCAGA 598 Query 679 CGTGGAGCTGCGCCTGCCCCGGCTCTTCGGGGGCAACCTGGACCAGCACTTCCGCCTCCT 738 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 599 CGTGGAGCTGCGCCTGCCCCGGCTCTTCGGGGGCAACCTGGACCAGCACTTCCGCCTCCT 658 Query 739 GGCCCAGAAGCAGAGCCTGCCTTACTTGGAGGCGGCCGCCTCGTTATTGGAGGCCCAATT 798 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 659 GGCCCAGAAGCAGAGCCTGCCTTACTTGGAGGCGGCCGCCTCGTTATTGGAGGCCCAATT 718 Query 799 GCCCCCCGAGCCCAAGAGCTGGGCCTGGGCGGAGGGCTGGACCCGGTACGGCCCCGAGGG 858 |||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||| Sbjct 719 GCCCCCCGAGCCCAAGAGCTGGGCTTGGGCGGAGGGCTGGAACCGGTACGGCCCCGAGGG 778 Query 859 GGAGGCCGAACCCGTGGCCATCCCCGAGGAGCGGGCCCTGGTGTTCGACGTGGAGGTCTG 918 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 779 GGAGGCCGAACCCGTGGCCATCCCCGAGGAGCGGGCCCTGGTGTTCGACGTGGAGGTCTG 838 Query 919 CTTGGCAGAGGGAACCTGCCCCACTTTGGCGGTGGCCATATCCCCCTCGGCCTGGTATTC 978 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 839 CTTGGCAGAGGGAACCTGCCCCACTTTGGCGGTGGCCATATCCCCCTCGGCCTGGTATTC 898 Query 979 CTGGTGCAGCCGGCGGCTGGTGGAAGAGCGTTACTCTTGGACCAGCCAGCTATCGCCGGC 1038 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 899 CTGGTGCAGCCGGCGGCTGGTGGAAGAGCGTTACTCTTGGACCAGCCAGCTATCGCCGGC 958 Query 1039 TGACCTAATCCCTTTGGGGGGCTCCACTAGTGCCAGCAGCTCCACCAAGCAGGATGGGCA 1098 |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 959 TGACCTAACCCCTTTGGGGGGCTCCACTAGTGCCAGCAGCTCCACCAAGCAGGATGGGCA 1018 Query 1099 GGAACAGTTAGTGGTGGGGCACAATGTTTCCTTTGACCGAGCCCATATCAGGGAACAGTA 1158 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1019 GGAACAGTTAGTGGTGGGGCACAATGTTTCCTTTGACCGAGCCCATATCAGGGAACAGTA 1078 Query 1159 TCTGATTCAGGACTCCCGGATGCGTTTTCTCGATACTATGAGCATGCACATGGCCATCTC 1218 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1079 TCTGATTCAGGACTCCCGGATGCGTTTTCTCGATACTATGAGCATGCACATGGCCATCTC 1138 Query 1219 GGGGCTGAGCAGCTTCCAGCGCAGCCTGTGGATGGGAGCCAAGCAGGGAAAGC-ACAAGA 1277 ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| Sbjct 1139 GGGGCTGAGCAGCTTCCAGCGCAGCCTGTGGATGGGAGCCAAGCAGGGAAAGCAACAAGA 1198 Query 1278 CCCAGCAGTCCACAAAGCGAGGGCAGAAGTCCCCGAGGAAAGCCAATGGTCCAGCGATCT 1337 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | Sbjct 1199 CCCAGCAGTCCACAAAGCGAGGGCAGAAGTCCCCGAGGAAAGCCAATGGTCCAGCGAT-T 1257 Query 1338 CATCTTGGGACTGGATGGATATCAGCAGTGCCAATAATCTTGCAGATGTGCACAACCTTT 1397 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1258 CATCTTGGGACTGGATGGATATCAGCAGTGCCAATAATCTTGCAGATGTGCACAACCTTT 1317 Query 1398 ATGTGGGGGGACCTCCCTTAGAGAAGGAGCCTCGGGAGCTGTTCGTCAAAGGCAGCATGA 1457 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1318 ATGTGGGGGGACCTCCCTTAGAGAAGGAGCCTCGGGAGCTGTTCGTCAAAGGCAGCATGA 1377 Query 1458 GGGATATCCGAGAGAACTTCCAGGATCTGATGCAGTACTGCGCCCGTGATGTGTGGGCCA 1517 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1378 GGGATATCCGAGAGAACTTCCAGGATCTGATGCAGTACTGCGCCCGTGATGTGTGGGCCA 1437 Query 1518 CCTTTGAGGTTTTCCAGCAGCAGCTGCCACTCTTCTTGGAGAGGTGTCCCCACCCAGTGA 1577 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1438 CCTTTGAGGTTTTCCAGCAGCAGCTGCCACTCTTCTTGGAGAGGTGTCCCCACCCAGTGA 1497 Query 1578 CTCTGGCTGGCATGCTGGAGATGGGTGTGTCCTACCTGCCTGTCAACCAGAACTGGGAGC 1637 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1498 CTCTGGCTGGCATGCTGGAGATGGGTGTGTCCTACCTGCCTGTCAACCAGAACTGGGAGC 1557 Query 1638 GTTACCTGACAGAGGCACAGAACACATATGAGGAGCTCCAGCGGGA-GATGAAGAAGTCG 1696 |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct 1558 GTTACCTGACAGAGGCACAGAACACATATGAGGAGCTCCAGCGGGACGATGAAGAAGTCG 1617 Query 1697 CTGATGGATCTGGCTAATGATGCCT-GTCAGTTGCTCTCAGGAGAGAGGTACAAAGAAGA 1755 || | | ||||||||||||||||| |||||||||||||||||||||||||||||||||| Sbjct 1618 TTG-TAG-TCTGGCTAATGATGCCTGGTCAGTTGCTCTCAGGAGAGAGGTACAAAGAAGA 1675 Query 1756 CCCTTGGCTCTGGGACCTAGAATGGGATTTGCAGGAGTTTAAGCAGAAAAAGGCAAAGAA 1815 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1676 CCCTTGGCTCTGGGACCTAGAATGGGATTTGCAGGAGTTTAAGCAGAAAAAGGCAAAGAA 1735 Query 1816 GGTGAAGAAGCCAGCCTCAGCCAGCAAGTTGCCCATCGAGGGAGCTGGGCCCTTTGGGGA 1875 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1736 GGTGAAGAAGCCAGCCTCAGCCAGCAAGTTGCCCATCGAGGGAGCTGGGCCCTTTGGGGA 1795 Query 1876 TCCCATGGATCAGGAAGATCCTGGCCCGCCCAGCGAGGAGGAGGAGCTTCAGCGAAGTGT 1935 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1796 TCCCATGGATCAGGAAGATCCTGGCCCGCCCAGCGAGGAGGAGGAGCTTCAGCGAAGTGT 1855 Query 1936 AACAGCCCACAACCGGTTACAGCAGCTGAGGAGCACCACGGACCTCCTGCCTAAGCGACC 1995 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1856 AACAGCCCACAACCGGTTACAGCAGCTGAGGAGCACCACGGACCTCCTGCCTAAGCGACC 1915 Query 1996 CCAGCACCTTCCAGGACACCCTGGGTGGTACCGGAAGCTCTGCCCTCGACTAGATGACCC 2055 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1916 CCAGCACCTTCCAGGACACCCTGGGTGGTACCGGAAGCTCTGCCCTCGACTAGATGACCC 1975 Query 2056 TGCCTGGGCTCCCGGCCCCAGCCTCCTCAGCCTGCAAATGCGGGTCACTCCTAAGCTCAT 2115 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1976 TGCCTGGGCTCCCGGCCCCAGCCTCCTCAGCCTGCAAATGCGGGTCACTCCTAAGCTCAT 2035 Query 2116 GGCACTGACCTGGGATGGTTTTCCTCTACACTACTCAGACTCTCATGGTTGGGGCTACCT 2175 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2036 GGCACTGACCTGGGATGGTTTTCCTCTACACTACTCAGACTCTCATGGTTGGGGCTACCT 2095 Query 2176 AGTGCCTGGGCGTCGGGATAATCTGACCGAGCCGCCAGTGAGCCCCACTGTAGAATCCGC 2235 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2096 AGTGCCTGGGCGTCGGGATAATCTGACCGAGCCGCCAGTGAGCCCCACTGTAGAATCCGC 2155 Query 2236 TGCAGTAACCTGCCCCTACAGAGCCATCGAGTCCTTATACAGGAAGCACTGCCTTGAACA 2295 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2156 TGCAGTAACCTGCCCCTACAGAGCCATCGAGTCCTTATACAGGAAGCACTGCCTTGAACA 2215 Query 2296 GGGGAAGCAGCAATTGGAGCCCCAGGAGGTAGACCTGGCTGAGGAGTTCTTACTCACTGA 2355 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2216 GGGGAAGCAGCAATTGGAGCCCCAGGAGGTAGACCTGGCTGAGGAGTTCTTACTCACTGA 2275 Query 2356 CAGTAGTGCCATGTGGCAAACGGTAGAAGAACTGGGCTGCTTAGACGTAGAGGCTGAGGC 2415 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2276 CAGTAGTGCCATGTGGCAAACGGTAGAAGAACTGGGCTGCTTAGACGTAGAGGCTGAGGC 2335 Query 2416 CAAGATGGAGAATTCAGGGCTGAGCCAACCTCTAGTTCTGCCTGCTGCTTGTGCCCCCAA 2475 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2336 CAAGATGGAGAATTCAGGGCTGAGCCAACCTCTAGTTCTGCCTGCTGCTTGTGCCCCCAA 2395 Query 2476 ATCCAGCCAGCCCACGTATCACCATGGCAACGGACCTTATAATGATGTGAATATCCCTGG 2535 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2396 ATCCAGCCAGCCCACGTATCACCATGGCAACGGACCTTATAATGATGTGAATATCCCTGG 2455 Query 2536 TTGCTGGTTTTTCAAGCTGCCTCACAAGGACGGTAACAACTACAATGTGGGCAGTCCCTT 2595 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2456 TTGCTGGTTTTTCAAGCTGCCTCACAAGGACGGTAACAACTACAATGTGGGCAGTCCCTT 2515 Query 2596 TGCCAAAGATTTCCTGCCCAAGATGGAGGATGGCACCCTGCAGGCTGGCCCAGGAGGTGC 2655 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2516 TGCCAAAGATTTCCTGCCCAAGATGGAGGATGGCACCCTGCAGGCTGGCCCAGGAGGTGC 2575 Query 2656 CAGTGGGCCTCGTGCCCTGGAAATAAATAAAATGATTTCTTTTTGGAGGAATGCTCATAA 2715 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2576 CAGTGGGCCTCGTGCCCTGGAAATAAATAAAATGATTTCTTTTTGGAGGAATGCTCATAA 2635 Query 2716 ACGTATCAGTTCCCAGATGGTGGTATGGCTCCCCAGGTCAGCTCTGCCCCGGGTTGTGAC 2775 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2636 ACGTATCAGTTCCCAGATGGTGGTATGGCTCCCCAGGTCAGCTCTGCCCCGGGTTGTGAC 2695 Query 2776 CAGGCACCCCAGCTT-CGATGAGGAAGGCCACTATGGGGCCATCCTACCCCAGGTGGTGA 2834 ||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| Sbjct 2696 CAGGCACCC-AGCTTTCGATGAGGAAGGCCACTATGGGGCCATCCTACCCCAGGTGGTGA 2754 Query 2835 CTGCTGGCACCATCACCCGTCGAGCTGTGGAGCCCACGTGGCTCACTGCCAGTAATGCTC 2894 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2755 CTGCTGGCACCATCACCCGTCGAGCTGTGGAGCCCACGTGGCTCACTGCCAGTAATGCTC 2814 Query 2895 GGCCTGACCGGGTAGGCAGTGAGTTGAAAGCCATGGTGCAGGCTCCACCTGGCTATGTCC 2954 ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct 2815 GGCCTGACCGGGTAGGCAGTGAGTTGAAAGCCATGGTGCAGGCTCCAACTGGCTATGTCC 2874 Query 2955 TTGTGGGTGCTGATGTGGACTCACAGGAACTGTGGATCGCAGCTGTACTTGGAGATGCTC 3014 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2875 TTGTGGGTGCTGATGTGGACTCACAGGAACTGTGGATCGCAGCTGTACTTGGAGATGCTC 2934 Query 3015 ACTTTGCTGGGATGCATGGCTGCACGGCCTTTGGCTGGATGACTCTGCAGGGCAGGAAGA 3074 |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2935 ACTTAGCTGGGATGCATGGCTGCACGGCCTTTGGCTGGATGACTCTGCAGGGCAGGAAGA 2994 Query 3075 GCAGAGGCACTGATCTGCACAGCAAGACAGCTGCCACTGTGGGCATC-AGCCGAGAGCAT 3133 ||||||||||||||||||||||||||||||||||||||||| ||||| | |||||||||| Sbjct 2995 GCAGAGGCACTGATCTGCACAGCAAGACAGCTGCCACTGTGCGCATCCA-CCGAGAGCAT 3053 Query 3134 GCCAAAATCTTCAACTATGGCCGCATCTATGGGGCTGGGCAGTCCTTTGCTGAGCGCCTA 3193 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3054 GCCAAAATCTTCAACTATGGCCGCATCTATGGGGCTGGGCAGTCCTTTGCTGAGCGCCTA 3113 Query 3194 CTGATGCAGTTCAACCACAGGCTCACAAGGCAGGAGGCAGCTGAGAAGGCCCAGCAGATG 3253 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3114 CTGATGCAGTTCAACCACAGGCTCACAAGGCAGGAGGCAGCTGAGAAGGCCCAGCAGATG 3173 Query 3254 TATGCAGTCACAAAAGGCCTGCGCCGGTATCGGCTGTCTGCGGATGGTGAGTGGCTGGTG 3313 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3174 TATGCAGTCACAAAAGGCCTGCGCCGGTATCGGCTGTCTGCGGATGGTGAGTGGCTGGTG 3233 Query 3314 AAACAGTTGAATCTTCCTGTGGACAGGACAGAGGACGGCTGGGTCTCCCTACAAGATCTT 3373 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3234 AAACAGTTGAATCTTCCTGTGGACAGGACAGAGGACGGCTGGGTCTCCCTACAAGATCTT 3293 Query 3374 CGAATGATCCGAAGAGAAGCTTCAAGGAAGTCACGATGGAAGAAGTGGGAGGTAGCCTCT 3433 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3294 CGAATGATCCGAAGAGAAGCTTCAAGGAAGTCACGATGGAAGAAGTGGGAGGTAGCCTCT 3353 Query 3434 GAACGAGCATGGACAGGGGGCACAGAGTCAGAAATGTTTAATAAGCTGGAGAGTATTGCC 3493 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3354 GAACGAGCATGGACAGGGGGCACAGAGTCAGAAATGTTTAATAAGCTGGAGAGTATTGCC 3413 Query 3494 ATGTCTGATACACCACGTACCCCAGTACTGGGCTGCTGCATCAGCAGAGCCTTGGAGCCC 3553 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3414 ATGTCTGATACACCACGTACCCCAGTACTGGGCTGCTGCATCAGCAGAGCCTTGGAGCCC 3473 Query 3554 TCAGTTGTCCAGGGAGAGTTTATAACCAGTCGTGTGAACTGGGTGGTACAGAGCTCTGCT 3613 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3474 TCAGTTGTCCAGGGAGAGTTTATAACCAGTCGTGTGAACTGGGTGGTACAGAGCTCTGCT 3533 Query 3614 GTAGACTACTTACATCTCATGCTTGTGGCCATGAAGTGGCTGTTTGAGGAATTTGCCATT 3673 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3534 GTAGACTACTTACATCTCATGCTTGTGGCCATGAAGTGGCTGTTTGAGGAATTTGCCATT 3593 Query 3674 GATGGGCGCTTCTGCATCAGCATCCACGACGAGGTTCGCTACCTGGTGCGTGAGGAGGAC 3733 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3594 GATGGGCGCTTCTGCATCAGCATCCACGACGAGGTTCGCTACCTGGTGCGTGAGGAGGAC 3653 Query 3734 CGCTACCGTGCCGCCCTGGCACTGCAGATCACCAATCTCCTGACCAGGTGCATGTTTGCC 3793 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3654 CGCTACCGTGCCGCCCTGGCACTGCAGATCACCAATCTCCTGACCAGGTGCATGTTTGCC 3713 Query 3794 TATAAGCTGGGTCTGAATGATCTGCCCCAGTCAGTCGCCTTTTTCAGTGCAGTAGACATT 3853 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3714 TATAAGCTGGGTCTGAATGATCTGCCCCAGTCAGTCGCCTTTTTCAGTGCAGTAGACATT 3773 Query 3854 GACCAGTGCCTCAGGAAGGAAGTGACCATGGACTGTAAAACTCCTTCTAACCCAACTGGG 3913 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3774 GACCAGTGCCTCAGGAAGGAAGTGACCATGGACTGTAAAACTCCTTCTAACCCAACTGGG 3833 Query 3914 ATGGAAAGGAGATATGGGATCCCCCAGGGTGAAGCACTGGATATTTACCAGATAATTGAA 3973 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3834 ATGGAAAGGAGATATGGGATCCCCCAGGGTGAAGCACTGGATATTTACCAGATAATTGAA 3893 Query 3974 CTCACCAAAGGCTCCTTGGAAAAACG-AAGCCAGCCTGGACCCTAGCTCTGTCTGGAGGT 4032 |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| Sbjct 3894 CTCACCAAAGGCTCCTTGGAAAAACGGAAGCCAGCCTGGACCCTAGCTCTGTCTGGAGGT 3953 Query 4033 TCTGTATTTGCTCCTGTGGAGCTTTATTGGAGCGGTGCAGGTTCCTAAACTCAGGCTTTC 4092 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3954 TCTGTATTTGCTCCTGTGGAGCTTTATTGGAGCGGTGCAGGTTCCTAAACTCAGGCTTTC 4013 Query 4093 AGATGTGCTTTTTTGCAAAAGGCAGCCATTTTTCTGTAGCAGGACCTGCCCAGGAAAGTC 4152 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4014 AGATGTGCTTTTTTGCAAAAGGCAGCCATTTTTCTGTAGCAGGACCTGCCCAGGAAAGTC 4073 Query 4153 CTCCTAACGGAAGGCACAATTCAGTGCGTTCAGAACCAGGACACCAACATCAGTGCAGGC 4212 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4074 CTCCTAACGGAAGGCACAATTCAGTGCGTTCAGAACCAGGACACCAACATCAGTGCAGGC 4133 Query 4213 TGTGTGACAAGGGGTACTGTTGGGCACAAATGAAGCAGATGCCCCAAAGGTCACATTAAC 4272 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4134 TGTGTGACAAGGGGTACTGTTGGGCACAAATGAAGCAGATGCCCCAAAGGTCACATTAAC 4193 Query 4273 TCAGGCATTTCTTCCTCCTCTTCTTGGCTGGTTCTCTGTCCTGCTGTGTATGTGCTGATG 4332 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4194 TCAGGCATTTCTTCCTCCTCTTCTTGGCTGGTTCTCTGTCCTGCTGTGTATGTGCTGATG 4253 Query 4333 CAGTGCCCTAGAAGGGGAGAGTAGAAATTTTGACAACCTTGTTCTAAGGTGATGGGAATA 4392 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4254 CAGTGCCCTAGAAGGGGAGAGTAGAAATTTTGACAACCTTGTTCTAAGGTGATGGGAATA 4313 Query 4393 AAAACAAACACCAAACTCCTGGAACAGTTGTGCTTTCCCGTCTGCTGCCCAGGTTGTGAC 4452 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4314 AAAACAAACACCAAACTCCTGGAACAGTTGTGCTTTCCCGTCTGCTGCCCAGGTTGTGAC 4373 Query 4453 TTAGAACTCCGTCCTGAGTAGATGGACGAGATGCTGGGAGCCCGGAGCATCACAGCTACA 4512 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4374 TTAGAACTCCGTCCTGAGTAGATGGACGAGATGCTGGGAGCCCGGAGCATCACAGCTACA 4433 Query 4513 GACGGCCTGGGGCACAGTGATGTACGGAACTCCGCATCAGCCGGCTAGCCAGATTATTTT 4572 |||||||||||||||||| |||| ||||| ||||| | ||||||||||||||||| Sbjct 4434 GACGGCCTGGGGCACAGTCC-GTACNGAACTGNNCATCANCNAGCTAGCCAGATTATTTT 4492 Query 4573 ATATAAATGTCTAATTTTGACTGG 4596 |||||||| ||||||||| ||||| Sbjct 4493 ATATAAATNTCTAATTTTTACTGG 4516 >dbj|AK148091.1| UniGene infoGene info Mus musculus B16 F10Y cells cDNA, RIKEN full-length enriched library, clone:G370014F07 product:polymerase (DNA directed), gamma, full insert sequence Length=4350 Score = 8004 bits (4334), Expect = 0.0 Identities = 4344/4349 (99%), Gaps = 0/4349 (0%) Strand=Plus/Plus Query 40 GCCTGCCTCTGGGTAGCCGCGGGACCCAGTTCGCGCAGACGGGAAGTTGCGGCTGCTCCC 99 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2 GCCTGCCTCTGGGTAGCCGCGGGACCCAGTTCGCGCAGACGGGAAGTTGCGGCTGCTCCC 61 Query 100 GAGACCGCACGCCACCCTGAGGCTGCGTGGGCCGCGCGCCGCGGACGCCGCGTCGTCGCC 159 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 62 GAGACCGCACGCCACCCTGAGGCTGCGTGGGCCGCGCGCCGCGGACGCCGCGTCGTCGCC 121 Query 160 GGGGCTGTGGGCTGCCGCAGAACGGGAAGCGCGAAGCGGACCGAGGACTTGTGTGAGGAA 219 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 122 GGGGCTGTGGGCTGCCGCAGAACGGGAAGCGCGAAGCGGACCGAGGACTTGTGTGAGGAA 181 Query 220 GGCAGGCATGGTGAGACCTATTTCACTGACAGGAGCACAGAGAGGGGACGCGTCTCTCTC 279 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 182 GGCAGGCATGGTGAGACCTATTTCACTGACAGGAGCACAGAGAGGGGACGCGTCTCTCTC 241 Query 280 TGAGTCTTTCGGCCACTAAAAGCAGTCAAGCTGGAGCCCAAAGCCCGGTGCCCCGACTCA 339 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 242 TGAGTCTTTCGGCCACTAAAAGCAGTCAAGCTGGAGCCCAAAGCCCGGTGCCCCGACTCA 301 Query 340 CAGCGGGGGGCTCCCTGCACCAACCATGAGCCGCCTGCTCTGGAAGAAGGTGGCTGGCGC 399 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 302 CAGCGGGGGGCTCCCTGCACCAACCATGAGCCGCCTGCTCTGGAAGAAGGTGGCTGGCGC 361 Query 400 CAAGGTCGCCTCAGGGCCAGTACCAGCAACCGCGCGCTGGGTCTCCAGCTCCGTCCTCGA 459 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 362 CAAGGTCGCCTCAGGGCCAGTACCAGCAACCGCGCGCTGGGTCTCCAGCTCCGTCCTCGA 421 Query 460 CCCCGTCCCCAGCGACGGGCGGCCGCCGTCGCAAATGCCCTCCTCCGAGAATGGGCAGCT 519 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 422 CCCCGTCCCCAGCGACGGGCGGCCGCCGTCGCAAATGCCCTCCTCCGAGAATGGGCAGCT 481 Query 520 GCGGCTCAACCCTCTGCTCATCCAGATGTTGTCGAGAGGCCTGCACGAGCAGATCTTCGG 579 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 482 GCGGCTCAACCCTCTGCTCATCCAGATGTTGTCGAGAGGCCTGCACGAGCAGATCTTCGG 541 Query 580 GTGCGGCGGGGAAATGCCCGACGAGGCCGCGGTGCAGCGCAGCGTAGAGCACCTGCAGAA 639 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 542 GTGCGGCGGGGAAATGCCCGACGAGGCCGCGGTGCAGCGCAGCGTAGAGCACCTGCAGAA 601 Query 640 GCACGGGCTCTGGGGGCAGCCGGCCACGCCCTTGCCAGACGTGGAGCTGCGCCTGCCCCG 699 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 602 GCACGGGCTCTGGGGGCAGCCGGCCACGCCCTTGCCAGACGTGGAGCTGCGCCTGCCCCG 661 Query 700 GCTCTTCGGGGGCAACCTGGACCAGCACTTCCGCCTCCTGGCCCAGAAGCAGAGCCTGCC 759 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 662 GCTCTTCGGGGGCAACCTGGACCAGCACTTCCGCCTCCTGGCCCAGAAGCAGAGCCTGCC 721 Query 760 TTACTTGGAGGCGGCCGCCTCGTTATTGGAGGCCCAATTGCCCCCCGAGCCCAAGAGCTG 819 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 722 TTACTTGGAGGCGGCCGCCTCGTTATTGGAGGCCCAATTGCCCCCCGAGCCCAAGAGCTG 781 Query 820 GGCCTGGGCGGAGGGCTGGACCCGGTACGGCCCCGAGGGGGAGGCCGAACCCGTGGCCAT 879 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 782 GGCCTGGGCGGAGGGCTGGACCCGGTACGGCCCCGAGGGGGAGGCCGAACCCGTGGCCAT 841 Query 880 CCCCGAGGAGCGGGCCCTGGTGTTCGACGTGGAGGTCTGCTTGGCAGAGGGAACCTGCCC 939 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 842 CCCCGAGGAGCGGGCCCTGGTGTTCGACGTGGAGGTCTGCTTGGCAGAGGGAACCTGCCC 901 Query 940 CACTTTGGCGGTGGCCATATCCCCCTCGGCCTGGTATTCCTGGTGCAGCCGGCGGCTGGT 999 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 902 CACTTTGGCGGTGGCCATATCCCCCTCGGCCTGGTATTCCTGGTGCAGCCGGCGGCTGGT 961 Query 1000 GGAAGAGCGTTACTCTTGGACCAGCCAGCTATCGCCGGCTGACCTAATCCCTTTGGGGGG 1059 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 962 GGAAGAGCGTTACTCTTGGACCAGCCAGCTATCGCCGGCTGACCTAATCCCTTTGGGGGG 1021 Query 1060 CTCCACTAGTGCCAGCAGCTCCACCAAGCAGGATGGGCAGGAACAGTTAGTGGTGGGGCA 1119 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1022 CTCCACTAGTGCCAGCAGCTCCACCAAGCAGGATGGGCAGGAACAGTTAGTGGTGGGGCA 1081 Query 1120 CAATGTTTCCTTTGACCGAGCCCATATCAGGGAACAGTATCTGATTCAGGACTCCCGGAT 1179 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1082 CAATGTTTCCTTTGACCGAGCCCATATCAGGGAACAGTATCTGATTCAGGACTCCCGGAT 1141 Query 1180 GCGTTTTCTCGATACTATGAGCATGCACATGGCCATCTCGGGGCTGAGCAGCTTCCAGCG 1239 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1142 GCGTTTTCTCGATACTATGAGCATGCACATGGCCATCTCGGGGCTGAGCAGCTTCCAGCG 1201 Query 1240 CAGCCTGTGGATGGGAGCCAAGCAGGGAAAGCACAAGACCCAGCAGTCCACAAAGCGAGG 1299 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1202 CAGCCTGTGGATGGGAGCCAAGCAGGGAAAGCACAAGACCCAGCAGTCCACAAAGCGAGG 1261 Query 1300 GCAGAAGTCCCCGAGGAAAGCCAATGGTCCAGCGATCTCATCTTGGGACTGGATGGATAT 1359 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1262 GCAGAAGTCCCCGAGGAAAGCCAATGGTCCAGCGATCTCATCTTGGGACTGGATGGATAT 1321 Query 1360 CAGCAGTGCCAATAATCTTGCAGATGTGCACAACCTTTATGTGGGGGGACCTCCCTTAGA 1419 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1322 CAGCAGTGCCAATAATCTTGCAGATGTGCACAACCTTTATGTGGGGGGACCTCCCTTAGA 1381 Query 1420 GAAGGAGCCTCGGGAGCTGTTCGTCAAAGGCAGCATGAGGGATATCCGAGAGAACTTCCA 1479 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1382 GAAGGAGCCTCGGGAGCTGTTCGTCAAAGGCAGCATGAGGGATATCCGAGAGAACTTCCA 1441 Query 1480 GGATCTGATGCAGTACTGCGCCCGTGATGTGTGGGCCACCTTTGAGGTTTTCCAGCAGCA 1539 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1442 GGATCTGATGCAGTACTGCGCCCGTGATGTGTGGGCCACCTTTGAGGTTTTCCAGCAGCA 1501 Query 1540 GCTGCCACTCTTCTTGGAGAGGTGTCCCCACCCAGTGACTCTGGCTGGCATGCTGGAGAT 1599 ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| Sbjct 1502 GCTGCCACTCTTCTTGGAGAGGTGTCCCCACCCAGTGGCTCTGGCTGGCATGCTGGAGAT 1561 Query 1600 GGGTGTGTCCTACCTGCCTGTCAACCAGAACTGGGAGCGTTACCTGACAGAGGCACAGAA 1659 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1562 GGGTGTGTCCTACCTGCCTGTCAACCAGAACTGGGAGCGTTACCTGACAGAGGCACAGAA 1621 Query 1660 CACATATGAGGAGCTCCAGCGGGAGATGAAGAAGTCGCTGATGGATCTGGCTAATGATGC 1719 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1622 CACATATGAGGAGCTCCAGCGGGAGATGAAGAAGTCGCTGATGGATCTGGCTAATGATGC 1681 Query 1720 CTGTCAGTTGCTCTCAGGAGAGAGGTACAAAGAAGACCCTTGGCTCTGGGACCTAGAATG 1779 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1682 CTGTCAGTTGCTCTCAGGAGAGAGGTACAAAGAAGACCCTTGGCTCTGGGACCTAGAATG 1741 Query 1780 GGATTTGCAGGAGTTTAAGCAGAAAAAGGCAAAGAAGGTGAAGAAGCCAGCCTCAGCCAG 1839 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1742 GGATTTGCAGGAGTTTAAGCAGAAAAAGGCAAAGAAGGTGAAGAAGCCAGCCTCAGCCAG 1801 Query 1840 CAAGTTGCCCATCGAGGGAGCTGGGCCCTTTGGGGATCCCATGGATCAGGAAGATCCTGG 1899 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1802 CAAGTTGCCCATCGAGGGAGCTGGGCCCTTTGGGGATCCCATGGATCAGGAAGATCCTGG 1861 Query 1900 CCCGCCCAGCGAGGAGGAGGAGCTTCAGCGAAGTGTAACAGCCCACAACCGGTTACAGCA 1959 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1862 CCCGCCCAGCGAGGAGGAGGAGCTTCAGCGAAGTGTAACAGCCCACAACCGGTTACAGCA 1921 Query 1960 GCTGAGGAGCACCACGGACCTCCTGCCTAAGCGACCCCAGCACCTTCCAGGACACCCTGG 2019 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1922 GCTGAGGAGCACCACGGACCTCCTGCCTAAGCGACCCCAGCACCTTCCAGGACACCCTGG 1981 Query 2020 GTGGTACCGGAAGCTCTGCCCTCGACTAGATGACCCTGCCTGGGCTCCCGGCCCCAGCCT 2079 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1982 GTGGTACCGGAAGCTCTGCCCTCGACTAGATGACCCTGCCTGGGCTCCCGGCCCCAGCCT 2041 Query 2080 CCTCAGCCTGCAAATGCGGGTCACTCCTAAGCTCATGGCACTGACCTGGGATGGTTTTCC 2139 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2042 CCTCAGCCTGCAAATGCGGGTCACTCCTAAGCTCATGGCACTGACCTGGGATGGTTTTCC 2101 Query 2140 TCTACACTACTCAGACTCTCATGGTTGGGGCTACCTAGTGCCTGGGCGTCGGGATAATCT 2199 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2102 TCTACACTACTCAGACTCTCATGGTTGGGGCTACCTAGTGCCTGGGCGTCGGGATAATCT 2161 Query 2200 GACCGAGCCGCCAGTGAGCCCCACTGTAGAATCCGCTGCAGTAACCTGCCCCTACAGAGC 2259 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| | Sbjct 2162 GACCGAGCCGCCAGTGAGCCCCACTGTAGAATCCGCTGCAGTAACTTGCCCCTACAGAAC 2221 Query 2260 CATCGAGTCCTTATACAGGAAGCACTGCCTTGAACAGGGGAAGCAGCAATTGGAGCCCCA 2319 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2222 CATCGAGTCCTTATACAGGAAGCACTGCCTTGAACAGGGGAAGCAGCAATTGGAGCCCCA 2281 Query 2320 GGAGGTAGACCTGGCTGAGGAGTTCTTACTCACTGACAGTAGTGCCATGTGGCAAACGGT 2379 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2282 GGAGGTAGACCTGGCTGAGGAGTTCTTACTCACTGACAGTAGTGCCATGTGGCAAACGGT 2341 Query 2380 AGAAGAACTGGGCTGCTTAGACGTAGAGGCTGAGGCCAAGATGGAGAATTCAGGGCTGAG 2439 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2342 AGAAGAACTGGGCTGCTTAGACGTAGAGGCTGAGGCCAAGATGGAGAATTCAGGGCTGAG 2401 Query 2440 CCAACCTCTAGTTCTGCCTGCTGCTTGTGCCCCCAAATCCAGCCAGCCCACGTATCACCA 2499 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2402 CCAACCTCTAGTTCTGCCTGCTGCTTGTGCCCCCAAATCCAGCCAGCCCACGTATCACCA 2461 Query 2500 TGGCAACGGACCTTATAATGATGTGAATATCCCTGGTTGCTGGTTTTTCAAGCTGCCTCA 2559 |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct 2462 TGGCAACGGACCTTATAATGATGTAAATATCCCTGGTTGCTGGTTTTTCAAGCTGCCTCA 2521 Query 2560 CAAGGACGGTAACAACTACAATGTGGGCAGTCCCTTTGCCAAAGATTTCCTGCCCAAGAT 2619 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2522 CAAGGACGGTAACAACTACAATGTGGGCAGTCCCTTTGCCAAAGATTTCCTGCCCAAGAT 2581 Query 2620 GGAGGATGGCACCCTGCAGGCTGGCCCAGGAGGTGCCAGTGGGCCTCGTGCCCTGGAAAT 2679 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2582 GGAGGATGGCACCCTGCAGGCTGGCCCAGGAGGTGCCAGTGGGCCTCGTGCCCTGGAAAT 2641 Query 2680 AAATAAAATGATTTCTTTTTGGAGGAATGCTCATAAACGTATCAGTTCCCAGATGGTGGT 2739 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2642 AAATAAAATGATTTCTTTTTGGAGGAATGCTCATAAACGTATCAGTTCCCAGATGGTGGT 2701 Query 2740 ATGGCTCCCCAGGTCAGCTCTGCCCCGGGTTGTGACCAGGCACCCCAGCTTCGATGAGGA 2799 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2702 ATGGCTCCCCAGGTCAGCTCTGCCCCGGGTTGTGACCAGGCACCCCAGCTTCGATGAGGA 2761 Query 2800 AGGCCACTATGGGGCCATCCTACCCCAGGTGGTGACTGCTGGCACCATCACCCGTCGAGC 2859 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2762 AGGCCACTATGGGGCCATCCTACCCCAGGTGGTGACTGCTGGCACCATCACCCGTCGAGC 2821 Query 2860 TGTGGAGCCCACGTGGCTCACTGCCAGTAATGCTCGGCCTGACCGGGTAGGCAGTGAGTT 2919 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2822 TGTGGAGCCCACGTGGCTCACTGCCAGTAATGCTCGGCCTGACCGGGTAGGCAGTGAGTT 2881 Query 2920 GAAAGCCATGGTGCAGGCTCCACCTGGCTATGTCCTTGTGGGTGCTGATGTGGACTCACA 2979 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2882 GAAAGCCATGGTGCAGGCTCCACCTGGCTATGTCCTTGTGGGTGCTGATGTGGACTCACA 2941 Query 2980 GGAACTGTGGATCGCAGCTGTACTTGGAGATGCTCACTTTGCTGGGATGCATGGCTGCAC 3039 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2942 GGAACTGTGGATCGCAGCTGTACTTGGAGATGCTCACTTTGCTGGGATGCATGGCTGCAC 3001 Query 3040 GGCCTTTGGCTGGATGACTCTGCAGGGCAGGAAGAGCAGAGGCACTGATCTGCACAGCAA 3099 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3002 GGCCTTTGGCTGGATGACTCTGCAGGGCAGGAAGAGCAGAGGCACTGATCTGCACAGCAA 3061 Query 3100 GACAGCTGCCACTGTGGGCATCAGCCGAGAGCATGCCAAAATCTTCAACTATGGCCGCAT 3159 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3062 GACAGCTGCCACTGTGGGCATCAGCCGAGAGCATGCCAAAATCTTCAACTATGGCCGCAT 3121 Query 3160 CTATGGGGCTGGGCAGTCCTTTGCTGAGCGCCTACTGATGCAGTTCAACCACAGGCTCAC 3219 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3122 CTATGGGGCTGGGCAGTCCTTTGCTGAGCGCCTACTGATGCAGTTCAACCACAGGCTCAC 3181 Query 3220 AAGGCAGGAGGCAGCTGAGAAGGCCCAGCAGATGTATGCAGTCACAAAAGGCCTGCGCCG 3279 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3182 AAGGCAGGAGGCAGCTGAGAAGGCCCAGCAGATGTATGCAGTCACAAAAGGCCTGCGCCG 3241 Query 3280 GTATCGGCTGTCTGCGGATGGTGAGTGGCTGGTGAAACAGTTGAATCTTCCTGTGGACAG 3339 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3242 GTATCGGCTGTCTGCGGATGGTGAGTGGCTGGTGAAACAGTTGAATCTTCCTGTGGACAG 3301 Query 3340 GACAGAGGACGGCTGGGTCTCCCTACAAGATCTTCGAATGATCCGAAGAGAAGCTTCAAG 3399 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3302 GACAGAGGACGGCTGGGTCTCCCTACAAGATCTTCGAATGATCCGAAGAGAAGCTTCAAG 3361 Query 3400 GAAGTCACGATGGAAGAAGTGGGAGGTAGCCTCTGAACGAGCATGGACAGGGGGCACAGA 3459 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3362 GAAGTCACGATGGAAGAAGTGGGAGGTAGCCTCTGAACGAGCATGGACAGGGGGCACAGA 3421 Query 3460 GTCAGAAATGTTTAATAAGCTGGAGAGTATTGCCATGTCTGATACACCACGTACCCCAGT 3519 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3422 GTCAGAAATGTTTAATAAGCTGGAGAGTATTGCCATGTCTGATACACCACGTACCCCAGT 3481 Query 3520 ACTGGGCTGCTGCATCAGCAGAGCCTTGGAGCCCTCAGTTGTCCAGGGAGAGTTTATAAC 3579 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3482 ACTGGGCTGCTGCATCAGCAGAGCCTTGGAGCCCTCAGTTGTCCAGGGAGAGTTTATAAC 3541 Query 3580 CAGTCGTGTGAACTGGGTGGTACAGAGCTCTGCTGTAGACTACTTACATCTCATGCTTGT 3639 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3542 CAGTCGTGTGAACTGGGTGGTACAGAGCTCTGCTGTAGACTACTTACATCTCATGCTTGT 3601 Query 3640 GGCCATGAAGTGGCTGTTTGAGGAATTTGCCATTGATGGGCGCTTCTGCATCAGCATCCA 3699 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3602 GGCCATGAAGTGGCTGTTTGAGGAATTTGCCATTGATGGGCGCTTCTGCATCAGCATCCA 3661 Query 3700 CGACGAGGTTCGCTACCTGGTGCGTGAGGAGGACCGCTACCGTGCCGCCCTGGCACTGCA 3759 ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Sbjct 3662 CGACGAGGTTCGCTACCTGGTGCGTGAGGAGGACCGCTACCATGCCGCCCTGGCACTGCA 3721 Query 3760 GATCACCAATCTCCTGACCAGGTGCATGTTTGCCTATAAGCTGGGTCTGAATGATCTGCC 3819 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3722 GATCACCAATCTCCTGACCAGGTGCATGTTTGCCTATAAGCTGGGTCTGAATGATCTGCC 3781 Query 3820 CCAGTCAGTCGCCTTTTTCAGTGCAGTAGACATTGACCAGTGCCTCAGGAAGGAAGTGAC 3879 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3782 CCAGTCAGTCGCCTTTTTCAGTGCAGTAGACATTGACCAGTGCCTCAGGAAGGAAGTGAC 3841 Query 3880 CATGGACTGTAAAACTCCTTCTAACCCAACTGGGATGGAAAGGAGATATGGGATCCCCCA 3939 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3842 CATGGACTGTAAAACTCCTTCTAACCCAACTGGGATGGAAAGGAGATATGGGATCCCCCA 3901 Query 3940 GGGTGAAGCACTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACG 3999 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3902 GGGTGAAGCACTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACG 3961 Query 4000 AAGCCAGCCTGGACCCTAGCTCTGTCTGGAGGTTCTGTATTTGCTCCTGTGGAGCTTTAT 4059 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3962 AAGCCAGCCTGGACCCTAGCTCTGTCTGGAGGTTCTGTATTTGCTCCTGTGGAGCTTTAT 4021 Query 4060 TGGAGCGGTGCAGGTTCCTAAACTCAGGCTTTCAGATGTGCTTTTTTGCAAAAGGCAGCC 4119 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4022 TGGAGCGGTGCAGGTTCCTAAACTCAGGCTTTCAGATGTGCTTTTTTGCAAAAGGCAGCC 4081 Query 4120 ATTTTTCTGTAGCAGGACCTGCCCAGGAAAGTCCTCCTAACGGAAGGCACAATTCAGTGC 4179 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4082 ATTTTTCTGTAGCAGGACCTGCCCAGGAAAGTCCTCCTAACGGAAGGCACAATTCAGTGC 4141 Query 4180 GTTCAGAACCAGGACACCAACATCAGTGCAGGCTGTGTGACAAGGGGTACTGTTGGGCAC 4239 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4142 GTTCAGAACCAGGACACCAACATCAGTGCAGGCTGTGTGACAAGGGGTACTGTTGGGCAC 4201 Query 4240 AAATGAAGCAGATGCCCCAAAGGTCACATTAACTCAGGCATTTCTTCCTCCTCTTCTTGG 4299 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4202 AAATGAAGCAGATGCCCCAAAGGTCACATTAACTCAGGCATTTCTTCCTCCTCTTCTTGG 4261 Query 4300 CTGGTTCTCTGTCCTGCTGTGTATGTGCTGATGCAGTGCCCTAGAAGGGGAGAGTAGAAA 4359 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4262 CTGGTTCTCTGTCCTGCTGTGTATGTGCTGATGCAGTGCCCTAGAAGGGGAGAGTAGAAA 4321 Query 4360 TTTTGACAACCTTGTTCTAAGGTGATGGG 4388 ||||||||||||||||||||||||||||| Sbjct 4322 TTTTGACAACCTTGTTCTAAGGTGATGGG 4350 >gb|BC131676.1| Mus musculus cDNA clone IMAGE:40110975 Length=4052 Score = 7483 bits (4052), Expect = 0.0 Identities = 4052/4052 (100%), Gaps = 0/4052 (0%) Strand=Plus/Minus Query 215 AGGAAGGCAGGCATGGTGAGACCTATTTCACTGACAGGAGCACAGAGAGGGGACGCGTCT 274 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4052 AGGAAGGCAGGCATGGTGAGACCTATTTCACTGACAGGAGCACAGAGAGGGGACGCGTCT 3993 Query 275 CTCTCTGAGTCTTTCGGCCACTAAAAGCAGTCAAGCTGGAGCCCAAAGCCCGGTGCCCCG 334 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3992 CTCTCTGAGTCTTTCGGCCACTAAAAGCAGTCAAGCTGGAGCCCAAAGCCCGGTGCCCCG 3933 Query 335 ACTCACAGCGGGGGGCTCCCTGCACCAACCATGAGCCGCCTGCTCTGGAAGAAGGTGGCT 394 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3932 ACTCACAGCGGGGGGCTCCCTGCACCAACCATGAGCCGCCTGCTCTGGAAGAAGGTGGCT 3873 Query 395 GGCGCCAAGGTCGCCTCAGGGCCAGTACCAGCAACCGCGCGCTGGGTCTCCAGCTCCGTC 454 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3872 GGCGCCAAGGTCGCCTCAGGGCCAGTACCAGCAACCGCGCGCTGGGTCTCCAGCTCCGTC 3813 Query 455 CTCGACCCCGTCCCCAGCGACGGGCGGCCGCCGTCGCAAATGCCCTCCTCCGAGAATGGG 514 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3812 CTCGACCCCGTCCCCAGCGACGGGCGGCCGCCGTCGCAAATGCCCTCCTCCGAGAATGGG 3753 Query 515 CAGCTGCGGCTCAACCCTCTGCTCATCCAGATGTTGTCGAGAGGCCTGCACGAGCAGATC 574 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3752 CAGCTGCGGCTCAACCCTCTGCTCATCCAGATGTTGTCGAGAGGCCTGCACGAGCAGATC 3693 Query 575 TTCGGGTGCGGCGGGGAAATGCCCGACGAGGCCGCGGTGCAGCGCAGCGTAGAGCACCTG 634 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3692 TTCGGGTGCGGCGGGGAAATGCCCGACGAGGCCGCGGTGCAGCGCAGCGTAGAGCACCTG 3633 Query 635 CAGAAGCACGGGCTCTGGGGGCAGCCGGCCACGCCCTTGCCAGACGTGGAGCTGCGCCTG 694 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3632 CAGAAGCACGGGCTCTGGGGGCAGCCGGCCACGCCCTTGCCAGACGTGGAGCTGCGCCTG 3573 Query 695 CCCCGGCTCTTCGGGGGCAACCTGGACCAGCACTTCCGCCTCCTGGCCCAGAAGCAGAGC 754 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3572 CCCCGGCTCTTCGGGGGCAACCTGGACCAGCACTTCCGCCTCCTGGCCCAGAAGCAGAGC 3513 Query 755 CTGCCTTACTTGGAGGCGGCCGCCTCGTTATTGGAGGCCCAATTGCCCCCCGAGCCCAAG 814 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3512 CTGCCTTACTTGGAGGCGGCCGCCTCGTTATTGGAGGCCCAATTGCCCCCCGAGCCCAAG 3453 Query 815 AGCTGGGCCTGGGCGGAGGGCTGGACCCGGTACGGCCCCGAGGGGGAGGCCGAACCCGTG 874 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3452 AGCTGGGCCTGGGCGGAGGGCTGGACCCGGTACGGCCCCGAGGGGGAGGCCGAACCCGTG 3393 Query 875 GCCATCCCCGAGGAGCGGGCCCTGGTGTTCGACGTGGAGGTCTGCTTGGCAGAGGGAACC 934 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3392 GCCATCCCCGAGGAGCGGGCCCTGGTGTTCGACGTGGAGGTCTGCTTGGCAGAGGGAACC 3333 Query 935 TGCCCCACTTTGGCGGTGGCCATATCCCCCTCGGCCTGGTATTCCTGGTGCAGCCGGCGG 994 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3332 TGCCCCACTTTGGCGGTGGCCATATCCCCCTCGGCCTGGTATTCCTGGTGCAGCCGGCGG 3273 Query 995 CTGGTGGAAGAGCGTTACTCTTGGACCAGCCAGCTATCGCCGGCTGACCTAATCCCTTTG 1054 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3272 CTGGTGGAAGAGCGTTACTCTTGGACCAGCCAGCTATCGCCGGCTGACCTAATCCCTTTG 3213 Query 1055 GGGGGCTCCACTAGTGCCAGCAGCTCCACCAAGCAGGATGGGCAGGAACAGTTAGTGGTG 1114 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3212 GGGGGCTCCACTAGTGCCAGCAGCTCCACCAAGCAGGATGGGCAGGAACAGTTAGTGGTG 3153 Query 1115 GGGCACAATGTTTCCTTTGACCGAGCCCATATCAGGGAACAGTATCTGATTCAGGACTCC 1174 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3152 GGGCACAATGTTTCCTTTGACCGAGCCCATATCAGGGAACAGTATCTGATTCAGGACTCC 3093 Query 1175 CGGATGCGTTTTCTCGATACTATGAGCATGCACATGGCCATCTCGGGGCTGAGCAGCTTC 1234 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3092 CGGATGCGTTTTCTCGATACTATGAGCATGCACATGGCCATCTCGGGGCTGAGCAGCTTC 3033 Query 1235 CAGCGCAGCCTGTGGATGGGAGCCAAGCAGGGAAAGCACAAGACCCAGCAGTCCACAAAG 1294 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3032 CAGCGCAGCCTGTGGATGGGAGCCAAGCAGGGAAAGCACAAGACCCAGCAGTCCACAAAG 2973 Query 1295 CGAGGGCAGAAGTCCCCGAGGAAAGCCAATGGTCCAGCGATCTCATCTTGGGACTGGATG 1354 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2972 CGAGGGCAGAAGTCCCCGAGGAAAGCCAATGGTCCAGCGATCTCATCTTGGGACTGGATG 2913 Query 1355 GATATCAGCAGTGCCAATAATCTTGCAGATGTGCACAACCTTTATGTGGGGGGACCTCCC 1414 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2912 GATATCAGCAGTGCCAATAATCTTGCAGATGTGCACAACCTTTATGTGGGGGGACCTCCC 2853 Query 1415 TTAGAGAAGGAGCCTCGGGAGCTGTTCGTCAAAGGCAGCATGAGGGATATCCGAGAGAAC 1474 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2852 TTAGAGAAGGAGCCTCGGGAGCTGTTCGTCAAAGGCAGCATGAGGGATATCCGAGAGAAC 2793 Query 1475 TTCCAGGATCTGATGCAGTACTGCGCCCGTGATGTGTGGGCCACCTTTGAGGTTTTCCAG 1534 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2792 TTCCAGGATCTGATGCAGTACTGCGCCCGTGATGTGTGGGCCACCTTTGAGGTTTTCCAG 2733 Query 1535 CAGCAGCTGCCACTCTTCTTGGAGAGGTGTCCCCACCCAGTGACTCTGGCTGGCATGCTG 1594 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2732 CAGCAGCTGCCACTCTTCTTGGAGAGGTGTCCCCACCCAGTGACTCTGGCTGGCATGCTG 2673 Query 1595 GAGATGGGTGTGTCCTACCTGCCTGTCAACCAGAACTGGGAGCGTTACCTGACAGAGGCA 1654 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2672 GAGATGGGTGTGTCCTACCTGCCTGTCAACCAGAACTGGGAGCGTTACCTGACAGAGGCA 2613 Query 1655 CAGAACACATATGAGGAGCTCCAGCGGGAGATGAAGAAGTCGCTGATGGATCTGGCTAAT 1714 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2612 CAGAACACATATGAGGAGCTCCAGCGGGAGATGAAGAAGTCGCTGATGGATCTGGCTAAT 2553 Query 1715 GATGCCTGTCAGTTGCTCTCAGGAGAGAGGTACAAAGAAGACCCTTGGCTCTGGGACCTA 1774 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2552 GATGCCTGTCAGTTGCTCTCAGGAGAGAGGTACAAAGAAGACCCTTGGCTCTGGGACCTA 2493 Query 1775 GAATGGGATTTGCAGGAGTTTAAGCAGAAAAAGGCAAAGAAGGTGAAGAAGCCAGCCTCA 1834 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2492 GAATGGGATTTGCAGGAGTTTAAGCAGAAAAAGGCAAAGAAGGTGAAGAAGCCAGCCTCA 2433 Query 1835 GCCAGCAAGTTGCCCATCGAGGGAGCTGGGCCCTTTGGGGATCCCATGGATCAGGAAGAT 1894 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2432 GCCAGCAAGTTGCCCATCGAGGGAGCTGGGCCCTTTGGGGATCCCATGGATCAGGAAGAT 2373 Query 1895 CCTGGCCCGCCCAGCGAGGAGGAGGAGCTTCAGCGAAGTGTAACAGCCCACAACCGGTTA 1954 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2372 CCTGGCCCGCCCAGCGAGGAGGAGGAGCTTCAGCGAAGTGTAACAGCCCACAACCGGTTA 2313 Query 1955 CAGCAGCTGAGGAGCACCACGGACCTCCTGCCTAAGCGACCCCAGCACCTTCCAGGACAC 2014 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2312 CAGCAGCTGAGGAGCACCACGGACCTCCTGCCTAAGCGACCCCAGCACCTTCCAGGACAC 2253 Query 2015 CCTGGGTGGTACCGGAAGCTCTGCCCTCGACTAGATGACCCTGCCTGGGCTCCCGGCCCC 2074 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2252 CCTGGGTGGTACCGGAAGCTCTGCCCTCGACTAGATGACCCTGCCTGGGCTCCCGGCCCC 2193 Query 2075 AGCCTCCTCAGCCTGCAAATGCGGGTCACTCCTAAGCTCATGGCACTGACCTGGGATGGT 2134 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2192 AGCCTCCTCAGCCTGCAAATGCGGGTCACTCCTAAGCTCATGGCACTGACCTGGGATGGT 2133 Query 2135 TTTCCTCTACACTACTCAGACTCTCATGGTTGGGGCTACCTAGTGCCTGGGCGTCGGGAT 2194 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2132 TTTCCTCTACACTACTCAGACTCTCATGGTTGGGGCTACCTAGTGCCTGGGCGTCGGGAT 2073 Query 2195 AATCTGACCGAGCCGCCAGTGAGCCCCACTGTAGAATCCGCTGCAGTAACCTGCCCCTAC 2254 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2072 AATCTGACCGAGCCGCCAGTGAGCCCCACTGTAGAATCCGCTGCAGTAACCTGCCCCTAC 2013 Query 2255 AGAGCCATCGAGTCCTTATACAGGAAGCACTGCCTTGAACAGGGGAAGCAGCAATTGGAG 2314 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2012 AGAGCCATCGAGTCCTTATACAGGAAGCACTGCCTTGAACAGGGGAAGCAGCAATTGGAG 1953 Query 2315 CCCCAGGAGGTAGACCTGGCTGAGGAGTTCTTACTCACTGACAGTAGTGCCATGTGGCAA 2374 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1952 CCCCAGGAGGTAGACCTGGCTGAGGAGTTCTTACTCACTGACAGTAGTGCCATGTGGCAA 1893 Query 2375 ACGGTAGAAGAACTGGGCTGCTTAGACGTAGAGGCTGAGGCCAAGATGGAGAATTCAGGG 2434 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1892 ACGGTAGAAGAACTGGGCTGCTTAGACGTAGAGGCTGAGGCCAAGATGGAGAATTCAGGG 1833 Query 2435 CTGAGCCAACCTCTAGTTCTGCCTGCTGCTTGTGCCCCCAAATCCAGCCAGCCCACGTAT 2494 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1832 CTGAGCCAACCTCTAGTTCTGCCTGCTGCTTGTGCCCCCAAATCCAGCCAGCCCACGTAT 1773 Query 2495 CACCATGGCAACGGACCTTATAATGATGTGAATATCCCTGGTTGCTGGTTTTTCAAGCTG 2554 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1772 CACCATGGCAACGGACCTTATAATGATGTGAATATCCCTGGTTGCTGGTTTTTCAAGCTG 1713 Query 2555 CCTCACAAGGACGGTAACAACTACAATGTGGGCAGTCCCTTTGCCAAAGATTTCCTGCCC 2614 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1712 CCTCACAAGGACGGTAACAACTACAATGTGGGCAGTCCCTTTGCCAAAGATTTCCTGCCC 1653 Query 2615 AAGATGGAGGATGGCACCCTGCAGGCTGGCCCAGGAGGTGCCAGTGGGCCTCGTGCCCTG 2674 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1652 AAGATGGAGGATGGCACCCTGCAGGCTGGCCCAGGAGGTGCCAGTGGGCCTCGTGCCCTG 1593 Query 2675 GAAATAAATAAAATGATTTCTTTTTGGAGGAATGCTCATAAACGTATCAGTTCCCAGATG 2734 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1592 GAAATAAATAAAATGATTTCTTTTTGGAGGAATGCTCATAAACGTATCAGTTCCCAGATG 1533 Query 2735 GTGGTATGGCTCCCCAGGTCAGCTCTGCCCCGGGTTGTGACCAGGCACCCCAGCTTCGAT 2794 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1532 GTGGTATGGCTCCCCAGGTCAGCTCTGCCCCGGGTTGTGACCAGGCACCCCAGCTTCGAT 1473 Query 2795 GAGGAAGGCCACTATGGGGCCATCCTACCCCAGGTGGTGACTGCTGGCACCATCACCCGT 2854 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1472 GAGGAAGGCCACTATGGGGCCATCCTACCCCAGGTGGTGACTGCTGGCACCATCACCCGT 1413 Query 2855 CGAGCTGTGGAGCCCACGTGGCTCACTGCCAGTAATGCTCGGCCTGACCGGGTAGGCAGT 2914 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1412 CGAGCTGTGGAGCCCACGTGGCTCACTGCCAGTAATGCTCGGCCTGACCGGGTAGGCAGT 1353 Query 2915 GAGTTGAAAGCCATGGTGCAGGCTCCACCTGGCTATGTCCTTGTGGGTGCTGATGTGGAC 2974 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1352 GAGTTGAAAGCCATGGTGCAGGCTCCACCTGGCTATGTCCTTGTGGGTGCTGATGTGGAC 1293 Query 2975 TCACAGGAACTGTGGATCGCAGCTGTACTTGGAGATGCTCACTTTGCTGGGATGCATGGC 3034 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1292 TCACAGGAACTGTGGATCGCAGCTGTACTTGGAGATGCTCACTTTGCTGGGATGCATGGC 1233 Query 3035 TGCACGGCCTTTGGCTGGATGACTCTGCAGGGCAGGAAGAGCAGAGGCACTGATCTGCAC 3094 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1232 TGCACGGCCTTTGGCTGGATGACTCTGCAGGGCAGGAAGAGCAGAGGCACTGATCTGCAC 1173 Query 3095 AGCAAGACAGCTGCCACTGTGGGCATCAGCCGAGAGCATGCCAAAATCTTCAACTATGGC 3154 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1172 AGCAAGACAGCTGCCACTGTGGGCATCAGCCGAGAGCATGCCAAAATCTTCAACTATGGC 1113 Query 3155 CGCATCTATGGGGCTGGGCAGTCCTTTGCTGAGCGCCTACTGATGCAGTTCAACCACAGG 3214 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1112 CGCATCTATGGGGCTGGGCAGTCCTTTGCTGAGCGCCTACTGATGCAGTTCAACCACAGG 1053 Query 3215 CTCACAAGGCAGGAGGCAGCTGAGAAGGCCCAGCAGATGTATGCAGTCACAAAAGGCCTG 3274 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1052 CTCACAAGGCAGGAGGCAGCTGAGAAGGCCCAGCAGATGTATGCAGTCACAAAAGGCCTG 993 Query 3275 CGCCGGTATCGGCTGTCTGCGGATGGTGAGTGGCTGGTGAAACAGTTGAATCTTCCTGTG 3334 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 992 CGCCGGTATCGGCTGTCTGCGGATGGTGAGTGGCTGGTGAAACAGTTGAATCTTCCTGTG 933 Query 3335 GACAGGACAGAGGACGGCTGGGTCTCCCTACAAGATCTTCGAATGATCCGAAGAGAAGCT 3394 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 932 GACAGGACAGAGGACGGCTGGGTCTCCCTACAAGATCTTCGAATGATCCGAAGAGAAGCT 873 Query 3395 TCAAGGAAGTCACGATGGAAGAAGTGGGAGGTAGCCTCTGAACGAGCATGGACAGGGGGC 3454 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 872 TCAAGGAAGTCACGATGGAAGAAGTGGGAGGTAGCCTCTGAACGAGCATGGACAGGGGGC 813 Query 3455 ACAGAGTCAGAAATGTTTAATAAGCTGGAGAGTATTGCCATGTCTGATACACCACGTACC 3514 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 812 ACAGAGTCAGAAATGTTTAATAAGCTGGAGAGTATTGCCATGTCTGATACACCACGTACC 753 Query 3515 CCAGTACTGGGCTGCTGCATCAGCAGAGCCTTGGAGCCCTCAGTTGTCCAGGGAGAGTTT 3574 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 752 CCAGTACTGGGCTGCTGCATCAGCAGAGCCTTGGAGCCCTCAGTTGTCCAGGGAGAGTTT 693 Query 3575 ATAACCAGTCGTGTGAACTGGGTGGTACAGAGCTCTGCTGTAGACTACTTACATCTCATG 3634 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 692 ATAACCAGTCGTGTGAACTGGGTGGTACAGAGCTCTGCTGTAGACTACTTACATCTCATG 633 Query 3635 CTTGTGGCCATGAAGTGGCTGTTTGAGGAATTTGCCATTGATGGGCGCTTCTGCATCAGC 3694 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 632 CTTGTGGCCATGAAGTGGCTGTTTGAGGAATTTGCCATTGATGGGCGCTTCTGCATCAGC 573 Query 3695 ATCCACGACGAGGTTCGCTACCTGGTGCGTGAGGAGGACCGCTACCGTGCCGCCCTGGCA 3754 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 572 ATCCACGACGAGGTTCGCTACCTGGTGCGTGAGGAGGACCGCTACCGTGCCGCCCTGGCA 513 Query 3755 CTGCAGATCACCAATCTCCTGACCAGGTGCATGTTTGCCTATAAGCTGGGTCTGAATGAT 3814 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 512 CTGCAGATCACCAATCTCCTGACCAGGTGCATGTTTGCCTATAAGCTGGGTCTGAATGAT 453 Query 3815 CTGCCCCAGTCAGTCGCCTTTTTCAGTGCAGTAGACATTGACCAGTGCCTCAGGAAGGAA 3874 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 452 CTGCCCCAGTCAGTCGCCTTTTTCAGTGCAGTAGACATTGACCAGTGCCTCAGGAAGGAA 393 Query 3875 GTGACCATGGACTGTAAAACTCCTTCTAACCCAACTGGGATGGAAAGGAGATATGGGATC 3934 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 392 GTGACCATGGACTGTAAAACTCCTTCTAACCCAACTGGGATGGAAAGGAGATATGGGATC 333 Query 3935 CCCCAGGGTGAAGCACTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCTTGGAA 3994 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 332 CCCCAGGGTGAAGCACTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCTTGGAA 273 Query 3995 AAACGAAGCCAGCCTGGACCCTAGCTCTGTCTGGAGGTTCTGTATTTGCTCCTGTGGAGC 4054 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 272 AAACGAAGCCAGCCTGGACCCTAGCTCTGTCTGGAGGTTCTGTATTTGCTCCTGTGGAGC 213 Query 4055 TTTATTGGAGCGGTGCAGGTTCCTAAACTCAGGCTTTCAGATGTGCTTTTTTGCAAAAGG 4114 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 212 TTTATTGGAGCGGTGCAGGTTCCTAAACTCAGGCTTTCAGATGTGCTTTTTTGCAAAAGG 153 Query 4115 CAGCCATTTTTCTGTAGCAGGACCTGCCCAGGAAAGTCCTCCTAACGGAAGGCACAATTC 4174 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 152 CAGCCATTTTTCTGTAGCAGGACCTGCCCAGGAAAGTCCTCCTAACGGAAGGCACAATTC 93 Query 4175 AGTGCGTTCAGAACCAGGACACCAACATCAGTGCAGGCTGTGTGACAAGGGGTACTGTTG 4234 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 92 AGTGCGTTCAGAACCAGGACACCAACATCAGTGCAGGCTGTGTGACAAGGGGTACTGTTG 33 Query 4235 GGCACAAATGAAGCAGATGCCCCAAAGGTCAC 4266 |||||||||||||||||||||||||||||||| Sbjct 32 GGCACAAATGAAGCAGATGCCCCAAAGGTCAC 1 >dbj|AB121698.1| UniGene infoGeoGene info Mus musculus Pol gamma mRNA for mitochondrial DNA polymerase catalytic subunit, complete cds Length=3917 Score = 7223 bits (3911), Expect = 0.0 Identities = 3915/3917 (99%), Gaps = 0/3917 (0%) Strand=Plus/Plus Query 308 AGCTGGAGCCCAAAGCCCGGTGCCCCGACTCACAGCGGGGGGCTCCCTGCACCAACCATG 367 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1 AGCTGGAGCCCAAAGCCCGGTGCCCCGACTCACAGCGGGGGGCTCCCTGCACCAACCATG 60 Query 368 AGCCGCCTGCTCTGGAAGAAGGTGGCTGGCGCCAAGGTCGCCTCAGGGCCAGTACCAGCA 427 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 61 AGCCGCCTGCTCTGGAAGAAGGTGGCTGGCGCCAAGGTCGCCTCAGGGCCAGTACCAGCA 120 Query 428 ACCGCGCGCTGGGTCTCCAGCTCCGTCCTCGACCCCGTCCCCAGCGACGGGCGGCCGCCG 487 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 121 ACCGCGCGCTGGGTCTCCAGCTCCGTCCTCGACCCCGTCCCCAGCGACGGGCGGCCGCCG 180 Query 488 TCGCAAATGCCCTCCTCCGAGAATGGGCAGCTGCGGCTCAACCCTCTGCTCATCCAGATG 547 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 181 TCGCAAATGCCCTCCTCCGAGAATGGGCAGCTGCGGCTCAACCCTCTGCTCATCCAGATG 240 Query 548 TTGTCGAGAGGCCTGCACGAGCAGATCTTCGGGTGCGGCGGGGAAATGCCCGACGAGGCC 607 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 241 TTGTCGAGAGGCCTGCACGAGCAGATCTTCGGGTGCGGCGGGGAAATGCCCGACGAGGCC 300 Query 608 GCGGTGCAGCGCAGCGTAGAGCACCTGCAGAAGCACGGGCTCTGGGGGCAGCCGGCCACG 667 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 301 GCGGTGCAGCGCAGCGTAGAGCACCTGCAGAAGCACGGGCTCTGGGGGCAGCCGGCCACG 360 Query 668 CCCTTGCCAGACGTGGAGCTGCGCCTGCCCCGGCTCTTCGGGGGCAACCTGGACCAGCAC 727 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 361 CCCTTGCCAGACGTGGAGCTGCGCCTGCCCCGGCTCTTCGGGGGCAACCTGGACCAGCAC 420 Query 728 TTCCGCCTCCTGGCCCAGAAGCAGAGCCTGCCTTACTTGGAGGCGGCCGCCTCGTTATTG 787 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 421 TTCCGCCTCCTGGCCCAGAAGCAGAGCCTGCCTTACTTGGAGGCGGCCGCCTCGTTATTG 480 Query 788 GAGGCCCAATTGCCCCCCGAGCCCAAGAGCTGGGCCTGGGCGGAGGGCTGGACCCGGTAC 847 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 481 GAGGCCCAATTGCCCCCCGAGCCCAAGAGCTGGGCCTGGGCGGAGGGCTGGACCCGGTAC 540 Query 848 GGCCCCGAGGGGGAGGCCGAACCCGTGGCCATCCCCGAGGAGCGGGCCCTGGTGTTCGAC 907 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 541 GGCCCCGAGGGGGAGGCCGAACCCGTGGCCATCCCCGAGGAGCGGGCCCTGGTGTTCGAC 600 Query 908 GTGGAGGTCTGCTTGGCAGAGGGAACCTGCCCCACTTTGGCGGTGGCCATATCCCCCTCG 967 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 601 GTGGAGGTCTGCTTGGCAGAGGGAACCTGCCCCACTTTGGCGGTGGCCATATCCCCCTCG 660 Query 968 GCCTGGTATTCCTGGTGCAGCCGGCGGCTGGTGGAAGAGCGTTACTCTTGGACCAGCCAG 1027 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 661 GCCTGGTATTCCTGGTGCAGCCGGCGGCTGGTGGAAGAGCGTTACTCTTGGACCAGCCAG 720 Query 1028 CTATCGCCGGCTGACCTAATCCCTTTGGGGGGCTCCACTAGTGCCAGCAGCTCCACCAAG 1087 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 721 CTATCGCCGGCTGACCTAATCCCTTTGGGGGGCTCCACTAGTGCCAGCAGCTCCACCAAG 780 Query 1088 CAGGATGGGCAGGAACAGTTAGTGGTGGGGCACAATGTTTCCTTTGACCGAGCCCATATC 1147 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 781 CAGGATGGGCAGGAACAGTTAGTGGTGGGGCACAATGTTTCCTTTGACCGAGCCCATATC 840 Query 1148 AGGGAACAGTATCTGATTCAGGACTCCCGGATGCGTTTTCTCGATACTATGAGCATGCAC 1207 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 841 AGGGAACAGTATCTGATTCAGGACTCCCGGATGCGTTTTCTCGATACTATGAGCATGCAC 900 Query 1208 ATGGCCATCTCGGGGCTGAGCAGCTTCCAGCGCAGCCTGTGGATGGGAGCCAAGCAGGGA 1267 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 901 ATGGCCATCTCGGGGCTGAGCAGCTTCCAGCGCAGCCTGTGGATGGGAGCCAAGCAGGGA 960 Query 1268 AAGCACAAGACCCAGCAGTCCACAAAGCGAGGGCAGAAGTCCCCGAGGAAAGCCAATGGT 1327 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 961 AAGCACAAGACCCAGCAGTCCACAAAGCGAGGGCAGAAGTCCCCGAGGAAAGCCAATGGT 1020 Query 1328 CCAGCGATCTCATCTTGGGACTGGATGGATATCAGCAGTGCCAATAATCTTGCAGATGTG 1387 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1021 CCAGCGATCTCATCTTGGGACTGGATGGATATCAGCAGTGCCAATAATCTTGCAGATGTG 1080 Query 1388 CACAACCTTTATGTGGGGGGACCTCCCTTAGAGAAGGAGCCTCGGGAGCTGTTCGTCAAA 1447 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1081 CACAACCTTTATGTGGGGGGACCTCCCTTAGAGAAGGAGCCTCGGGAGCTGTTCGTCAAA 1140 Query 1448 GGCAGCATGAGGGATATCCGAGAGAACTTCCAGGATCTGATGCAGTACTGCGCCCGTGAT 1507 || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1141 GGGAGCATGAGGGATATCCGAGAGAACTTCCAGGATCTGATGCAGTACTGCGCCCGTGAT 1200 Query 1508 GTGTGGGCCACCTTTGAGGTTTTCCAGCAGCAGCTGCCACTCTTCTTGGAGAGGTGTCCC 1567 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1201 GTGTGGGCCACCTTTGAGGTTTTCCAGCAGCAGCTGCCACTCTTCTTGGAGAGGTGTCCC 1260 Query 1568 CACCCAGTGACTCTGGCTGGCATGCTGGAGATGGGTGTGTCCTACCTGCCTGTCAACCAG 1627 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1261 CACCCAGTGACTCTGGCTGGCATGCTGGAGATGGGTGTGTCCTACCTGCCTGTCAACCAG 1320 Query 1628 AACTGGGAGCGTTACCTGACAGAGGCACAGAACACATATGAGGAGCTCCAGCGGGAGATG 1687 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1321 AACTGGGAGCGTTACCTGACAGAGGCACAGAACACATATGAGGAGCTCCAGCGGGAGATG 1380 Query 1688 AAGAAGTCGCTGATGGATCTGGCTAATGATGCCTGTCAGTTGCTCTCAGGAGAGAGGTAC 1747 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1381 AAGAAGTCGCTGATGGATCTGGCTAATGATGCCTGTCAGTTGCTCTCAGGAGAGAGGTAC 1440 Query 1748 AAAGAAGACCCTTGGCTCTGGGACCTAGAATGGGATTTGCAGGAGTTTAAGCAGAAAAAG 1807 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1441 AAAGAAGACCCTTGGCTCTGGGACCTAGAATGGGATTTGCAGGAGTTTAAGCAGAAAAAG 1500 Query 1808 GCAAAGAAGGTGAAGAAGCCAGCCTCAGCCAGCAAGTTGCCCATCGAGGGAGCTGGGCCC 1867 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1501 GCAAAGAAGGTGAAGAAGCCAGCCTCAGCCAGCAAGTTGCCCATCGAGGGAGCTGGGCCC 1560 Query 1868 TTTGGGGATCCCATGGATCAGGAAGATCCTGGCCCGCCCAGCGAGGAGGAGGAGCTTCAG 1927 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1561 TTTGGGGATCCCATGGATCAGGAAGATCCTGGCCCGCCCAGCGAGGAGGAGGAGCTTCAG 1620 Query 1928 CGAAGTGTAACAGCCCACAACCGGTTACAGCAGCTGAGGAGCACCACGGACCTCCTGCCT 1987 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1621 CGAAGTGTAACAGCCCACAACCGGTTACAGCAGCTGAGGAGCACCACGGACCTCCTGCCT 1680 Query 1988 AAGCGACCCCAGCACCTTCCAGGACACCCTGGGTGGTACCGGAAGCTCTGCCCTCGACTA 2047 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1681 AAGCGACCCCAGCACCTTCCAGGACACCCTGGGTGGTACCGGAAGCTCTGCCCTCGACTA 1740 Query 2048 GATGACCCTGCCTGGGCTCCCGGCCCCAGCCTCCTCAGCCTGCAAATGCGGGTCACTCCT 2107 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1741 GATGACCCTGCCTGGGCTCCCGGCCCCAGCCTCCTCAGCCTGCAAATGCGGGTCACTCCT 1800 Query 2108 AAGCTCATGGCACTGACCTGGGATGGTTTTCCTCTACACTACTCAGACTCTCATGGTTGG 2167 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1801 AAGCTCATGGCACTGACCTGGGATGGTTTTCCTCTACACTACTCAGACTCTCATGGTTGG 1860 Query 2168 GGCTACCTAGTGCCTGGGCGTCGGGATAATCTGACCGAGCCGCCAGTGAGCCCCACTGTA 2227 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1861 GGCTACCTAGTGCCTGGGCGTCGGGATAATCTGACCGAGCCGCCAGTGAGCCCCACTGTA 1920 Query 2228 GAATCCGCTGCAGTAACCTGCCCCTACAGAGCCATCGAGTCCTTATACAGGAAGCACTGC 2287 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1921 GAATCCGCTGCAGTAACCTGCCCCTACAGAGCCATCGAGTCCTTATACAGGAAGCACTGC 1980 Query 2288 CTTGAACAGGGGAAGCAGCAATTGGAGCCCCAGGAGGTAGACCTGGCTGAGGAGTTCTTA 2347 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1981 CTTGAACAGGGGAAGCAGCAATTGGAGCCCCAGGAGGTAGACCTGGCTGAGGAGTTCTTA 2040 Query 2348 CTCACTGACAGTAGTGCCATGTGGCAAACGGTAGAAGAACTGGGCTGCTTAGACGTAGAG 2407 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2041 CTCACTGACAGTAGTGCCATGTGGCAAACGGTAGAAGAACTGGGCTGCTTAGACGTAGAG 2100 Query 2408 GCTGAGGCCAAGATGGAGAATTCAGGGCTGAGCCAACCTCTAGTTCTGCCTGCTGCTTGT 2467 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2101 GCTGAGGCCAAGATGGAGAATTCAGGGCTGAGCCAACCTCTAGTTCTGCCTGCTGCTTGT 2160 Query 2468 GCCCCCAAATCCAGCCAGCCCACGTATCACCATGGCAACGGACCTTATAATGATGTGAAT 2527 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2161 GCCCCCAAATCCAGCCAGCCCACGTATCACCATGGCAACGGACCTTATAATGATGTGAAT 2220 Query 2528 ATCCCTGGTTGCTGGTTTTTCAAGCTGCCTCACAAGGACGGTAACAACTACAATGTGGGC 2587 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2221 ATCCCTGGTTGCTGGTTTTTCAAGCTGCCTCACAAGGACGGTAACAACTACAATGTGGGC 2280 Query 2588 AGTCCCTTTGCCAAAGATTTCCTGCCCAAGATGGAGGATGGCACCCTGCAGGCTGGCCCA 2647 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2281 AGTCCCTTTGCCAAAGATTTCCTGCCCAAGATGGAGGATGGCACCCTGCAGGCTGGCCCA 2340 Query 2648 GGAGGTGCCAGTGGGCCTCGTGCCCTGGAAATAAATAAAATGATTTCTTTTTGGAGGAAT 2707 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2341 GGAGGTGCCAGTGGGCCTCGTGCCCTGGAAATAAATAAAATGATTTCTTTTTGGAGGAAT 2400 Query 2708 GCTCATAAACGTATCAGTTCCCAGATGGTGGTATGGCTCCCCAGGTCAGCTCTGCCCCGG 2767 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2401 GCTCATAAACGTATCAGTTCCCAGATGGTGGTATGGCTCCCCAGGTCAGCTCTGCCCCGG 2460 Query 2768 GTTGTGACCAGGCACCCCAGCTTCGATGAGGAAGGCCACTATGGGGCCATCCTACCCCAG 2827 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2461 GTTGTGACCAGGCACCCCAGCTTCGATGAGGAAGGCCACTATGGGGCCATCCTACCCCAG 2520 Query 2828 GTGGTGACTGCTGGCACCATCACCCGTCGAGCTGTGGAGCCCACGTGGCTCACTGCCAGT 2887 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2521 GTGGTGACTGCTGGCACCATCACCCGTCGAGCTGTGGAGCCCACGTGGCTCACTGCCAGT 2580 Query 2888 AATGCTCGGCCTGACCGGGTAGGCAGTGAGTTGAAAGCCATGGTGCAGGCTCCACCTGGC 2947 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2581 AATGCTCGGCCTGACCGGGTAGGCAGTGAGTTGAAAGCCATGGTGCAGGCTCCACCTGGC 2640 Query 2948 TATGTCCTTGTGGGTGCTGATGTGGACTCACAGGAACTGTGGATCGCAGCTGTACTTGGA 3007 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2641 TATGTCCTTGTGGGTGCTGATGTGGACTCACAGGAACTGTGGATCGCAGCTGTACTTGGA 2700 Query 3008 GATGCTCACTTTGCTGGGATGCATGGCTGCACGGCCTTTGGCTGGATGACTCTGCAGGGC 3067 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2701 GATGCTCACTTTGCTGGGATGCATGGCTGCACGGCCTTTGGCTGGATGACTCTGCAGGGC 2760 Query 3068 AGGAAGAGCAGAGGCACTGATCTGCACAGCAAGACAGCTGCCACTGTGGGCATCAGCCGA 3127 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2761 AGGAAGAGCAGAGGCACTGATCTGCACAGCAAGACAGCTGCCACTGTGGGCATCAGCCGA 2820 Query 3128 GAGCATGCCAAAATCTTCAACTATGGCCGCATCTATGGGGCTGGGCAGTCCTTTGCTGAG 3187 |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2821 GAGCATGCCAAAATTTTCAACTATGGCCGCATCTATGGGGCTGGGCAGTCCTTTGCTGAG 2880 Query 3188 CGCCTACTGATGCAGTTCAACCACAGGCTCACAAGGCAGGAGGCAGCTGAGAAGGCCCAG 3247 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2881 CGCCTACTGATGCAGTTCAACCACAGGCTCACAAGGCAGGAGGCAGCTGAGAAGGCCCAG 2940 Query 3248 CAGATGTATGCAGTCACAAAAGGCCTGCGCCGGTATCGGCTGTCTGCGGATGGTGAGTGG 3307 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2941 CAGATGTATGCAGTCACAAAAGGCCTGCGCCGGTATCGGCTGTCTGCGGATGGTGAGTGG 3000 Query 3308 CTGGTGAAACAGTTGAATCTTCCTGTGGACAGGACAGAGGACGGCTGGGTCTCCCTACAA 3367 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3001 CTGGTGAAACAGTTGAATCTTCCTGTGGACAGGACAGAGGACGGCTGGGTCTCCCTACAA 3060 Query 3368 GATCTTCGAATGATCCGAAGAGAAGCTTCAAGGAAGTCACGATGGAAGAAGTGGGAGGTA 3427 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3061 GATCTTCGAATGATCCGAAGAGAAGCTTCAAGGAAGTCACGATGGAAGAAGTGGGAGGTA 3120 Query 3428 GCCTCTGAACGAGCATGGACAGGGGGCACAGAGTCAGAAATGTTTAATAAGCTGGAGAGT 3487 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3121 GCCTCTGAACGAGCATGGACAGGGGGCACAGAGTCAGAAATGTTTAATAAGCTGGAGAGT 3180 Query 3488 ATTGCCATGTCTGATACACCACGTACCCCAGTACTGGGCTGCTGCATCAGCAGAGCCTTG 3547 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3181 ATTGCCATGTCTGATACACCACGTACCCCAGTACTGGGCTGCTGCATCAGCAGAGCCTTG 3240 Query 3548 GAGCCCTCAGTTGTCCAGGGAGAGTTTATAACCAGTCGTGTGAACTGGGTGGTACAGAGC 3607 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3241 GAGCCCTCAGTTGTCCAGGGAGAGTTTATAACCAGTCGTGTGAACTGGGTGGTACAGAGC 3300 Query 3608 TCTGCTGTAGACTACTTACATCTCATGCTTGTGGCCATGAAGTGGCTGTTTGAGGAATTT 3667 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3301 TCTGCTGTAGACTACTTACATCTCATGCTTGTGGCCATGAAGTGGCTGTTTGAGGAATTT 3360 Query 3668 GCCATTGATGGGCGCTTCTGCATCAGCATCCACGACGAGGTTCGCTACCTGGTGCGTGAG 3727 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3361 GCCATTGATGGGCGCTTCTGCATCAGCATCCACGACGAGGTTCGCTACCTGGTGCGTGAG 3420 Query 3728 GAGGACCGCTACCGTGCCGCCCTGGCACTGCAGATCACCAATCTCCTGACCAGGTGCATG 3787 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3421 GAGGACCGCTACCGTGCCGCCCTGGCACTGCAGATCACCAATCTCCTGACCAGGTGCATG 3480 Query 3788 TTTGCCTATAAGCTGGGTCTGAATGATCTGCCCCAGTCAGTCGCCTTTTTCAGTGCAGTA 3847 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3481 TTTGCCTATAAGCTGGGTCTGAATGATCTGCCCCAGTCAGTCGCCTTTTTCAGTGCAGTA 3540 Query 3848 GACATTGACCAGTGCCTCAGGAAGGAAGTGACCATGGACTGTAAAACTCCTTCTAACCCA 3907 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3541 GACATTGACCAGTGCCTCAGGAAGGAAGTGACCATGGACTGTAAAACTCCTTCTAACCCA 3600 Query 3908 ACTGGGATGGAAAGGAGATATGGGATCCCCCAGGGTGAAGCACTGGATATTTACCAGATA 3967 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3601 ACTGGGATGGAAAGGAGATATGGGATCCCCCAGGGTGAAGCACTGGATATTTACCAGATA 3660 Query 3968 ATTGAACTCACCAAAGGCTCCTTGGAAAAACGAAGCCAGCCTGGACCCTAGCTCTGTCTG 4027 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3661 ATTGAACTCACCAAAGGCTCCTTGGAAAAACGAAGCCAGCCTGGACCCTAGCTCTGTCTG 3720 Query 4028 GAGGTTCTGTATTTGCTCCTGTGGAGCTTTATTGGAGCGGTGCAGGTTCCTAAACTCAGG 4087 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3721 GAGGTTCTGTATTTGCTCCTGTGGAGCTTTATTGGAGCGGTGCAGGTTCCTAAACTCAGG 3780 Query 4088 CTTTCAGATGTGCTTTTTTGCAAAAGGCAGCCATTTTTCTGTAGCAGGACCTGCCCAGGA 4147 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3781 CTTTCAGATGTGCTTTTTTGCAAAAGGCAGCCATTTTTCTGTAGCAGGACCTGCCCAGGA 3840 Query 4148 AAGTCCTCCTAACGGAAGGCACAATTCAGTGCGTTCAGAACCAGGACACCAACATCAGTG 4207 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3841 AAGTCCTCCTAACGGAAGGCACAATTCAGTGCGTTCAGAACCAGGACACCAACATCAGTG 3900 Query 4208 CAGGCTGTGTGACAAGG 4224 ||||||||||||||||| Sbjct 3901 CAGGCTGTGTGACAAGG 3917 >gb|BC061472.1| UniGene infoGeoGene info Mus musculus polymerase (DNA directed), gamma, mRNA (cDNA clone MGC:69606 IMAGE:6827238), complete cds Length=4607 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 6122 bits (3315), Expect = 0.0 Identities = 3317/3318 (99%), Gaps = 0/3318 (0%) Strand=Plus/Plus Query 87 TGCGGCTGCTCCCGAGACCGCACGCCACCCTGAGGCTGCGTGGGCCGCGCGCCGCGGACG 146 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1 TGCGGCTGCTCCCGAGACCGCACGCCACCCTGAGGCTGCGTGGGCCGCGCGCCGCGGACG 60 Query 147 CCGCGTCGTCGCCGGGGCTGTGGGCTGCCGCAGAACGGGAAGCGCGAAGCGGACCGAGGA 206 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 61 CCGCGTCGTCGCCGGGGCTGTGGGCTGCCGCAGAACGGGAAGCGCGAAGCGGACCGAGGA 120 Query 207 CTTGTGTGAGGAAGGCAGGCATGGTGAGACCTATTTCACTGACAGGAGCACAGAGAGGGG 266 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 121 CTTGTGTGAGGAAGGCAGGCATGGTGAGACCTATTTCACTGACAGGAGCACAGAGAGGGG 180 Query 267 ACGCGTCTCTCTCTGAGTCTTTCGGCCACTAAAAGCAGTCAAGCTGGAGCCCAAAGCCCG 326 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 181 ACGCGTCTCTCTCTGAGTCTTTCGGCCACTAAAAGCAGTCAAGCTGGAGCCCAAAGCCCG 240 Query 327 GTGCCCCGACTCACAGCGGGGGGCTCCCTGCACCAACCATGAGCCGCCTGCTCTGGAAGA 386 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 241 GTGCCCCGACTCACAGCGGGGGGCTCCCTGCACCAACCATGAGCCGCCTGCTCTGGAAGA 300 Query 387 AGGTGGCTGGCGCCAAGGTCGCCTCAGGGCCAGTACCAGCAACCGCGCGCTGGGTCTCCA 446 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 301 AGGTGGCTGGCGCCAAGGTCGCCTCAGGGCCAGTACCAGCAACCGCGCGCTGGGTCTCCA 360 Query 447 GCTCCGTCCTCGACCCCGTCCCCAGCGACGGGCGGCCGCCGTCGCAAATGCCCTCCTCCG 506 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 361 GCTCCGTCCTCGACCCCGTCCCCAGCGACGGGCGGCCGCCGTCGCAAATGCCCTCCTCCG 420 Query 507 AGAATGGGCAGCTGCGGCTCAACCCTCTGCTCATCCAGATGTTGTCGAGAGGCCTGCACG 566 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 421 AGAATGGGCAGCTGCGGCTCAACCCTCTGCTCATCCAGATGTTGTCGAGAGGCCTGCACG 480 Query 567 AGCAGATCTTCGGGTGCGGCGGGGAAATGCCCGACGAGGCCGCGGTGCAGCGCAGCGTAG 626 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 481 AGCAGATCTTCGGGTGCGGCGGGGAAATGCCCGACGAGGCCGCGGTGCAGCGCAGCGTAG 540 Query 627 AGCACCTGCAGAAGCACGGGCTCTGGGGGCAGCCGGCCACGCCCTTGCCAGACGTGGAGC 686 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 541 AGCACCTGCAGAAGCACGGGCTCTGGGGGCAGCCGGCCACGCCCTTGCCAGACGTGGAGC 600 Query 687 TGCGCCTGCCCCGGCTCTTCGGGGGCAACCTGGACCAGCACTTCCGCCTCCTGGCCCAGA 746 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 601 TGCGCCTGCCCCGGCTCTTCGGGGGCAACCTGGACCAGCACTTCCGCCTCCTGGCCCAGA 660 Query 747 AGCAGAGCCTGCCTTACTTGGAGGCGGCCGCCTCGTTATTGGAGGCCCAATTGCCCCCCG 806 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 661 AGCAGAGCCTGCCTTACTTGGAGGCGGCCGCCTCGTTATTGGAGGCCCAATTGCCCCCCG 720 Query 807 AGCCCAAGAGCTGGGCCTGGGCGGAGGGCTGGACCCGGTACGGCCCCGAGGGGGAGGCCG 866 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 721 AGCCCAAGAGCTGGGCCTGGGCGGAGGGCTGGACCCGGTACGGCCCCGAGGGGGAGGCCG 780 Query 867 AACCCGTGGCCATCCCCGAGGAGCGGGCCCTGGTGTTCGACGTGGAGGTCTGCTTGGCAG 926 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 781 AACCCGTGGCCATCCCCGAGGAGCGGGCCCTGGTGTTCGACGTGGAGGTCTGCTTGGCAG 840 Query 927 AGGGAACCTGCCCCACTTTGGCGGTGGCCATATCCCCCTCGGCCTGGTATTCCTGGTGCA 986 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 841 AGGGAACCTGCCCCACTTTGGCGGTGGCCATATCCCCCTCGGCCTGGTATTCCTGGTGCA 900 Query 987 GCCGGCGGCTGGTGGAAGAGCGTTACTCTTGGACCAGCCAGCTATCGCCGGCTGACCTAA 1046 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 901 GCCGGCGGCTGGTGGAAGAGCGTTACTCTTGGACCAGCCAGCTATCGCCGGCTGACCTAA 960 Query 1047 TCCCTTTGGGGGGCTCCACTAGTGCCAGCAGCTCCACCAAGCAGGATGGGCAGGAACAGT 1106 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 961 TCCCTTTGGGGGGCTCCACTAGTGCCAGCAGCTCCACCAAGCAGGATGGGCAGGAACAGT 1020 Query 1107 TAGTGGTGGGGCACAATGTTTCCTTTGACCGAGCCCATATCAGGGAACAGTATCTGATTC 1166 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1021 TAGTGGTGGGGCACAATGTTTCCTTTGACCGAGCCCATATCAGGGAACAGTATCTGATTC 1080 Query 1167 AGGACTCCCGGATGCGTTTTCTCGATACTATGAGCATGCACATGGCCATCTCGGGGCTGA 1226 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1081 AGGACTCCCGGATGCGTTTTCTCGATACTATGAGCATGCACATGGCCATCTCGGGGCTGA 1140 Query 1227 GCAGCTTCCAGCGCAGCCTGTGGATGGGAGCCAAGCAGGGAAAGCACAAGACCCAGCAGT 1286 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1141 GCAGCTTCCAGCGCAGCCTGTGGATGGGAGCCAAGCAGGGAAAGCACAAGACCCAGCAGT 1200 Query 1287 CCACAAAGCGAGGGCAGAAGTCCCCGAGGAAAGCCAATGGTCCAGCGATCTCATCTTGGG 1346 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1201 CCACAAAGCGAGGGCAGAAGTCCCCGAGGAAAGCCAATGGTCCAGCGATCTCATCTTGGG 1260 Query 1347 ACTGGATGGATATCAGCAGTGCCAATAATCTTGCAGATGTGCACAACCTTTATGTGGGGG 1406 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1261 ACTGGATGGATATCAGCAGTGCCAATAATCTTGCAGATGTGCACAACCTTTATGTGGGGG 1320 Query 1407 GACCTCCCTTAGAGAAGGAGCCTCGGGAGCTGTTCGTCAAAGGCAGCATGAGGGATATCC 1466 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1321 GACCTCCCTTAGAGAAGGAGCCTCGGGAGCTGTTCGTCAAAGGCAGCATGAGGGATATCC 1380 Query 1467 GAGAGAACTTCCAGGATCTGATGCAGTACTGCGCCCGTGATGTGTGGGCCACCTTTGAGG 1526 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1381 GAGAGAACTTCCAGGATCTGATGCAGTACTGCGCCCGTGATGTGTGGGCCACCTTTGAGG 1440 Query 1527 TTTTCCAGCAGCAGCTGCCACTCTTCTTGGAGAGGTGTCCCCACCCAGTGACTCTGGCTG 1586 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1441 TTTTCCAGCAGCAGCTGCCACTCTTCTTGGAGAGGTGTCCCCACCCAGTGACTCTGGCTG 1500 Query 1587 GCATGCTGGAGATGGGTGTGTCCTACCTGCCTGTCAACCAGAACTGGGAGCGTTACCTGA 1646 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1501 GCATGCTGGAGATGGGTGTGTCCTACCTGCCTGTCAACCAGAACTGGGAGCGTTACCTGA 1560 Query 1647 CAGAGGCACAGAACACATATGAGGAGCTCCAGCGGGAGATGAAGAAGTCGCTGATGGATC 1706 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1561 CAGAGGCACAGAACACATATGAGGAGCTCCAGCGGGAGATGAAGAAGTCGCTGATGGATC 1620 Query 1707 TGGCTAATGATGCCTGTCAGTTGCTCTCAGGAGAGAGGTACAAAGAAGACCCTTGGCTCT 1766 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1621 TGGCTAATGATGCCTGTCAGTTGCTCTCAGGAGAGAGGTACAAAGAAGACCCTTGGCTCT 1680 Query 1767 GGGACCTAGAATGGGATTTGCAGGAGTTTAAGCAGAAAAAGGCAAAGAAGGTGAAGAAGC 1826 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1681 GGGACCTAGAATGGGATTTGCAGGAGTTTAAGCAGAAAAAGGCAAAGAAGGTGAAGAAGC 1740 Query 1827 CAGCCTCAGCCAGCAAGTTGCCCATCGAGGGAGCTGGGCCCTTTGGGGATCCCATGGATC 1886 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1741 CAGCCTCAGCCAGCAAGTTGCCCATCGAGGGAGCTGGGCCCTTTGGGGATCCCATGGATC 1800 Query 1887 AGGAAGATCCTGGCCCGCCCAGCGAGGAGGAGGAGCTTCAGCGAAGTGTAACAGCCCACA 1946 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1801 AGGAAGATCCTGGCCCGCCCAGCGAGGAGGAGGAGCTTCAGCGAAGTGTAACAGCCCACA 1860 Query 1947 ACCGGTTACAGCAGCTGAGGAGCACCACGGACCTCCTGCCTAAGCGACCCCAGCACCTTC 2006 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1861 ACCGGTTACAGCAGCTGAGGAGCACCACGGACCTCCTGCCTAAGCGACCCCAGCACCTTC 1920 Query 2007 CAGGACACCCTGGGTGGTACCGGAAGCTCTGCCCTCGACTAGATGACCCTGCCTGGGCTC 2066 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1921 CAGGACACCCTGGGTGGTACCGGAAGCTCTGCCCTCGACTAGATGACCCTGCCTGGGCTC 1980 Query 2067 CCGGCCCCAGCCTCCTCAGCCTGCAAATGCGGGTCACTCCTAAGCTCATGGCACTGACCT 2126 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1981 CCGGCCCCAGCCTCCTCAGCCTGCAAATGCGGGTCACTCCTAAGCTCATGGCACTGACCT 2040 Query 2127 GGGATGGTTTTCCTCTACACTACTCAGACTCTCATGGTTGGGGCTACCTAGTGCCTGGGC 2186 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2041 GGGATGGTTTTCCTCTACACTACTCAGACTCTCATGGTTGGGGCTACCTAGTGCCTGGGC 2100 Query 2187 GTCGGGATAATCTGACCGAGCCGCCAGTGAGCCCCACTGTAGAATCCGCTGCAGTAACCT 2246 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2101 GTCGGGATAATCTGACCGAGCCGCCAGTGAGCCCCACTGTAGAATCCGCTGCAGTAACCT 2160 Query 2247 GCCCCTACAGAGCCATCGAGTCCTTATACAGGAAGCACTGCCTTGAACAGGGGAAGCAGC 2306 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2161 GCCCCTACAGAGCCATCGAGTCCTTATACAGGAAGCACTGCCTTGAACAGGGGAAGCAGC 2220 Query 2307 AATTGGAGCCCCAGGAGGTAGACCTGGCTGAGGAGTTCTTACTCACTGACAGTAGTGCCA 2366 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2221 AATTGGAGCCCCAGGAGGTAGACCTGGCTGAGGAGTTCTTACTCACTGACAGTAGTGCCA 2280 Query 2367 TGTGGCAAACGGTAGAAGAACTGGGCTGCTTAGACGTAGAGGCTGAGGCCAAGATGGAGA 2426 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2281 TGTGGCAAACGGTAGAAGAACTGGGCTGCTTAGACGTAGAGGCTGAGGCCAAGATGGAGA 2340 Query 2427 ATTCAGGGCTGAGCCAACCTCTAGTTCTGCCTGCTGCTTGTGCCCCCAAATCCAGCCAGC 2486 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2341 ATTCAGGGCTGAGCCAACCTCTAGTTCTGCCTGCTGCTTGTGCCCCCAAATCCAGCCAGC 2400 Query 2487 CCACGTATCACCATGGCAACGGACCTTATAATGATGTGAATATCCCTGGTTGCTGGTTTT 2546 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2401 CCACGTATCACCATGGCAACGGACCTTATAATGATGTGAATATCCCTGGTTGCTGGTTTT 2460 Query 2547 TCAAGCTGCCTCACAAGGACGGTAACAACTACAATGTGGGCAGTCCCTTTGCCAAAGATT 2606 |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct 2461 TCAAGCTGCCTCACAAGGACGGTAACAACTACAATGTGGGCACTCCCTTTGCCAAAGATT 2520 Query 2607 TCCTGCCCAAGATGGAGGATGGCACCCTGCAGGCTGGCCCAGGAGGTGCCAGTGGGCCTC 2666 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2521 TCCTGCCCAAGATGGAGGATGGCACCCTGCAGGCTGGCCCAGGAGGTGCCAGTGGGCCTC 2580 Query 2667 GTGCCCTGGAAATAAATAAAATGATTTCTTTTTGGAGGAATGCTCATAAACGTATCAGTT 2726 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2581 GTGCCCTGGAAATAAATAAAATGATTTCTTTTTGGAGGAATGCTCATAAACGTATCAGTT 2640 Query 2727 CCCAGATGGTGGTATGGCTCCCCAGGTCAGCTCTGCCCCGGGTTGTGACCAGGCACCCCA 2786 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2641 CCCAGATGGTGGTATGGCTCCCCAGGTCAGCTCTGCCCCGGGTTGTGACCAGGCACCCCA 2700 Query 2787 GCTTCGATGAGGAAGGCCACTATGGGGCCATCCTACCCCAGGTGGTGACTGCTGGCACCA 2846 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2701 GCTTCGATGAGGAAGGCCACTATGGGGCCATCCTACCCCAGGTGGTGACTGCTGGCACCA 2760 Query 2847 TCACCCGTCGAGCTGTGGAGCCCACGTGGCTCACTGCCAGTAATGCTCGGCCTGACCGGG 2906 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2761 TCACCCGTCGAGCTGTGGAGCCCACGTGGCTCACTGCCAGTAATGCTCGGCCTGACCGGG 2820 Query 2907 TAGGCAGTGAGTTGAAAGCCATGGTGCAGGCTCCACCTGGCTATGTCCTTGTGGGTGCTG 2966 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2821 TAGGCAGTGAGTTGAAAGCCATGGTGCAGGCTCCACCTGGCTATGTCCTTGTGGGTGCTG 2880 Query 2967 ATGTGGACTCACAGGAACTGTGGATCGCAGCTGTACTTGGAGATGCTCACTTTGCTGGGA 3026 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2881 ATGTGGACTCACAGGAACTGTGGATCGCAGCTGTACTTGGAGATGCTCACTTTGCTGGGA 2940 Query 3027 TGCATGGCTGCACGGCCTTTGGCTGGATGACTCTGCAGGGCAGGAAGAGCAGAGGCACTG 3086 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2941 TGCATGGCTGCACGGCCTTTGGCTGGATGACTCTGCAGGGCAGGAAGAGCAGAGGCACTG 3000 Query 3087 ATCTGCACAGCAAGACAGCTGCCACTGTGGGCATCAGCCGAGAGCATGCCAAAATCTTCA 3146 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3001 ATCTGCACAGCAAGACAGCTGCCACTGTGGGCATCAGCCGAGAGCATGCCAAAATCTTCA 3060 Query 3147 ACTATGGCCGCATCTATGGGGCTGGGCAGTCCTTTGCTGAGCGCCTACTGATGCAGTTCA 3206 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3061 ACTATGGCCGCATCTATGGGGCTGGGCAGTCCTTTGCTGAGCGCCTACTGATGCAGTTCA 3120 Query 3207 ACCACAGGCTCACAAGGCAGGAGGCAGCTGAGAAGGCCCAGCAGATGTATGCAGTCACAA 3266 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3121 ACCACAGGCTCACAAGGCAGGAGGCAGCTGAGAAGGCCCAGCAGATGTATGCAGTCACAA 3180 Query 3267 AAGGCCTGCGCCGGTATCGGCTGTCTGCGGATGGTGAGTGGCTGGTGAAACAGTTGAATC 3326 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3181 AAGGCCTGCGCCGGTATCGGCTGTCTGCGGATGGTGAGTGGCTGGTGAAACAGTTGAATC 3240 Query 3327 TTCCTGTGGACAGGACAGAGGACGGCTGGGTCTCCCTACAAGATCTTCGAATGATCCGAA 3386 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3241 TTCCTGTGGACAGGACAGAGGACGGCTGGGTCTCCCTACAAGATCTTCGAATGATCCGAA 3300 Query 3387 GAGAAGCTTCAAGGAAGT 3404 |||||||||||||||||| Sbjct 3301 GAGAAGCTTCAAGGAAGT 3318 Score = 2206 bits (1194), Expect = 0.0 Identities = 1194/1194 (100%), Gaps = 0/1194 (0%) Strand=Plus/Plus Query 3403 GTCACGATGGAAGAAGTGGGAGGTAGCCTCTGAACGAGCATGGACAGGGGGCACAGAGTC 3462 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3395 GTCACGATGGAAGAAGTGGGAGGTAGCCTCTGAACGAGCATGGACAGGGGGCACAGAGTC 3454 Query 3463 AGAAATGTTTAATAAGCTGGAGAGTATTGCCATGTCTGATACACCACGTACCCCAGTACT 3522 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3455 AGAAATGTTTAATAAGCTGGAGAGTATTGCCATGTCTGATACACCACGTACCCCAGTACT 3514 Query 3523 GGGCTGCTGCATCAGCAGAGCCTTGGAGCCCTCAGTTGTCCAGGGAGAGTTTATAACCAG 3582 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3515 GGGCTGCTGCATCAGCAGAGCCTTGGAGCCCTCAGTTGTCCAGGGAGAGTTTATAACCAG 3574 Query 3583 TCGTGTGAACTGGGTGGTACAGAGCTCTGCTGTAGACTACTTACATCTCATGCTTGTGGC 3642 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3575 TCGTGTGAACTGGGTGGTACAGAGCTCTGCTGTAGACTACTTACATCTCATGCTTGTGGC 3634 Query 3643 CATGAAGTGGCTGTTTGAGGAATTTGCCATTGATGGGCGCTTCTGCATCAGCATCCACGA 3702 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3635 CATGAAGTGGCTGTTTGAGGAATTTGCCATTGATGGGCGCTTCTGCATCAGCATCCACGA 3694 Query 3703 CGAGGTTCGCTACCTGGTGCGTGAGGAGGACCGCTACCGTGCCGCCCTGGCACTGCAGAT 3762 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3695 CGAGGTTCGCTACCTGGTGCGTGAGGAGGACCGCTACCGTGCCGCCCTGGCACTGCAGAT 3754 Query 3763 CACCAATCTCCTGACCAGGTGCATGTTTGCCTATAAGCTGGGTCTGAATGATCTGCCCCA 3822 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3755 CACCAATCTCCTGACCAGGTGCATGTTTGCCTATAAGCTGGGTCTGAATGATCTGCCCCA 3814 Query 3823 GTCAGTCGCCTTTTTCAGTGCAGTAGACATTGACCAGTGCCTCAGGAAGGAAGTGACCAT 3882 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3815 GTCAGTCGCCTTTTTCAGTGCAGTAGACATTGACCAGTGCCTCAGGAAGGAAGTGACCAT 3874 Query 3883 GGACTGTAAAACTCCTTCTAACCCAACTGGGATGGAAAGGAGATATGGGATCCCCCAGGG 3942 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3875 GGACTGTAAAACTCCTTCTAACCCAACTGGGATGGAAAGGAGATATGGGATCCCCCAGGG 3934 Query 3943 TGAAGCACTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACGAAG 4002 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3935 TGAAGCACTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACGAAG 3994 Query 4003 CCAGCCTGGACCCTAGCTCTGTCTGGAGGTTCTGTATTTGCTCCTGTGGAGCTTTATTGG 4062 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3995 CCAGCCTGGACCCTAGCTCTGTCTGGAGGTTCTGTATTTGCTCCTGTGGAGCTTTATTGG 4054 Query 4063 AGCGGTGCAGGTTCCTAAACTCAGGCTTTCAGATGTGCTTTTTTGCAAAAGGCAGCCATT 4122 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4055 AGCGGTGCAGGTTCCTAAACTCAGGCTTTCAGATGTGCTTTTTTGCAAAAGGCAGCCATT 4114 Query 4123 TTTCTGTAGCAGGACCTGCCCAGGAAAGTCCTCCTAACGGAAGGCACAATTCAGTGCGTT 4182 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4115 TTTCTGTAGCAGGACCTGCCCAGGAAAGTCCTCCTAACGGAAGGCACAATTCAGTGCGTT 4174 Query 4183 CAGAACCAGGACACCAACATCAGTGCAGGCTGTGTGACAAGGGGTACTGTTGGGCACAAA 4242 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4175 CAGAACCAGGACACCAACATCAGTGCAGGCTGTGTGACAAGGGGTACTGTTGGGCACAAA 4234 Query 4243 TGAAGCAGATGCCCCAAAGGTCACATTAACTCAGGCATTTCTTCCTCCTCTTCTTGGCTG 4302 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4235 TGAAGCAGATGCCCCAAAGGTCACATTAACTCAGGCATTTCTTCCTCCTCTTCTTGGCTG 4294 Query 4303 GTTCTCTGTCCTGCTGTGTATGTGCTGATGCAGTGCCCTAGAAGGGGAGAGTAGAAATTT 4362 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4295 GTTCTCTGTCCTGCTGTGTATGTGCTGATGCAGTGCCCTAGAAGGGGAGAGTAGAAATTT 4354 Query 4363 TGACAACCTTGTTCTAAGGTGATGGGAATAAAAACAAACACCAAACTCCTGGAACAGTTG 4422 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4355 TGACAACCTTGTTCTAAGGTGATGGGAATAAAAACAAACACCAAACTCCTGGAACAGTTG 4414 Query 4423 TGCTTTCCCGTCTGCTGCCCAGGTTGTGACTTAGAACTCCGTCCTGAGTAGATGGACGAG 4482 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4415 TGCTTTCCCGTCTGCTGCCCAGGTTGTGACTTAGAACTCCGTCCTGAGTAGATGGACGAG 4474 Query 4483 ATGCTGGGAGCCCGGAGCATCACAGCTACAGACGGCCTGGGGCACAGTGATGTACGGAAC 4542 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4475 ATGCTGGGAGCCCGGAGCATCACAGCTACAGACGGCCTGGGGCACAGTGATGTACGGAAC 4534 Query 4543 TCCGCATCAGCCGGCTAGCCAGATTATTTTATATAAATGTCTAATTTTGACTGG 4596 |||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4535 TCCGCATCAGCCGGCTAGCCAGATTATTTTATATAAATGTCTAATTTTGACTGG 4588 >emb|AJ245646.1|RNO245646 UniGene infoGeoGene info Rattus norvegicus mRNA for DNA polymerase gamma (MIP1 gene) Length=3651 Score = 5614 bits (3040), Expect = 0.0 Identities = 3456/3660 (94%), Gaps = 15/3660 (0%) Strand=Plus/Plus Query 365 ATGAGCCGCCTGCTCTGGAAGAAGGTGGCTGGCGCCAAGGTCGCCTCAGGGCCAGTACCA 424 ||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| Sbjct 1 ATGAGCCGCCTGCTCTGGAAGAAGGTGGCCGGCGCCAAAGTCGCCTCAGGGCCAGTACCA 60 Query 425 GCAACCGCG-CGCTGGGTCTCCAGCTCCGTCCTCGACCCCGTCCCCAGCGACGGGCGGCC 483 ||||| | | |||||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct 61 GCAACAG-GACGCTGGGTCTCCAGCTCCGTCCTCGACCCCGTCCCCAGCGACGGGCAGCC 119 Query 484 GCCGTCGCAAATGCCCTCCTCCGAGAATGGGCAGCTGCGGCTCAACCCTCTGCTCATCCA 543 || |||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| Sbjct 120 GCAGTCGCAAATGCCCTCCTCAGAGAATGGGCAGCTGCGGCTCAACCCTCTGCACATCCA 179 Query 544 GATGTTGTCGAGAGGCCTGCACGAGCAGATCTTCGGGTGCGGCGGGGAAATGCCCGACGA 603 |||| |||||||||||||||||||||| |||||||||||||| ||||| |||||||||| Sbjct 180 GATGCTGTCGAGAGGCCTGCACGAGCAAATCTTCGGGTGCGGAGGGGACGTGCCCGACGA 239 Query 604 GGCCGCGGTGCAGCGCAGCGTAGAGCACCTGCAGAAGCACGGGCTCTGGGGGCAGCCGGC 663 ||||||||||||||||||| | |||||||| | ||||||||||||||||||||||||| | Sbjct 240 GGCCGCGGTGCAGCGCAGCATCGAGCACCTACGGAAGCACGGGCTCTGGGGGCAGCCGAC 299 Query 664 CACGCCCTTGCCAGACGTGGAGCTGCGCCTGCCCCGGCTCTTCGGGGGCAACCTGGACCA 723 ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| Sbjct 300 CACGCCCTTGCCAGACGTGCAGCTGCGCCTGCCCCGGCTCTTCGGGGGCAACCTGGACCA 359 Query 724 GCACTTCCGCCTCCTGGCCCAGAAGCAGAGCCTGCCTTACTTGGAGGCGGCCGCCTCGTT 783 ||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||| Sbjct 360 GCACTTCCGCCTCCTGGCCCAGAAGCAGAGCCTCCCGTACTTGGAGGCGGCCGCCTCGTT 419 Query 784 ATTGGAGGCCCAATTGCCCCCCGAGCCCAAGA-GCTGGGCCTGGGCGGAGGGCTGGACCC 842 || ||||||||||||||||||| |||||| || | |||| |||||||||||||||||||| Sbjct 420 ATCGGAGGCCCAATTGCCCCCCCAGCCCAGGAAG-TGGGTCTGGGCGGAGGGCTGGACCC 478 Query 843 GGTACGGCCCCGAGGGGGAGGCCGAACCCGTGGCCATCCCCGAGGAGCGGGCCCTGGTGT 902 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 479 GGTACGGCCCCGAGGGGGAGGCCGAACCCGTGGCCATCCCCGAGGAGCGGGCCCTGGTGT 538 Query 903 TCGACGTGGAGGTCTGCTTGGCAGAGGGAACCTGCCCCACTTTGGCGGTGGCCATATCCC 962 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 539 TCGACGTGGAGGTCTGCTTGGCAGAGGGAACCTGCCCCACTTTGGCGGTGGCCATATCCC 598 Query 963 CCTCGGCCTGGTATTCCTGGTGCAGCCGGCGGCTGGTGGAAGAGCGTTACTCTTGGACCA 1022 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 599 CCTCGGCCTGGTATTCCTGGTGCAGCCGGCGGCTGGTGGAAGAGCGTTACTCTTGGACCA 658 Query 1023 GCCAGCTATCGCCGGCTGACCTAATCCCTTTGGGGGGCTCCACTAGTGCCAGCAGCTCCA 1082 ||||||| |||||||||||||||||||||||||||| ||| |||||||||||||||||| Sbjct 659 GCCAGCTGTCGCCGGCTGACCTAATCCCTTTGGGGGTCTCTGCTAGTGCCAGCAGCTCCA 718 Query 1083 CCAAGCAGGATGGGCAGGAACAGTTAGTGGTGGGGCACAATGTTTCCTTTGACCGAGCCC 1142 || |||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 719 CCCAGCAGGATTGGCAGGAACAGTTAGTGGTGGGGCACAATGTTTCCTTTGACCGAGCCC 778 Query 1143 ATATCAGGGAACAGTATCTGATTCAGGACTCCCGGATGCGTTTTCTCGATACTATGAGCA 1202 |||||||||| |||||||||||||||| ||| || ||||| ||||| || |||||||||| Sbjct 779 ATATCAGGGAGCAGTATCTGATTCAGGGCTCACGCATGCGCTTTCTGGACACTATGAGCA 838 Query 1203 TGCACATGGCCATCTCGGGGCTGAGCAGCTTCCAGCGCAGCCTGTGGATGGGAGCCAAGC 1262 |||||||||| ||||| ||||||||||||||||||||||| ||||||||||||||||||| Sbjct 839 TGCACATGGCTATCTCAGGGCTGAGCAGCTTCCAGCGCAGTCTGTGGATGGGAGCCAAGC 898 Query 1263 AGGGAAAGCACAAGACCCAGCAGTCC-ACAAAGCGAGGGCAGAAGTCCCCGAGGAAAGCC 1321 |||| ||||||||||||||||| ||| ||||||||||| |||||||||| || ||| || Sbjct 899 AGGGCAAGCACAAGACCCAGCA-TCCTACAAAGCGAGGTCAGAAGTCCCAGAAGAATGCG 957 Query 1322 AATGGTCCAGCGATCTCATCTTGGGACTGGATGGATATCAGCAGTGCCAATAATCTTGCA 1381 |||||||||||||| |||||||||||||||||||| ||||||||||| |||||||||||| Sbjct 958 AATGGTCCAGCGATTTCATCTTGGGACTGGATGGACATCAGCAGTGCTAATAATCTTGCA 1017 Query 1382 GATGTGCACAACCTTTATGTGGGGGGACCTCCCTTAGAGAAGGAGCCTCGGGAGCTGTTC 1441 || |||||||||||||||||||||||||||| ||||| ||||||||||||||| |||||| Sbjct 1018 GACGTGCACAACCTTTATGTGGGGGGACCTCGCTTAGCGAAGGAGCCTCGGGAACTGTTC 1077 Query 1442 GTCAAAGGCAGCATGAGGGATATCCGAGAGAACTTCCAGGATCTGATGCAGTACTGCGCC 1501 |||||||||||||||||||||||| | ||||||||||||||||||||| ||||||| || Sbjct 1078 GTCAAAGGCAGCATGAGGGATATCAGGGAGAACTTCCAGGATCTGATGGAGTACTGTGCT 1137 Query 1502 CGTGATGTGTGGGCCACCTTTGAGGTTTTCCAGCAGCAGCTGCCACTCTTCTTGGAGAGG 1561 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct 1138 CGTGATGTGTGGGCCACCTTTGAGGTTTTCCAGCAGCAGCTGCCGCTCTTCTTGGAGAGG 1197 Query 1562 TGTCCCCACCCAGTGACTCTGGCTGGCATGCTGGAGATGGGTGTGTCCTACCTGCCTGTC 1621 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct 1198 TGTCCCCACCCAGTGACTCTGGCTGGCATGCTGGAGATGGGTGTCTCCTACCTGCCTGTC 1257 Query 1622 AACCAGAACTGGGAGCGTTACCTGACAGAGGCACAGAACACATATGAGGAGCTCCAGCGG 1681 ||||||||||||||||| ||||||||||||||||||| |||||||||||| ||||||||| Sbjct 1258 AACCAGAACTGGGAGCGGTACCTGACAGAGGCACAGAGCACATATGAGGAACTCCAGCGG 1317 Query 1682 GAGATGAAGAAGTCGCTGATGGATCTGGCTAATGATGCCTGTCAGTTGCTCTCAGGAGAG 1741 ||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||| Sbjct 1318 GAGATGAAGAAGTCGCTGATGGAGCTGGCTAATGATGCCTGCCAGTTGCTCTCAGGAGAG 1377 Query 1742 AGGTACAAAGAAGACCCTTGGCTCTGGGACCTAGAATGGGATTTGCAGGAGTTTAAGCAG 1801 ||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||| Sbjct 1378 AGGTACAAAGAAGACCCTTGGCTCTGGGACCTAGAATGGGACTTGCAGGAATTTAAGCAG 1437 Query 1802 AAAAAGGCAAAGAAGGTGAAGAAGCCAGCCTCAGCCAGCAAGTTGCCCATCGAGGGAGCT 1861 |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct 1438 AAAAAGGCAAAGAAGGTGAAGAAGACAGCCTCAGCCAGCAAGTTGCCCATCGAGGGAGCT 1497 Query 1862 GGGCCCTTTGGGGATCCCATGGATCAGGAAGATCCTGGCCCGCCCAGCGAGGAGGAGGAG 1921 |||||||||||||||||||||||||||||||||||||| || ||||| |||||||||||| Sbjct 1498 GGGCCCTTTGGGGATCCCATGGATCAGGAAGATCCTGGACCACCCAGTGAGGAGGAGGAG 1557 Query 1922 CTTCAGCGAAGTGTAACAGCCCACAACCGGTTACAGCAGCTGAGGAGCACCACGGACCTC 1981 ||||||| || | ||| ||||||| ||| ||||||||||||| ||||||||| |||||| Sbjct 1558 CTTCAGCAAAATATAATGGCCCACACCCGTTTACAGCAGCTGAAGAGCACCACAGACCTC 1617 Query 1982 CTGCCTAAGCGACCCCAGCACCTTCCAGGACACCCTGGGTGGTACCGGAAGCTCTGCCCT 2041 ||||||||||||||||| |||||||| ||||||||||||||||||||||| ||||||||| Sbjct 1618 CTGCCTAAGCGACCCCAACACCTTCCTGGACACCCTGGGTGGTACCGGAAACTCTGCCCT 1677 Query 2042 CGACTAGATGACCCTGCCTGGGCTCCCGGCCCCAGCCTCCTCAGCCTGCAAATGCGGGTC 2101 || |||||||||||||| ||| |||| ||||||||||||||||||||||||||||||||| Sbjct 1678 CGGCTAGATGACCCTGCATGGACTCCGGGCCCCAGCCTCCTCAGCCTGCAAATGCGGGTC 1737 Query 2102 ACTCCTAAGCTCATGGCACTGACCTGGGATGGTTTTCCTCTACACTACTCAGACTCTCAT 2161 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1738 ACTCCTAAGCTCATGGCACTGACCTGGGATGGTTTTCCTCTACACTACTCAGACTCTCAT 1797 Query 2162 GGTTGGGGCTACCTAGTGCCTGGGCGTCGGGATAATCTGACCGAGCCGCCAGTGAGCCCC 2221 |||||||||||||| ||||||||||| |||||||||||||| |||| ||||||||||||| Sbjct 1798 GGTTGGGGCTACCTGGTGCCTGGGCGGCGGGATAATCTGACTGAGCTGCCAGTGAGCCCC 1857 Query 2222 ACTGTAGAA-TCCGCTGCAGTAACCTGCCCCTACAGAGCCATCGAGTCCTTATACAGGAA 2280 |||| || | || ||||| || ||||||||||||||||||||||||||||| ||||||| Sbjct 1858 ACTG-AGGAGTCAGCTGCGGTGACCTGCCCCTACAGAGCCATCGAGTCCTTGTACAGGAG 1916 Query 2281 GCACTGCCTTGAACAGGGGAAGCAGCAATTGGAGCCCCAGGAGGTAGACCTGGCTGAGGA 2340 |||||| ||||| ||||| |||||||| ||||| |||||||| ||||||||||||||| Sbjct 1917 GCACTGTCTTGACCAGGGCAAGCAGCAGCTGGAGACCCAGGAGACAGACCTGGCTGAGGA 1976 Query 2341 GTTCTTACTCACTGACAGTAGTGCCATGTGGCAAACGGTAGAAGAACTGGGCTGCTTAGA 2400 |||||| ||||| |||||| | |||||||||| |||||||||||||||||||||||||| Sbjct 1977 GTTCTTGCTCACGGACAGT-G--CCATGTGGCAGACGGTAGAAGAACTGGGCTGCTTAGA 2033 Query 2401 CGTAGAGGCTGAGGCCA-AGATGGAGAATTCAGGGCTGAGCCAACCTCTAGTTCTGCCTG 2459 || ||||||||||||| || |||||| |||||||||||| || || ||||||| |||| Sbjct 2034 TGTGGAGGCTGAGGCCACAG-TGGAGAGTTCAGGGCTGAGTCAGCCCCTAGTTCCGCCTA 2092 Query 2460 CTGCTTGTGCCCCCAAATCCAGCCAGCCCACGTATCACCATGGCAACGGACCTTATAATG 2519 ||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||| Sbjct 2093 CTGCTTGTGCCCCCAAAACCAGCCAGCCCACTTATCACCATGGCAACGGACCTTATAATG 2152 Query 2520 ATGTGAATATCCCTGGTTGCTGGTTTTTCAAGCTGCCTCACAAGGACGGTAACAACTACA 2579 ||||| ||||||| |||||||||||||||||||||||||||||||| ||||||||||||| Sbjct 2153 ATGTGGATATCCCCGGTTGCTGGTTTTTCAAGCTGCCTCACAAGGATGGTAACAACTACA 2212 Query 2580 ATGTGGGCAGTCCCTTTGCCAAAGATTTCCTGCCCAAGATGGAGGATGGCACCCTGCAGG 2639 ||||||| ||||||||||||||||||||||||||||||||||| || ||||| ||||||| Sbjct 2213 ATGTGGGTAGTCCCTTTGCCAAAGATTTCCTGCCCAAGATGGAAGACGGCACTCTGCAGG 2272 Query 2640 CTGGCCCAGGAGGTGCCAGTGGG-CCTCGTGCCCTGGAAATAAATAAAATGATTTCTTTT 2698 |||||||||| |||||||| ||| |||||||||||||||||||||||||||||||||||| Sbjct 2273 CTGGCCCAGGGGGTGCCAG-GGGACCTCGTGCCCTGGAAATAAATAAAATGATTTCTTTT 2331 Query 2699 TGGAGGAATGCTCATAAACGTATCAGTTCCCAGATGGTGGTATGGCTCCCCAGGTCAGCT 2758 |||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| Sbjct 2332 TGGAGGAATGCTCATAAACGCATCAGCTCCCAGATGGTGGTATGGCTCCCCAGGTCAGCT 2391 Query 2759 CTGCCCCGGGTTGTGACCAGGCACCCCAGCTTCGATGAGGAAGGCCACTATGGGGCCATC 2818 |||||||||| ||||||||||||||||||||| ||||||||| ||||||||||||||||| Sbjct 2392 CTGCCCCGGGCTGTGACCAGGCACCCCAGCTTTGATGAGGAAAGCCACTATGGGGCCATC 2451 Query 2819 CTACCCCAGGTGGTGACTGCTGGCACCATCACCCGTCGAGCTGTGGAGCCCACGTGGCTC 2878 || ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| Sbjct 2452 CTGCCCCAGGTGGTGACTGCTGGCACCATCACCCGTCGCGCTGTGGAGCCCACGTGGCTC 2511 Query 2879 ACTGCCAGTAATGCTCGGCCTGACCGGGTAGGCAGTGAGTTGAAAGCCATGGTGCAGGCT 2938 |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2512 ACTGCCAGCAATGCTCGGCCTGACCGGGTAGGCAGTGAGTTGAAAGCCATGGTGCAGGCT 2571 Query 2939 CCACCTGGCTATGTCCTTGTGGGTGCTGATGTGGACTCACAGGAACTGTGGATCGCAGCT 2998 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2572 CCACCTGGCTATGTCCTTGTGGGTGCTGATGTGGACTCACAGGAACTGTGGATCGCAGCC 2631 Query 2999 GTACTTGGAGATGCTCACTTTGCTGGGATGCATGGCTGCACGGCCTTTGGCTGGATGACT 3058 || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2632 GTTCTTGGAGATGCTCACTTTGCTGGGATGCATGGCTGCACGGCCTTTGGCTGGATGACT 2691 Query 3059 CTGCAGGGCAGGAAGAGCAGAGGCACTGATCTGCACAGCAAGACAGCTGCCACTGTGGGC 3118 || ||||||||||||||||||||||||||||||||||| |||||||| |||||||||||| Sbjct 2692 CTTCAGGGCAGGAAGAGCAGAGGCACTGATCTGCACAGTAAGACAGCCGCCACTGTGGGC 2751 Query 3119 ATCAGCCGAGAGCATGCCAAAATCTTCAACTATGGCCGCATCTATGGGGCTGGGCAGTCC 3178 ||||| || ||||| |||||| |||||||||| ||||||||||| ||||||||||||||| Sbjct 2752 ATCAGTCGTGAGCACGCCAAAGTCTTCAACTACGGCCGCATCTACGGGGCTGGGCAGTCC 2811 Query 3179 TTTGCTGAGCGCCTACTGATGCAGTTCAACCACAGGCTCACAAGGCAGGAGGCAGCTGAG 3238 ||||| |||||||| |||||||||||||||||||||||| ||||||||||||||||||| Sbjct 2812 TTTGCCGAGCGCCTGCTGATGCAGTTCAACCACAGGCTCTCAAGGCAGGAGGCAGCTGAC 2871 Query 3239 AAGGCCCAGCAGATGTATGCAGTCACAAAAGGCCTGCGCCGGTATCGGCTGTCTGCGGAT 3298 ||||||||||||||||| || ||||| |||||||||||||| || ||||| || | ||| Sbjct 2872 AAGGCCCAGCAGATGTACGCTGTCACGAAAGGCCTGCGCCGATACCGGCTCTCAGATGAT 2931 Query 3299 GGTGAGTGGCTGGTGAAACAGTTGAATCTTCCTGTGGACAGGACAGAGGACGGCTGGGTC 3358 ||||| ||||||||||||||||| ||| ||||||||||||||||||| ||||||||||| Sbjct 2932 GGTGAATGGCTGGTGAAACAGTTAAATGTTCCTGTGGACAGGACAGAAGACGGCTGGGTT 2991 Query 3359 TCCCTACAAGATCTTCGAATGATCCGAAGAGAAGCTTCAAGGAAGTCACGATGGAAGAAG 3418 ||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||| Sbjct 2992 TCCCTACAAGATCTTCGAAAGATCCGAAGAGAAGCTTCAAGGAAGTCTCGATGGAAGAAG 3051 Query 3419 TGGGAGGTAGCCTCTGAACGAGCATGGACAGGGGGCACAGAGTCAGAAATGTTTAATAAG 3478 |||||||||| | |||||||||||||||||||||| || ||||||||||||||||||||| Sbjct 3052 TGGGAGGTAGTCACTGAACGAGCATGGACAGGGGGTACGGAGTCAGAAATGTTTAATAAG 3111 Query 3479 CTGGAGAGTATTGCCATGTCTGATACACCACGTACCCCAGTACTGGGCTGCTGCATCAGC 3538 |||||||| |||||||||||||| |||||||| |||||||| |||||||||||||||||| Sbjct 3112 CTGGAGAGCATTGCCATGTCTGACACACCACGCACCCCAGTGCTGGGCTGCTGCATCAGC 3171 Query 3539 AGAGCCTTGGAGCCCTCAGTTGTCCAGGGAGAGTTTATAACCAGTCGTGTGAACTGGGTG 3598 ||||||||||||||||| |||||||||||||||||||| |||||||||||||| |||||| Sbjct 3172 AGAGCCTTGGAGCCCTCGGTTGTCCAGGGAGAGTTTATGACCAGTCGTGTGAATTGGGTG 3231 Query 3599 GTACAGAGCTCTGCTGTAGACTACTTACATCTCATGCTTGTGGCCATGAAGTGGCTGTTT 3658 ||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||| Sbjct 3232 GTACAGAGCTCTGCTGTGGACTACTTACACCTCATGCTTGTGGCCATGAAGTGGCTGTTT 3291 Query 3659 GAGGAATTTGCCATTGATGGGCGCTTCTGCATCAGCATCCACGACGAGGTTCGCTACCTG 3718 ||||||||||||||||||||||||||||||||||||||||| || ||||| ||||||||| Sbjct 3292 GAGGAATTTGCCATTGATGGGCGCTTCTGCATCAGCATCCATGATGAGGTGCGCTACCTG 3351 Query 3719 GTGCGTGAGGAGGACCGCTACCGTGCCGCCCTGGCACTGCAGATCACCAATCTCCTGACC 3778 || ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| Sbjct 3352 GTACGTGAGGAGGACCGCTACCGTGCTGCCCTGGCACTGCAGATCACCAATCTCCTGACC 3411 Query 3779 AGGTGCATGTTTGCCTATAAGCTGGGTCTGAATGATCTGCCCCAGTCAGTCGCCTTTTTC 3838 ||||||||||||||||| ||||||||||||||||| |||||||||||||| ||||||||| Sbjct 3412 AGGTGCATGTTTGCCTACAAGCTGGGTCTGAATGACCTGCCCCAGTCAGTTGCCTTTTTC 3471 Query 3839 AGTGCAGTAGACATTGACCAGTGCCTCAGGAAGGAAGTGACCATGGACTGTAAAACTCCT 3898 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3472 AGTGCAGTAGACATTGACCAGTGCCTCAGGAAGGAAGTGACCATGGACTGTAAAACTCCT 3531 Query 3899 TCTAACCCAACTGGGATGGAAAGGAGATATGGGATCCCCCAGGGTGAAGCACTGGATATT 3958 ||||||||||||||||||||||||| ||| ||||| |||||||||||||||||||||||| Sbjct 3532 TCTAACCCAACTGGGATGGAAAGGAAATACGGGATTCCCCAGGGTGAAGCACTGGATATT 3591 Query 3959 TACCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACGAAGCCAGCCTGGACCCTAG 4018 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3592 TACCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACGAAGCCAGCCTGGACCCTAG 3651 >ref|NM_053528.1| UniGene infoGeoGene info Rattus norvegicus polymerase (DNA directed), gamma (Polg), mRNA emb|AJ245647.1|RNO245647 UniGene infoGene info Rattus norvegicus mRNA for DNA polymerase gamma, isolated from Novikoff hepatoma cell line (MIP1 gene) Length=3651 Score = 5609 bits (3037), Expect = 0.0 Identities = 3455/3660 (94%), Gaps = 15/3660 (0%) Strand=Plus/Plus Query 365 ATGAGCCGCCTGCTCTGGAAGAAGGTGGCTGGCGCCAAGGTCGCCTCAGGGCCAGTACCA 424 ||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| Sbjct 1 ATGAGCCGCCTGCTCTGGAAGAAGGTGGCCGGCGCCAAAGTCGCCTCAGGGCCAGTACCA 60 Query 425 GCAACCGCG-CGCTGGGTCTCCAGCTCCGTCCTCGACCCCGTCCCCAGCGACGGGCGGCC 483 ||||| | | |||||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct 61 GCAACAG-GACGCTGGGTCTCCAGCTCCGTCCTCGACCCCGTCCCCAGCGACGGGCAGCC 119 Query 484 GCCGTCGCAAATGCCCTCCTCCGAGAATGGGCAGCTGCGGCTCAACCCTCTGCTCATCCA 543 || |||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| Sbjct 120 GCAGTCGCAAATGCCCTCCTCAGAGAATGGGCAGCTGCGGCTCAACCCTCTGCACATCCA 179 Query 544 GATGTTGTCGAGAGGCCTGCACGAGCAGATCTTCGGGTGCGGCGGGGAAATGCCCGACGA 603 |||| |||||||||||||||||||||| |||||||||||||| ||||| |||||||||| Sbjct 180 GATGCTGTCGAGAGGCCTGCACGAGCAAATCTTCGGGTGCGGAGGGGACGTGCCCGACGA 239 Query 604 GGCCGCGGTGCAGCGCAGCGTAGAGCACCTGCAGAAGCACGGGCTCTGGGGGCAGCCGGC 663 ||||||||||||||||||| | |||||||| | ||||||||||||||||||||||||| | Sbjct 240 GGCCGCGGTGCAGCGCAGCATCGAGCACCTACGGAAGCACGGGCTCTGGGGGCAGCCGAC 299 Query 664 CACGCCCTTGCCAGACGTGGAGCTGCGCCTGCCCCGGCTCTTCGGGGGCAACCTGGACCA 723 ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| Sbjct 300 CACGCCCTTGCCAGACGTGCAGCTGCGCCTGCCCCGGCTCTTCGGGGGCAACCTGGACCA 359 Query 724 GCACTTCCGCCTCCTGGCCCAGAAGCAGAGCCTGCCTTACTTGGAGGCGGCCGCCTCGTT 783 ||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||| Sbjct 360 GCACTTCCGCCTCCTGGCCCAGAAGCAGAGCCTCCCGTACTTGGAGGCGGCCGCCTCGTT 419 Query 784 ATTGGAGGCCCAATTGCCCCCCGAGCCCAAGA-GCTGGGCCTGGGCGGAGGGCTGGACCC 842 || ||||||||||||||||||| |||||| || | |||| |||||||||||||||||||| Sbjct 420 ATCGGAGGCCCAATTGCCCCCCCAGCCCAGGAAG-TGGGTCTGGGCGGAGGGCTGGACCC 478 Query 843 GGTACGGCCCCGAGGGGGAGGCCGAACCCGTGGCCATCCCCGAGGAGCGGGCCCTGGTGT 902 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 479 GGTACGGCCCCGAGGGGGAGGCCGAACCCGTGGCCATCCCCGAGGAGCGGGCCCTGGTGT 538 Query 903 TCGACGTGGAGGTCTGCTTGGCAGAGGGAACCTGCCCCACTTTGGCGGTGGCCATATCCC 962 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 539 TCGACGTGGAGGTCTGCTTGGCAGAGGGAACCTGCCCCACTTTGGCGGTGGCCATATCCC 598 Query 963 CCTCGGCCTGGTATTCCTGGTGCAGCCGGCGGCTGGTGGAAGAGCGTTACTCTTGGACCA 1022 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 599 CCTCGGCCTGGTATTCCTGGTGCAGCCGGCGGCTGGTGGAAGAGCGTTACTCTTGGACCA 658 Query 1023 GCCAGCTATCGCCGGCTGACCTAATCCCTTTGGGGGGCTCCACTAGTGCCAGCAGCTCCA 1082 ||||||| |||||||||||||||||||||||||||| ||| |||||||||||||||||| Sbjct 659 GCCAGCTGTCGCCGGCTGACCTAATCCCTTTGGGGGTCTCTGCTAGTGCCAGCAGCTCCA 718 Query 1083 CCAAGCAGGATGGGCAGGAACAGTTAGTGGTGGGGCACAATGTTTCCTTTGACCGAGCCC 1142 || |||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 719 CCCAGCAGGATTGGCAGGAACAGTTAGTGGTGGGGCACAATGTTTCCTTTGACCGAGCCC 778 Query 1143 ATATCAGGGAACAGTATCTGATTCAGGACTCCCGGATGCGTTTTCTCGATACTATGAGCA 1202 |||||||||| |||||||||||||||| ||| || |||| ||||| || |||||||||| Sbjct 779 ATATCAGGGAGCAGTATCTGATTCAGGGCTCACGCATGCACTTTCTGGACACTATGAGCA 838 Query 1203 TGCACATGGCCATCTCGGGGCTGAGCAGCTTCCAGCGCAGCCTGTGGATGGGAGCCAAGC 1262 |||||||||| ||||| ||||||||||||||||||||||| ||||||||||||||||||| Sbjct 839 TGCACATGGCTATCTCAGGGCTGAGCAGCTTCCAGCGCAGTCTGTGGATGGGAGCCAAGC 898 Query 1263 AGGGAAAGCACAAGACCCAGCAGTCC-ACAAAGCGAGGGCAGAAGTCCCCGAGGAAAGCC 1321 |||| ||||||||||||||||| ||| ||||||||||| |||||||||| || ||| || Sbjct 899 AGGGCAAGCACAAGACCCAGCA-TCCTACAAAGCGAGGTCAGAAGTCCCAGAAGAATGCG 957 Query 1322 AATGGTCCAGCGATCTCATCTTGGGACTGGATGGATATCAGCAGTGCCAATAATCTTGCA 1381 |||||||||||||| |||||||||||||||||||| ||||||||||| |||||||||||| Sbjct 958 AATGGTCCAGCGATTTCATCTTGGGACTGGATGGACATCAGCAGTGCTAATAATCTTGCA 1017 Query 1382 GATGTGCACAACCTTTATGTGGGGGGACCTCCCTTAGAGAAGGAGCCTCGGGAGCTGTTC 1441 || |||||||||||||||||||||||||||| ||||| ||||||||||||||| |||||| Sbjct 1018 GACGTGCACAACCTTTATGTGGGGGGACCTCGCTTAGCGAAGGAGCCTCGGGAACTGTTC 1077 Query 1442 GTCAAAGGCAGCATGAGGGATATCCGAGAGAACTTCCAGGATCTGATGCAGTACTGCGCC 1501 |||||||||||||||||||||||| | ||||||||||||||||||||| ||||||| || Sbjct 1078 GTCAAAGGCAGCATGAGGGATATCAGGGAGAACTTCCAGGATCTGATGGAGTACTGTGCT 1137 Query 1502 CGTGATGTGTGGGCCACCTTTGAGGTTTTCCAGCAGCAGCTGCCACTCTTCTTGGAGAGG 1561 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct 1138 CGTGATGTGTGGGCCACCTTTGAGGTTTTCCAGCAGCAGCTGCCGCTCTTCTTGGAGAGG 1197 Query 1562 TGTCCCCACCCAGTGACTCTGGCTGGCATGCTGGAGATGGGTGTGTCCTACCTGCCTGTC 1621 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct 1198 TGTCCCCACCCAGTGACTCTGGCTGGCATGCTGGAGATGGGTGTCTCCTACCTGCCTGTC 1257 Query 1622 AACCAGAACTGGGAGCGTTACCTGACAGAGGCACAGAACACATATGAGGAGCTCCAGCGG 1681 ||||||||||||||||| ||||||||||||||||||| |||||||||||| ||||||||| Sbjct 1258 AACCAGAACTGGGAGCGGTACCTGACAGAGGCACAGAGCACATATGAGGAACTCCAGCGG 1317 Query 1682 GAGATGAAGAAGTCGCTGATGGATCTGGCTAATGATGCCTGTCAGTTGCTCTCAGGAGAG 1741 ||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||| Sbjct 1318 GAGATGAAGAAGTCGCTGATGGAGCTGGCTAATGATGCCTGCCAGTTGCTCTCAGGAGAG 1377 Query 1742 AGGTACAAAGAAGACCCTTGGCTCTGGGACCTAGAATGGGATTTGCAGGAGTTTAAGCAG 1801 ||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||| Sbjct 1378 AGGTACAAAGAAGACCCTTGGCTCTGGGACCTAGAATGGGACTTGCAGGAATTTAAGCAG 1437 Query 1802 AAAAAGGCAAAGAAGGTGAAGAAGCCAGCCTCAGCCAGCAAGTTGCCCATCGAGGGAGCT 1861 |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct 1438 AAAAAGGCAAAGAAGGTGAAGAAGACAGCCTCAGCCAGCAAGTTGCCCATCGAGGGAGCT 1497 Query 1862 GGGCCCTTTGGGGATCCCATGGATCAGGAAGATCCTGGCCCGCCCAGCGAGGAGGAGGAG 1921 |||||||||||||||||||||||||||||||||||||| || ||||| |||||||||||| Sbjct 1498 GGGCCCTTTGGGGATCCCATGGATCAGGAAGATCCTGGACCACCCAGTGAGGAGGAGGAG 1557 Query 1922 CTTCAGCGAAGTGTAACAGCCCACAACCGGTTACAGCAGCTGAGGAGCACCACGGACCTC 1981 ||||||| || | ||| ||||||| ||| ||||||||||||| ||||||||| |||||| Sbjct 1558 CTTCAGCAAAATATAATGGCCCACACCCGTTTACAGCAGCTGAAGAGCACCACAGACCTC 1617 Query 1982 CTGCCTAAGCGACCCCAGCACCTTCCAGGACACCCTGGGTGGTACCGGAAGCTCTGCCCT 2041 ||||||||||||||||| |||||||| ||||||||||||||||||||||| ||||||||| Sbjct 1618 CTGCCTAAGCGACCCCAACACCTTCCTGGACACCCTGGGTGGTACCGGAAACTCTGCCCT 1677 Query 2042 CGACTAGATGACCCTGCCTGGGCTCCCGGCCCCAGCCTCCTCAGCCTGCAAATGCGGGTC 2101 || |||||||||||||| ||| |||| ||||||||||||||||||||||||||||||||| Sbjct 1678 CGGCTAGATGACCCTGCATGGACTCCGGGCCCCAGCCTCCTCAGCCTGCAAATGCGGGTC 1737 Query 2102 ACTCCTAAGCTCATGGCACTGACCTGGGATGGTTTTCCTCTACACTACTCAGACTCTCAT 2161 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1738 ACTCCTAAGCTCATGGCACTGACCTGGGATGGTTTTCCTCTACACTACTCAGACTCTCAT 1797 Query 2162 GGTTGGGGCTACCTAGTGCCTGGGCGTCGGGATAATCTGACCGAGCCGCCAGTGAGCCCC 2221 |||||||||||||| ||||||||||| |||||||||||||| |||| ||||||||||||| Sbjct 1798 GGTTGGGGCTACCTGGTGCCTGGGCGGCGGGATAATCTGACTGAGCTGCCAGTGAGCCCC 1857 Query 2222 ACTGTAGAA-TCCGCTGCAGTAACCTGCCCCTACAGAGCCATCGAGTCCTTATACAGGAA 2280 |||| || | || ||||| || ||||||||||||||||||||||||||||| ||||||| Sbjct 1858 ACTG-AGGAGTCAGCTGCGGTGACCTGCCCCTACAGAGCCATCGAGTCCTTGTACAGGAG 1916 Query 2281 GCACTGCCTTGAACAGGGGAAGCAGCAATTGGAGCCCCAGGAGGTAGACCTGGCTGAGGA 2340 |||||| ||||| ||||| |||||||| ||||| |||||||| ||||||||||||||| Sbjct 1917 GCACTGTCTTGACCAGGGCAAGCAGCAGCTGGAGACCCAGGAGACAGACCTGGCTGAGGA 1976 Query 2341 GTTCTTACTCACTGACAGTAGTGCCATGTGGCAAACGGTAGAAGAACTGGGCTGCTTAGA 2400 |||||| ||||| |||||| | |||||||||| |||||||||||||||||||||||||| Sbjct 1977 GTTCTTGCTCACGGACAGT-G--CCATGTGGCAGACGGTAGAAGAACTGGGCTGCTTAGA 2033 Query 2401 CGTAGAGGCTGAGGCCA-AGATGGAGAATTCAGGGCTGAGCCAACCTCTAGTTCTGCCTG 2459 || ||||||||||||| || |||||| |||||||||||| || || ||||||| |||| Sbjct 2034 TGTGGAGGCTGAGGCCACAG-TGGAGAGTTCAGGGCTGAGTCAGCCCCTAGTTCCGCCTA 2092 Query 2460 CTGCTTGTGCCCCCAAATCCAGCCAGCCCACGTATCACCATGGCAACGGACCTTATAATG 2519 ||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||| Sbjct 2093 CTGCTTGTGCCCCCAAAACCAGCCAGCCCACTTATCACCATGGCAACGGACCTTATAATG 2152 Query 2520 ATGTGAATATCCCTGGTTGCTGGTTTTTCAAGCTGCCTCACAAGGACGGTAACAACTACA 2579 ||||| ||||||| |||||||||||||||||||||||||||||||| ||||||||||||| Sbjct 2153 ATGTGGATATCCCCGGTTGCTGGTTTTTCAAGCTGCCTCACAAGGATGGTAACAACTACA 2212 Query 2580 ATGTGGGCAGTCCCTTTGCCAAAGATTTCCTGCCCAAGATGGAGGATGGCACCCTGCAGG 2639 ||||||| ||||||||||||||||||||||||||||||||||| || ||||| ||||||| Sbjct 2213 ATGTGGGTAGTCCCTTTGCCAAAGATTTCCTGCCCAAGATGGAAGACGGCACTCTGCAGG 2272 Query 2640 CTGGCCCAGGAGGTGCCAGTGGG-CCTCGTGCCCTGGAAATAAATAAAATGATTTCTTTT 2698 |||||||||| |||||||| ||| |||||||||||||||||||||||||||||||||||| Sbjct 2273 CTGGCCCAGGGGGTGCCAG-GGGACCTCGTGCCCTGGAAATAAATAAAATGATTTCTTTT 2331 Query 2699 TGGAGGAATGCTCATAAACGTATCAGTTCCCAGATGGTGGTATGGCTCCCCAGGTCAGCT 2758 |||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| Sbjct 2332 TGGAGGAATGCTCATAAACGCATCAGCTCCCAGATGGTGGTATGGCTCCCCAGGTCAGCT 2391 Query 2759 CTGCCCCGGGTTGTGACCAGGCACCCCAGCTTCGATGAGGAAGGCCACTATGGGGCCATC 2818 |||||||||| ||||||||||||||||||||| ||||||||| ||||||||||||||||| Sbjct 2392 CTGCCCCGGGCTGTGACCAGGCACCCCAGCTTTGATGAGGAAAGCCACTATGGGGCCATC 2451 Query 2819 CTACCCCAGGTGGTGACTGCTGGCACCATCACCCGTCGAGCTGTGGAGCCCACGTGGCTC 2878 || ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| Sbjct 2452 CTGCCCCAGGTGGTGACTGCTGGCACCATCACCCGTCGCGCTGTGGAGCCCACGTGGCTC 2511 Query 2879 ACTGCCAGTAATGCTCGGCCTGACCGGGTAGGCAGTGAGTTGAAAGCCATGGTGCAGGCT 2938 |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2512 ACTGCCAGCAATGCTCGGCCTGACCGGGTAGGCAGTGAGTTGAAAGCCATGGTGCAGGCT 2571 Query 2939 CCACCTGGCTATGTCCTTGTGGGTGCTGATGTGGACTCACAGGAACTGTGGATCGCAGCT 2998 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2572 CCACCTGGCTATGTCCTTGTGGGTGCTGATGTGGACTCACAGGAACTGTGGATCGCAGCC 2631 Query 2999 GTACTTGGAGATGCTCACTTTGCTGGGATGCATGGCTGCACGGCCTTTGGCTGGATGACT 3058 || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2632 GTTCTTGGAGATGCTCACTTTGCTGGGATGCATGGCTGCACGGCCTTTGGCTGGATGACT 2691 Query 3059 CTGCAGGGCAGGAAGAGCAGAGGCACTGATCTGCACAGCAAGACAGCTGCCACTGTGGGC 3118 || ||||||||||||||||||||||||||||||||||| |||||||| |||||||||||| Sbjct 2692 CTTCAGGGCAGGAAGAGCAGAGGCACTGATCTGCACAGTAAGACAGCCGCCACTGTGGGC 2751 Query 3119 ATCAGCCGAGAGCATGCCAAAATCTTCAACTATGGCCGCATCTATGGGGCTGGGCAGTCC 3178 ||||| || ||||| |||||| |||||||||| ||||||||||| ||||||||||||||| Sbjct 2752 ATCAGTCGTGAGCACGCCAAAGTCTTCAACTACGGCCGCATCTACGGGGCTGGGCAGTCC 2811 Query 3179 TTTGCTGAGCGCCTACTGATGCAGTTCAACCACAGGCTCACAAGGCAGGAGGCAGCTGAG 3238 ||||| |||||||| |||||||||||||||||||||||| ||||||||||||||||||| Sbjct 2812 TTTGCCGAGCGCCTGCTGATGCAGTTCAACCACAGGCTCTCAAGGCAGGAGGCAGCTGAC 2871 Query 3239 AAGGCCCAGCAGATGTATGCAGTCACAAAAGGCCTGCGCCGGTATCGGCTGTCTGCGGAT 3298 ||||||||||||||||| || ||||| |||||||||||||| || ||||| || | ||| Sbjct 2872 AAGGCCCAGCAGATGTACGCTGTCACGAAAGGCCTGCGCCGATACCGGCTCTCAGATGAT 2931 Query 3299 GGTGAGTGGCTGGTGAAACAGTTGAATCTTCCTGTGGACAGGACAGAGGACGGCTGGGTC 3358 ||||| ||||||||||||||||| ||| ||||||||||||||||||| ||||||||||| Sbjct 2932 GGTGAATGGCTGGTGAAACAGTTAAATGTTCCTGTGGACAGGACAGAAGACGGCTGGGTT 2991 Query 3359 TCCCTACAAGATCTTCGAATGATCCGAAGAGAAGCTTCAAGGAAGTCACGATGGAAGAAG 3418 ||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||| Sbjct 2992 TCCCTACAAGATCTTCGAAAGATCCGAAGAGAAGCTTCAAGGAAGTCTCGATGGAAGAAG 3051 Query 3419 TGGGAGGTAGCCTCTGAACGAGCATGGACAGGGGGCACAGAGTCAGAAATGTTTAATAAG 3478 |||||||||| | |||||||||||||||||||||| || ||||||||||||||||||||| Sbjct 3052 TGGGAGGTAGTCACTGAACGAGCATGGACAGGGGGTACGGAGTCAGAAATGTTTAATAAG 3111 Query 3479 CTGGAGAGTATTGCCATGTCTGATACACCACGTACCCCAGTACTGGGCTGCTGCATCAGC 3538 |||||||| |||||||||||||| |||||||| |||||||| |||||||||||||||||| Sbjct 3112 CTGGAGAGCATTGCCATGTCTGACACACCACGCACCCCAGTGCTGGGCTGCTGCATCAGC 3171 Query 3539 AGAGCCTTGGAGCCCTCAGTTGTCCAGGGAGAGTTTATAACCAGTCGTGTGAACTGGGTG 3598 ||||||||||||||||| |||||||||||||||||||| |||||||||||||| |||||| Sbjct 3172 AGAGCCTTGGAGCCCTCGGTTGTCCAGGGAGAGTTTATGACCAGTCGTGTGAATTGGGTG 3231 Query 3599 GTACAGAGCTCTGCTGTAGACTACTTACATCTCATGCTTGTGGCCATGAAGTGGCTGTTT 3658 ||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||| Sbjct 3232 GTACAGAGCTCTGCTGTGGACTACTTACACCTCATGCTTGTGGCCATGAAGTGGCTGTTT 3291 Query 3659 GAGGAATTTGCCATTGATGGGCGCTTCTGCATCAGCATCCACGACGAGGTTCGCTACCTG 3718 ||||||||||||||||||||||||||||||||||||||||| || ||||| ||||||||| Sbjct 3292 GAGGAATTTGCCATTGATGGGCGCTTCTGCATCAGCATCCATGATGAGGTGCGCTACCTG 3351 Query 3719 GTGCGTGAGGAGGACCGCTACCGTGCCGCCCTGGCACTGCAGATCACCAATCTCCTGACC 3778 || ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| Sbjct 3352 GTACGTGAGGAGGACCGCTACCGTGCTGCCCTGGCACTGCAGATCACCAATCTCCTGACC 3411 Query 3779 AGGTGCATGTTTGCCTATAAGCTGGGTCTGAATGATCTGCCCCAGTCAGTCGCCTTTTTC 3838 ||||||||||||||||| ||||||||||||||||| |||||||||||||| ||||||||| Sbjct 3412 AGGTGCATGTTTGCCTACAAGCTGGGTCTGAATGACCTGCCCCAGTCAGTTGCCTTTTTC 3471 Query 3839 AGTGCAGTAGACATTGACCAGTGCCTCAGGAAGGAAGTGACCATGGACTGTAAAACTCCT 3898 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3472 AGTGCAGTAGACATTGACCAGTGCCTCAGGAAGGAAGTGACCATGGACTGTAAAACTCCT 3531 Query 3899 TCTAACCCAACTGGGATGGAAAGGAGATATGGGATCCCCCAGGGTGAAGCACTGGATATT 3958 ||||||||||||||||||||||||| ||| ||||| |||||||||||||||||||||||| Sbjct 3532 TCTAACCCAACTGGGATGGAAAGGAAATACGGGATTCCCCAGGGTGAAGCACTGGATATT 3591 Query 3959 TACCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACGAAGCCAGCCTGGACCCTAG 4018 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3592 TACCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACGAAGCCAGCCTGGACCCTAG 3651 >gb|BC080291.1| UniGene infoGeoGene info Mus musculus cDNA clone IMAGE:6821261 Length=4277 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 4663 bits (2525), Expect = 0.0 Identities = 2527/2528 (99%), Gaps = 0/2528 (0%) Strand=Plus/Plus Query 1889 GAAGATCCTGGCCCGCCCAGCGAGGAGGAGGAGCTTCAGCGAAGTGTAACAGCCCACAAC 1948 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1720 GAAGATCCTGGCCCGCCCAGCGAGGAGGAGGAGCTTCAGCGAAGTGTAACAGCCCACAAC 1779 Query 1949 CGGTTACAGCAGCTGAGGAGCACCACGGACCTCCTGCCTAAGCGACCCCAGCACCTTCCA 2008 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1780 CGGTTACAGCAGCTGAGGAGCACCACGGACCTCCTGCCTAAGCGACCCCAGCACCTTCCA 1839 Query 2009 GGACACCCTGGGTGGTACCGGAAGCTCTGCCCTCGACTAGATGACCCTGCCTGGGCTCCC 2068 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1840 GGACACCCTGGGTGGTACCGGAAGCTCTGCCCTCGACTAGATGACCCTGCCTGGGCTCCC 1899 Query 2069 GGCCCCAGCCTCCTCAGCCTGCAAATGCGGGTCACTCCTAAGCTCATGGCACTGACCTGG 2128 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1900 GGCCCCAGCCTCCTCAGCCTGCAAATGCGGGTCACTCCTAAGCTCATGGCACTGACCTGG 1959 Query 2129 GATGGTTTTCCTCTACACTACTCAGACTCTCATGGTTGGGGCTACCTAGTGCCTGGGCGT 2188 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1960 GATGGTTTTCCTCTACACTACTCAGACTCTCATGGTTGGGGCTACCTAGTGCCTGGGCGT 2019 Query 2189 CGGGATAATCTGACCGAGCCGCCAGTGAGCCCCACTGTAGAATCCGCTGCAGTAACCTGC 2248 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2020 CGGGATAATCTGACCGAGCCGCCAGTGAGCCCCACTGTAGAATCCGCTGCAGTAACCTGC 2079 Query 2249 CCCTACAGAGCCATCGAGTCCTTATACAGGAAGCACTGCCTTGAACAGGGGAAGCAGCAA 2308 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2080 CCCTACAGAGCCATCGAGTCCTTATACAGGAAGCACTGCCTTGAACAGGGGAAGCAGCAA 2139 Query 2309 TTGGAGCCCCAGGAGGTAGACCTGGCTGAGGAGTTCTTACTCACTGACAGTAGTGCCATG 2368 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2140 TTGGAGCCCCAGGAGGTAGACCTGGCTGAGGAGTTCTTACTCACTGACAGTAGTGCCATG 2199 Query 2369 TGGCAAACGGTAGAAGAACTGGGCTGCTTAGACGTAGAGGCTGAGGCCAAGATGGAGAAT 2428 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2200 TGGCAAACGGTAGAAGAACTGGGCTGCTTAGACGTAGAGGCTGAGGCCAAGATGGAGAAT 2259 Query 2429 TCAGGGCTGAGCCAACCTCTAGTTCTGCCTGCTGCTTGTGCCCCCAAATCCAGCCAGCCC 2488 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2260 TCAGGGCTGAGCCAACCTCTAGTTCTGCCTGCTGCTTGTGCCCCCAAATCCAGCCAGCCC 2319 Query 2489 ACGTATCACCATGGCAACGGACCTTATAATGATGTGAATATCCCTGGTTGCTGGTTTTTC 2548 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2320 ACGTATCACCATGGCAACGGACCTTATAATGATGTGAATATCCCTGGTTGCTGGTTTTTC 2379 Query 2549 AAGCTGCCTCACAAGGACGGTAACAACTACAATGTGGGCAGTCCCTTTGCCAAAGATTTC 2608 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2380 AAGCTGCCTCACAAGGACGGTAACAACTACAATGTGGGCAGTCCCTTTGCCAAAGATTTC 2439 Query 2609 CTGCCCAAGATGGAGGATGGCACCCTGCAGGCTGGCCCAGGAGGTGCCAGTGGGCCTCGT 2668 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2440 CTGCCCAAGATGGAGGATGGCACCCTGCAGGCTGGCCCAGGAGGTGCCAGTGGGCCTCGT 2499 Query 2669 GCCCTGGAAATAAATAAAATGATTTCTTTTTGGAGGAATGCTCATAAACGTATCAGTTCC 2728 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2500 GCCCTGGAAATAAATAAAATGATTTCTTTTTGGAGGAATGCTCATAAACGTATCAGTTCC 2559 Query 2729 CAGATGGTGGTATGGCTCCCCAGGTCAGCTCTGCCCCGGGTTGTGACCAGGCACCCCAGC 2788 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2560 CAGATGGTGGTATGGCTCCCCAGGTCAGCTCTGCCCCGGGTTGTGACCAGGCACCCCAGC 2619 Query 2789 TTCGATGAGGAAGGCCACTATGGGGCCATCCTACCCCAGGTGGTGACTGCTGGCACCATC 2848 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2620 TTCGATGAGGAAGGCCACTATGGGGCCATCCTACCCCAGGTGGTGACTGCTGGCACCATC 2679 Query 2849 ACCCGTCGAGCTGTGGAGCCCACGTGGCTCACTGCCAGTAATGCTCGGCCTGACCGGGTA 2908 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2680 ACCCGTCGAGCTGTGGAGCCCACGTGGCTCACTGCCAGTAATGCTCGGCCTGACCGGGTA 2739 Query 2909 GGCAGTGAGTTGAAAGCCATGGTGCAGGCTCCACCTGGCTATGTCCTTGTGGGTGCTGAT 2968 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2740 GGCAGTGAGTTGAAAGCCATGGTGCAGGCTCCACCTGGCTATGTCCTTGTGGGTGCTGAT 2799 Query 2969 GTGGACTCACAGGAACTGTGGATCGCAGCTGTACTTGGAGATGCTCACTTTGCTGGGATG 3028 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2800 GTGGACTCACAGGAACTGTGGATCGCAGCTGTACTTGGAGATGCTCACTTTGCTGGGATG 2859 Query 3029 CATGGCTGCACGGCCTTTGGCTGGATGACTCTGCAGGGCAGGAAGAGCAGAGGCACTGAT 3088 ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Sbjct 2860 CATGGCTGCACGGCCTTTGGCTGGATGACTCTGCAGGGCAGTAAGAGCAGAGGCACTGAT 2919 Query 3089 CTGCACAGCAAGACAGCTGCCACTGTGGGCATCAGCCGAGAGCATGCCAAAATCTTCAAC 3148 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2920 CTGCACAGCAAGACAGCTGCCACTGTGGGCATCAGCCGAGAGCATGCCAAAATCTTCAAC 2979 Query 3149 TATGGCCGCATCTATGGGGCTGGGCAGTCCTTTGCTGAGCGCCTACTGATGCAGTTCAAC 3208 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2980 TATGGCCGCATCTATGGGGCTGGGCAGTCCTTTGCTGAGCGCCTACTGATGCAGTTCAAC 3039 Query 3209 CACAGGCTCACAAGGCAGGAGGCAGCTGAGAAGGCCCAGCAGATGTATGCAGTCACAAAA 3268 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3040 CACAGGCTCACAAGGCAGGAGGCAGCTGAGAAGGCCCAGCAGATGTATGCAGTCACAAAA 3099 Query 3269 GGCCTGCGCCGGTATCGGCTGTCTGCGGATGGTGAGTGGCTGGTGAAACAGTTGAATCTT 3328 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3100 GGCCTGCGCCGGTATCGGCTGTCTGCGGATGGTGAGTGGCTGGTGAAACAGTTGAATCTT 3159 Query 3329 CCTGTGGACAGGACAGAGGACGGCTGGGTCTCCCTACAAGATCTTCGAATGATCCGAAGA 3388 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3160 CCTGTGGACAGGACAGAGGACGGCTGGGTCTCCCTACAAGATCTTCGAATGATCCGAAGA 3219 Query 3389 GAAGCTTCAAGGAAGTCACGATGGAAGAAGTGGGAGGTAGCCTCTGAACGAGCATGGACA 3448 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3220 GAAGCTTCAAGGAAGTCACGATGGAAGAAGTGGGAGGTAGCCTCTGAACGAGCATGGACA 3279 Query 3449 GGGGGCACAGAGTCAGAAATGTTTAATAAGCTGGAGAGTATTGCCATGTCTGATACACCA 3508 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3280 GGGGGCACAGAGTCAGAAATGTTTAATAAGCTGGAGAGTATTGCCATGTCTGATACACCA 3339 Query 3509 CGTACCCCAGTACTGGGCTGCTGCATCAGCAGAGCCTTGGAGCCCTCAGTTGTCCAGGGA 3568 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3340 CGTACCCCAGTACTGGGCTGCTGCATCAGCAGAGCCTTGGAGCCCTCAGTTGTCCAGGGA 3399 Query 3569 GAGTTTATAACCAGTCGTGTGAACTGGGTGGTACAGAGCTCTGCTGTAGACTACTTACAT 3628 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3400 GAGTTTATAACCAGTCGTGTGAACTGGGTGGTACAGAGCTCTGCTGTAGACTACTTACAT 3459 Query 3629 CTCATGCTTGTGGCCATGAAGTGGCTGTTTGAGGAATTTGCCATTGATGGGCGCTTCTGC 3688 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3460 CTCATGCTTGTGGCCATGAAGTGGCTGTTTGAGGAATTTGCCATTGATGGGCGCTTCTGC 3519 Query 3689 ATCAGCATCCACGACGAGGTTCGCTACCTGGTGCGTGAGGAGGACCGCTACCGTGCCGCC 3748 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3520 ATCAGCATCCACGACGAGGTTCGCTACCTGGTGCGTGAGGAGGACCGCTACCGTGCCGCC 3579 Query 3749 CTGGCACTGCAGATCACCAATCTCCTGACCAGGTGCATGTTTGCCTATAAGCTGGGTCTG 3808 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3580 CTGGCACTGCAGATCACCAATCTCCTGACCAGGTGCATGTTTGCCTATAAGCTGGGTCTG 3639 Query 3809 AATGATCTGCCCCAGTCAGTCGCCTTTTTCAGTGCAGTAGACATTGACCAGTGCCTCAGG 3868 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3640 AATGATCTGCCCCAGTCAGTCGCCTTTTTCAGTGCAGTAGACATTGACCAGTGCCTCAGG 3699 Query 3869 AAGGAAGTGACCATGGACTGTAAAACTCCTTCTAACCCAACTGGGATGGAAAGGAGATAT 3928 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3700 AAGGAAGTGACCATGGACTGTAAAACTCCTTCTAACCCAACTGGGATGGAAAGGAGATAT 3759 Query 3929 GGGATCCCCCAGGGTGAAGCACTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCC 3988 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3760 GGGATCCCCCAGGGTGAAGCACTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCC 3819 Query 3989 TTGGAAAAACGAAGCCAGCCTGGACCCTAGCTCTGTCTGGAGGTTCTGTATTTGCTCCTG 4048 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3820 TTGGAAAAACGAAGCCAGCCTGGACCCTAGCTCTGTCTGGAGGTTCTGTATTTGCTCCTG 3879 Query 4049 TGGAGCTTTATTGGAGCGGTGCAGGTTCCTAAACTCAGGCTTTCAGATGTGCTTTTTTGC 4108 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3880 TGGAGCTTTATTGGAGCGGTGCAGGTTCCTAAACTCAGGCTTTCAGATGTGCTTTTTTGC 3939 Query 4109 AAAAGGCAGCCATTTTTCTGTAGCAGGACCTGCCCAGGAAAGTCCTCCTAACGGAAGGCA 4168 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3940 AAAAGGCAGCCATTTTTCTGTAGCAGGACCTGCCCAGGAAAGTCCTCCTAACGGAAGGCA 3999 Query 4169 CAATTCAGTGCGTTCAGAACCAGGACACCAACATCAGTGCAGGCTGTGTGACAAGGGGTA 4228 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4000 CAATTCAGTGCGTTCAGAACCAGGACACCAACATCAGTGCAGGCTGTGTGACAAGGGGTA 4059 Query 4229 CTGTTGGGCACAAATGAAGCAGATGCCCCAAAGGTCACATTAACTCAGGCATTTCTTCCT 4288 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4060 CTGTTGGGCACAAATGAAGCAGATGCCCCAAAGGTCACATTAACTCAGGCATTTCTTCCT 4119 Query 4289 CCTCTTCTTGGCTGGTTCTCTGTCCTGCTGTGTATGTGCTGATGCAGTGCCCTAGAAGGG 4348 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4120 CCTCTTCTTGGCTGGTTCTCTGTCCTGCTGTGTATGTGCTGATGCAGTGCCCTAGAAGGG 4179 Query 4349 GAGAGTAGAAATTTTGACAACCTTGTTCTAAGGTGATGGGAATAAAAACAAACACCAAAC 4408 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4180 GAGAGTAGAAATTTTGACAACCTTGTTCTAAGGTGATGGGAATAAAAACAAACACCAAAC 4239 Query 4409 TCCTGGAA 4416 |||||||| Sbjct 4240 TCCTGGAA 4247 Score = 3182 bits (1723), Expect = 0.0 Identities = 1723/1723 (100%), Gaps = 0/1723 (0%) Strand=Plus/Plus Query 94 GCTCCCGAGACCGCACGCCACCCTGAGGCTGCGTGGGCCGCGCGCCGCGGACGCCGCGTC 153 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1 GCTCCCGAGACCGCACGCCACCCTGAGGCTGCGTGGGCCGCGCGCCGCGGACGCCGCGTC 60 Query 154 GTCGCCGGGGCTGTGGGCTGCCGCAGAACGGGAAGCGCGAAGCGGACCGAGGACTTGTGT 213 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 61 GTCGCCGGGGCTGTGGGCTGCCGCAGAACGGGAAGCGCGAAGCGGACCGAGGACTTGTGT 120 Query 214 GAGGAAGGCAGGCATGGTGAGACCTATTTCACTGACAGGAGCACAGAGAGGGGACGCGTC 273 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 121 GAGGAAGGCAGGCATGGTGAGACCTATTTCACTGACAGGAGCACAGAGAGGGGACGCGTC 180 Query 274 TCTCTCTGAGTCTTTCGGCCACTAAAAGCAGTCAAGCTGGAGCCCAAAGCCCGGTGCCCC 333 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 181 TCTCTCTGAGTCTTTCGGCCACTAAAAGCAGTCAAGCTGGAGCCCAAAGCCCGGTGCCCC 240 Query 334 GACTCACAGCGGGGGGCTCCCTGCACCAACCATGAGCCGCCTGCTCTGGAAGAAGGTGGC 393 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 241 GACTCACAGCGGGGGGCTCCCTGCACCAACCATGAGCCGCCTGCTCTGGAAGAAGGTGGC 300 Query 394 TGGCGCCAAGGTCGCCTCAGGGCCAGTACCAGCAACCGCGCGCTGGGTCTCCAGCTCCGT 453 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 301 TGGCGCCAAGGTCGCCTCAGGGCCAGTACCAGCAACCGCGCGCTGGGTCTCCAGCTCCGT 360 Query 454 CCTCGACCCCGTCCCCAGCGACGGGCGGCCGCCGTCGCAAATGCCCTCCTCCGAGAATGG 513 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 361 CCTCGACCCCGTCCCCAGCGACGGGCGGCCGCCGTCGCAAATGCCCTCCTCCGAGAATGG 420 Query 514 GCAGCTGCGGCTCAACCCTCTGCTCATCCAGATGTTGTCGAGAGGCCTGCACGAGCAGAT 573 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 421 GCAGCTGCGGCTCAACCCTCTGCTCATCCAGATGTTGTCGAGAGGCCTGCACGAGCAGAT 480 Query 574 CTTCGGGTGCGGCGGGGAAATGCCCGACGAGGCCGCGGTGCAGCGCAGCGTAGAGCACCT 633 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 481 CTTCGGGTGCGGCGGGGAAATGCCCGACGAGGCCGCGGTGCAGCGCAGCGTAGAGCACCT 540 Query 634 GCAGAAGCACGGGCTCTGGGGGCAGCCGGCCACGCCCTTGCCAGACGTGGAGCTGCGCCT 693 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 541 GCAGAAGCACGGGCTCTGGGGGCAGCCGGCCACGCCCTTGCCAGACGTGGAGCTGCGCCT 600 Query 694 GCCCCGGCTCTTCGGGGGCAACCTGGACCAGCACTTCCGCCTCCTGGCCCAGAAGCAGAG 753 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 601 GCCCCGGCTCTTCGGGGGCAACCTGGACCAGCACTTCCGCCTCCTGGCCCAGAAGCAGAG 660 Query 754 CCTGCCTTACTTGGAGGCGGCCGCCTCGTTATTGGAGGCCCAATTGCCCCCCGAGCCCAA 813 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 661 CCTGCCTTACTTGGAGGCGGCCGCCTCGTTATTGGAGGCCCAATTGCCCCCCGAGCCCAA 720 Query 814 GAGCTGGGCCTGGGCGGAGGGCTGGACCCGGTACGGCCCCGAGGGGGAGGCCGAACCCGT 873 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 721 GAGCTGGGCCTGGGCGGAGGGCTGGACCCGGTACGGCCCCGAGGGGGAGGCCGAACCCGT 780 Query 874 GGCCATCCCCGAGGAGCGGGCCCTGGTGTTCGACGTGGAGGTCTGCTTGGCAGAGGGAAC 933 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 781 GGCCATCCCCGAGGAGCGGGCCCTGGTGTTCGACGTGGAGGTCTGCTTGGCAGAGGGAAC 840 Query 934 CTGCCCCACTTTGGCGGTGGCCATATCCCCCTCGGCCTGGTATTCCTGGTGCAGCCGGCG 993 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 841 CTGCCCCACTTTGGCGGTGGCCATATCCCCCTCGGCCTGGTATTCCTGGTGCAGCCGGCG 900 Query 994 GCTGGTGGAAGAGCGTTACTCTTGGACCAGCCAGCTATCGCCGGCTGACCTAATCCCTTT 1053 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 901 GCTGGTGGAAGAGCGTTACTCTTGGACCAGCCAGCTATCGCCGGCTGACCTAATCCCTTT 960 Query 1054 GGGGGGCTCCACTAGTGCCAGCAGCTCCACCAAGCAGGATGGGCAGGAACAGTTAGTGGT 1113 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 961 GGGGGGCTCCACTAGTGCCAGCAGCTCCACCAAGCAGGATGGGCAGGAACAGTTAGTGGT 1020 Query 1114 GGGGCACAATGTTTCCTTTGACCGAGCCCATATCAGGGAACAGTATCTGATTCAGGACTC 1173 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1021 GGGGCACAATGTTTCCTTTGACCGAGCCCATATCAGGGAACAGTATCTGATTCAGGACTC 1080 Query 1174 CCGGATGCGTTTTCTCGATACTATGAGCATGCACATGGCCATCTCGGGGCTGAGCAGCTT 1233 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1081 CCGGATGCGTTTTCTCGATACTATGAGCATGCACATGGCCATCTCGGGGCTGAGCAGCTT 1140 Query 1234 CCAGCGCAGCCTGTGGATGGGAGCCAAGCAGGGAAAGCACAAGACCCAGCAGTCCACAAA 1293 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1141 CCAGCGCAGCCTGTGGATGGGAGCCAAGCAGGGAAAGCACAAGACCCAGCAGTCCACAAA 1200 Query 1294 GCGAGGGCAGAAGTCCCCGAGGAAAGCCAATGGTCCAGCGATCTCATCTTGGGACTGGAT 1353 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1201 GCGAGGGCAGAAGTCCCCGAGGAAAGCCAATGGTCCAGCGATCTCATCTTGGGACTGGAT 1260 Query 1354 GGATATCAGCAGTGCCAATAATCTTGCAGATGTGCACAACCTTTATGTGGGGGGACCTCC 1413 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1261 GGATATCAGCAGTGCCAATAATCTTGCAGATGTGCACAACCTTTATGTGGGGGGACCTCC 1320 Query 1414 CTTAGAGAAGGAGCCTCGGGAGCTGTTCGTCAAAGGCAGCATGAGGGATATCCGAGAGAA 1473 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1321 CTTAGAGAAGGAGCCTCGGGAGCTGTTCGTCAAAGGCAGCATGAGGGATATCCGAGAGAA 1380 Query 1474 CTTCCAGGATCTGATGCAGTACTGCGCCCGTGATGTGTGGGCCACCTTTGAGGTTTTCCA 1533 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1381 CTTCCAGGATCTGATGCAGTACTGCGCCCGTGATGTGTGGGCCACCTTTGAGGTTTTCCA 1440 Query 1534 GCAGCAGCTGCCACTCTTCTTGGAGAGGTGTCCCCACCCAGTGACTCTGGCTGGCATGCT 1593 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1441 GCAGCAGCTGCCACTCTTCTTGGAGAGGTGTCCCCACCCAGTGACTCTGGCTGGCATGCT 1500 Query 1594 GGAGATGGGTGTGTCCTACCTGCCTGTCAACCAGAACTGGGAGCGTTACCTGACAGAGGC 1653 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1501 GGAGATGGGTGTGTCCTACCTGCCTGTCAACCAGAACTGGGAGCGTTACCTGACAGAGGC 1560 Query 1654 ACAGAACACATATGAGGAGCTCCAGCGGGAGATGAAGAAGTCGCTGATGGATCTGGCTAA 1713 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1561 ACAGAACACATATGAGGAGCTCCAGCGGGAGATGAAGAAGTCGCTGATGGATCTGGCTAA 1620 Query 1714 TGATGCCTGTCAGTTGCTCTCAGGAGAGAGGTACAAAGAAGACCCTTGGCTCTGGGACCT 1773 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1621 TGATGCCTGTCAGTTGCTCTCAGGAGAGAGGTACAAAGAAGACCCTTGGCTCTGGGACCT 1680 Query 1774 AGAATGGGATTTGCAGGAGTTTAAGCAGAAAAAGGCAAAGAAG 1816 ||||||||||||||||||||||||||||||||||||||||||| Sbjct 1681 AGAATGGGATTTGCAGGAGTTTAAGCAGAAAAAGGCAAAGAAG 1723 >ref|XM_001092360.1| UniGene infoGene info PREDICTED: Macaca mulatta polymerase (DNA directed), gamma (POLG), mRNA Length=4419 Score = 4473 bits (2422), Expect = 0.0 Identities = 3748/4368 (85%), Gaps = 171/4368 (3%) Strand=Plus/Plus Query 100 GAGACCGCACGCCACCCTGAGGCTGCGTGGGCCGCGC-GCCGCGGACGCCGCGTCGT-CG 157 ||| || |||||||||| |||||||||| |||||||| | ||||| |||| ||| | Sbjct 17 GAGGCCACACGCCACCCCGAGGCTGCGTAGGCCGCGCATAGGGGGACGTCGCGCCGTGGG 76 Query 158 CC-GGGGCTGTGGGCTG--CCGCAGAACGGGAAGC-GCGAAGCGGACCGAGGACTTGTGT 213 || |||| | ||| | ||||||| | |||||| || |||||||||||| ||| | Sbjct 77 CCTGGGG-T-CGGG-AGAACCGCAGACCAGGAAGCACCG-TGCGGACCGAGGATTTG-GG 131 Query 214 GAGGAAGGCAGGCATGGTGAGACCTATTTCACTGACAGGAGCA-CAGAGAGGGGACGCGT 272 | |||||||||||||||| | ||| |||||||||||||||| | |||||| ||||| || Sbjct 132 GTGGAAGGCAGGCATGGTCAAACCCATTTCACTGACAGGAG-AGCAGAGACAGGACGTGT 190 Query 273 CTCTCTCTGAGTCTTTCGGCCACTAAAAGCAGTCAAGCTGGAGCCCAAAGCCCGGTGCCC 332 ||||||| | ||||| | |||| ||||||||| |||||||||| ||||||| |||| | Sbjct 191 CTCTCTCCGCGTCTTCCAGCCAATAAAAGCAGCCAAGCTGGAGTCCAAAGCTAGGTGTTC 250 Query 333 CGACTCACAGCG-GGGGGCTCCCTGCACCAACCATGAGCCGCCTGCTCTGGAAGAAGGTG 391 ||||| ||||| ||||| ||||||||||||||||||||||||||||||||| |||| || Sbjct 251 TGACTCCCAGCGTGGGGG-TCCCTGCACCAACCATGAGCCGCCTGCTCTGGAGGAAGTTG 309 Query 392 GCTGGCGCCAAGGTCG-CCTCAGGGCCAGTACCAGCAACC-GCGCGCTGGGTCTCCAGCT 449 || ||||||| |||| | ||||||| || ||||| || | ||||||||||||||||| Sbjct 310 GCCGGCGCCACCGTCGTGC-CAGGGCCGGTTCCAGC-TCCGGGGCGCTGGGTCTCCAGCT 367 Query 450 CCGTCCTCGAC-CCCGTCCCCAGCGA----C-G-GGCGGC--C-GC--C-G-T-C-GCA- 492 |||||| || | ||| ||||||||| | | |||||| | || | | | | ||| Sbjct 368 CCGTCCCCG-CGTCCGACCCCAGCGACGGGCGGCGGCGGCAGCAGCAGCAGCTGCAGCAG 426 Query 493 ----AA-TGCCCTCCTCCGAGAATGGGCAGCTGCGGCTCAACCC-TCTGCTCATCCAGAT 546 || |||| ||||| ||| ||||||||||||| |||||| | ||| ||||||||| Sbjct 427 CCGCAAGTGCCATCCTCGGAGGGCGGGCAGCTGCGGCACAACCCGT-TGCACATCCAGAT 485 Query 547 GTTGTCGAGAGGCCTGCACGAGCAGATCTTCGGGTGCGGCGGGGAAATGCCCGACGAGGC 606 | | |||| ||| ||||||||||| ||||||||| || ||||| || |||| |||||| Sbjct 486 GCTCTCGAAAGGGCTGCACGAGCAAATCTTCGGGCAAGGAGGGGAGATACCCGGCGAGGC 545 Query 607 CGCGGTGCAG-CGCAGCGTAGAGCACCTGCAGAAGCACGGGCTCTGGGGGCAGCCGGCCA 665 |||||||| | |||||||| || |||||||||||||||||||||||||||||||| | || Sbjct 546 CGCGGTGC-GCCGCAGCGTCGAACACCTGCAGAAGCACGGGCTCTGGGGGCAGCCAG-CA 603 Query 666 -CGCCCTTGCCAGACGTGGAGCTGCGCCTGCC-CCGGCTCTTCGGGGGCAACCTGGACCA 723 |||||||||| |||||||||||||||||||| || |||| ||||| |||||||||||| Sbjct 604 GCGCCCTTGCCCGACGTGGAGCTGCGCCTGCCGCC-CCTCTACGGGGACAACCTGGACCA 662 Query 724 GCACTTCCGCCTCCTGGCCCAGAAGCAGAGCCTGCCTTACTTGGAGGCGGCCGCCTCGTT 783 |||||||||||||||||||||||||||||||||||| ||| ||||||||||| |||| | Sbjct 663 GCACTTCCGCCTCCTGGCCCAGAAGCAGAGCCTGCCCTACCTGGAGGCGGCCAACTCGCT 722 Query 784 ATTGGAGGCCCAATTGCCCCCCG-AGCCCAAGAGCTGGGCCTGGGCGGAGGGCTGGACCC 842 ||| ||||||| || |||||| |||||| | | ||||||||||||||||||||||||| Sbjct 723 GTTGCAGGCCCAGCTG-CCCCCGCAGCCCACGGGTTGGGCCTGGGCGGAGGGCTGGACCC 781 Query 843 GGTACGGCCCCGAGGGGGAGGCCGAACCCGTGGCCATCCCCGAGGAGCGGGCCCTGGTGT 902 |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct 782 GGTACGGCCCCGAGGGGGAGGCCGTACCCGTGGCCATCCCCGAGGAGCGGGCCCTGGTGT 841 Query 903 TCGACGTGGAGGTCTGCTTGGCAGAGGGAACCTGCCCCACTTTGGCGGTGGCCATATCCC 962 |||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||| Sbjct 842 TCGACGTGGAGGTCTGCTTGGCAGAGGGAATTTGCCCCACATTGGCGGTGGCCATATCCC 901 Query 963 CCTCGGCCTGGTATTCCTGGTGCAGCCGGCGGCTGGTGGAAGAGCGTTACTCTTGGACCA 1022 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 902 CCTCGGCCTGGTATTCCTGGTGCAGCCGGCGGCTGGTGGAAGAGCGTTACTCTTGGACCA 961 Query 1023 GCCAGCTATCGCCGGCTGACCTAATCCCTTTGGGGGGCTCC-ACTAGTGCCAGCAGCTCC 1081 ||||||| |||||||||||||| ||||| ||| || | || || |||||||| | || Sbjct 962 GCCAGCTGTCGCCGGCTGACCTCATCCCCCTGGAGGTC-CCTGCTGGTGCCAGC--C-CC 1017 Query 1082 ACCAAGCAG-GATGGGCAGGAACAGTTAGTGGTGGGGCACAATGTTTCCTTTGACCGAGC 1140 ||| || || ||| ||||||| |||||||||||||||||||||||||||||||||||||| Sbjct 1018 ACCCAG-AGAGATTGGCAGGAGCAGTTAGTGGTGGGGCACAATGTTTCCTTTGACCGAGC 1076 Query 1141 CCATATCAGGGAACAGTATCTGATTCAGGACTCCCGGATGCGTTTTCTCGATACTATGAG 1200 ||||||||||| ||||| ||||| |||| |||| |||||||| || || || ||||| Sbjct 1077 TCATATCAGGGAGCAGTACCTGATCCAGGGTTCCCACATGCGTTTCCTGGACACCATGAG 1136 Query 1201 CATGCACATGGCCATCTCGGGGCTGAGCAGCTTCCAGCGCAGCCTGTGGATGGGAGCCAA 1260 |||||||||||||||||| ||||| || |||||||||||||| |||||||| | |||||| Sbjct 1137 CATGCACATGGCCATCTCAGGGCTAAGTAGCTTCCAGCGCAGTCTGTGGATAGCAGCCAA 1196 Query 1261 GCAGGGAAAGCACAAGACCCAGCAG-TCCACAAAGCGAGGGCAGAAGTCCCCGAGGAAAG 1319 |||||| ||||||||| |||| | |||||||||| ||| |||||||||| |||||||| Sbjct 1197 GCAGGGCAAGCACAAGGTCCAG-GGCTCCACAAAGCAAGGCCAGAAGTCCCAGAGGAAAG 1255 Query 1320 -CC-AA-TGGTCCAGCGATCTCATCTTGGGACTGGATGGATATCAGCAGTGCCAATAATC 1376 || || || |||||||||||||| ||||||||| |||| |||||||||| ||| | || Sbjct 1256 CCCGAAGAGGCCCAGCGATCTCATCCTGGGACTGGCTGGACATCAGCAGTGTCAACAGTC 1315 Query 1377 TTGCAGATGTGCACA-ACCTTTATGT-GGGGGGACCTCCCTTAGAGAAGGAGCCTCGGGA 1434 | ||||| ||||||| | |||||||| |||||| ||||||||||||||||||||||| || Sbjct 1316 TGGCAGAGGTGCACAGA-CTTTATGTAGGGGGG-CCTCCCTTAGAGAAGGAGCCTCGAGA 1373 Query 1435 GCTGTTCGTCAAAGGCAGCATGAGGGATATCCGAGAGAACTTCCAGGATCTGATGCAGTA 1494 |||||||| || || | ||||| ||| || || |||||||||||||| ||||||||||| Sbjct 1374 ACTGTTCGTGAAGGGTACCATGAAGGACATTCGTGAGAACTTCCAGGACCTGATGCAGTA 1433 Query 1495 CTGCGCCC-GTGATGTGTGGGCCACCTTTGAGGTTTTCCAGCAGCAGCTGCCACTCTTCT 1553 ||| |||| | || |||||||||||| ||||||||||||||||||||| || ||||||| Sbjct 1434 CTGTGCCCAG-GACGTGTGGGCCACCCATGAGGTTTTCCAGCAGCAGCTACCGCTCTTCT 1492 Query 1554 TGGAGAGGTGTCCCCACCCAGTGACTCTGGCTGGCATGCTGGAGATGGGTGTGTCCTACC 1613 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| Sbjct 1493 TGGAGAGGTGTCCCCACCCAGTGACTCTGGCTGGCATGCTGGAGATGGGTGTCTCCTACC 1552 Query 1614 TGCCTGTCAACCAGAACTGGGAGCGTTACCTGACAGAGGCACAGAACACATATGAGGAGC 1673 |||||||||||||||||||||||||||||||| ||||||||||| ||| |||||||||| Sbjct 1553 TGCCTGTCAACCAGAACTGGGAGCGTTACCTGGCAGAGGCACAGGGCACTTATGAGGAGC 1612 Query 1674 TCCAGCGGGAGATGAAGAAGTCGCTGATGGATCTGGCTAATGATGCCTGTCAGTTGCTCT 1733 ||||||||||||||||||||||| ||||||| ||||| || || ||||| ||| |||||| Sbjct 1613 TCCAGCGGGAGATGAAGAAGTCGTTGATGGACCTGGCCAACGACGCCTGCCAGCTGCTCT 1672 Query 1734 CAGGAGAGAGGTACAAAGAAGACCCTTGGCTCTGGGACCTAGAATGGGATTTGCAGGAGT 1793 ||||||||||||||||||||||||| |||||||||||||| || ||||| |||| || | Sbjct 1673 CAGGAGAGAGGTACAAAGAAGACCCCTGGCTCTGGGACCTGGAGTGGGACCTGCAAGAAT 1732 Query 1794 TTAAGCAGAA-AAAGGCAAAGAAGGTGAAG-A--AGCCAGCCTCAGCCAGCAAGTTGCCC 1849 |||||||||| ||| || |||||||||||| | |||||||| ||||||||||||||||| Sbjct 1733 TTAAGCAGAAGAAA-GCTAAGAAGGTGAAGAAGGAGCCAGCCACAGCCAGCAAGTTGCCC 1791 Query 1850 ATCGA-GGGAGCT-GGGCCCTTTGGGGATCCCATGGATCAGGAAGATCCT-GGCCCGCC- 1905 ||||| ||| ||| |||||| ||| |||||||||||||||||||| ||| ||||| || Sbjct 1792 ATCGATGGG-GCTGGGGCCC-CTGGTGATCCCATGGATCAGGAAGA-CCTCGGCCC-CCG 1847 Query 1906 CAGCGAGGAGGAGGAGCTTCAGCGAAG-TGTAACAGCCCACAACC-GGTTACAGCAGCTG 1963 ||| |||||||||||| |||| | ||| ||| | |||| || | || ||| ||||| Sbjct 1848 CAGTGAGGAGGAGGAGTTTCAAC-AAGATGTCATGGCCC-GTGCCTGCTTGCAGAAGCTG 1905 Query 1964 -AGGAGCACCACGGACCTCCTGCCTAAGCGACCCCAGCACCTTCCAGGACACCCTGGGTG 2022 ||| | ||||| || |||||||| ||||| |||||||||||||| ||||||||||| || Sbjct 1906 AAGG-GGACCACAGAGCTCCTGCCCAAGCGGCCCCAGCACCTTCCTGGACACCCTGGATG 1964 Query 2023 GTACCGGAAGCTCTG-CCCTCGACTAGATGACCCTGCCTGGGCTCCC-GGCCCCAGCCTC 2080 ||||||||||||||| ||| || ||||| ||||| || ||| | ||| ||||||||||| Sbjct 1965 GTACCGGAAGCTCTGTCCC-CGGCTAGACGACCCCGCATGGAC-CCCAGGCCCCAGCCTT 2022 Query 2081 CTCAGCCTGCAAATGCGGGTCACTCCTAAGCTCATGGCACTGACCTGGGATGGTTTTCCT 2140 ||||||||||| ||||||||||| ||||| ||||||||||||||||||||||| || ||| Sbjct 2023 CTCAGCCTGCAGATGCGGGTCACACCTAAACTCATGGCACTGACCTGGGATGGCTTCCCT 2082 Query 2141 CTACACTACTCAGACTC-TCATGGTTGGGGCTACCTAGTGCCTGGGCGTCGGGATAATCT 2199 || ||||||||||| | |||||| ||||||||||| ||||||||||| ||||| || || Sbjct 2083 CTGCACTACTCAGA-GCGTCATGGCTGGGGCTACCTGGTGCCTGGGCGGCGGGACAACCT 2141 Query 2200 GACCGAGCCGCCAGTGA-GCCCCACTGTAGAATCCGCTGCAGTAACCTGCCCCTACAGAG 2258 | || || | || | | | |||| | ||||| |||| || |||||||||||||| Sbjct 2142 GGCCAAG-CTCCCGACAGGTACCACCCTGGAATCAGCTGGGGTGGTCTGCCCCTACAGAG 2200 Query 2259 CCATCGAGTCCTTATACAGGAAGCACTGCCTTGAACAGGGGAAGCAGCAATTGGA-GCCC 2317 ||||||||||| | |||||||||||||| || ||||||||||||||||| | | ||| Sbjct 2201 CCATCGAGTCCCTGTACAGGAAGCACTGTCTCGAACAGGGGAAGCAGCAGCT-AACGCCT 2259 Query 2318 CAGGAGGTAGACCTGGCTGAGGAGTTCTTACTCACTGACAGTAGTGCCATGTGGCAAACG 2377 ||||||| | |||||||||||||||| | |||||||||| ||||||||| ||||||||| Sbjct 2260 CAGGAGGCCGGCCTGGCTGAGGAGTTCCTGCTCACTGACAATAGTGCCATATGGCAAACG 2319 Query 2378 GTAGAAGAACTGGGCTGCTTAGACGTAGAGGCTGAGGCCAAGATGGAGAA-TT-C-AG-G 2433 ||||||||||||| | |||||| || ||||||||||||||||||||||| || | || Sbjct 2320 GTAGAAGAACTGGATTACTTAGAAGTGGAGGCTGAGGCCAAGATGGAGAACTTGCGAGCT 2379 Query 2434 GC--TG--A-GCCAACCTCTAGTTCTGCCTGCTGCTTGTGCCCCCAAATCCAGCCAGCCC 2488 || || | | ||||| |||| |||| |||| || | | |||||| |||||||||| Sbjct 2380 GCAGTGCCAGGTCAACCGCTAGCTCTGACTGCCCCTGGCGGCCCCAAGGACAGCCAGCCC 2439 Query 2489 -ACGTATCACCATGGCAACGGACCTTATAATGATGTGAATATCCCTGGTTGCTGGTTTTT 2547 || |||||||||||||| |||||||| || |||||| | |||||||| ||||||||||| Sbjct 2440 AAC-TATCACCATGGCAATGGACCTTACAACGATGTGGACATCCCTGGCTGCTGGTTTTT 2498 Query 2548 CAAGCTGCCTCACAAGGACGGTAACAACTACAATGTGGGCAGTCCCTTTGCCAAAGATTT 2607 |||||||||||||||||| ||||| | || |||||||| || ||||||||||| || || Sbjct 2499 CAAGCTGCCTCACAAGGATGGTAATAGCTGTAATGTGGGAAGCCCCTTTGCCAAGGACTT 2558 Query 2608 CCTGCCCAAGATGGAGGATGGCACCCTGCAGGCTGGCCCAGGAGGTGCCAGTGGGCCTCG 2667 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || Sbjct 2559 CCTGCCCAAGATGGAGGATGGCACCCTGCAGGCTGGCCCAGGAGGTGCCAGTGGGCCCCG 2618 Query 2668 TGCCCTGGAAATAAATAAAATGATTTCTTTTTGGAGGAATGCTCATAAACGTATCAGTTC 2727 ||| |||||||| || |||||||||||||| |||||||| || |||||||||||||| || Sbjct 2619 TGCTCTGGAAATCAACAAAATGATTTCTTTCTGGAGGAACGCCCATAAACGTATCAGCTC 2678 Query 2728 CCAGATGGTGGTATGGCTCCCCAGGTCAGCTCTGCCCCGGGTTGTGACCAGGCACCCC-A 2786 |||||||||||| ||||| |||||||||||||||||||| | ||||| |||||||||| | Sbjct 2679 CCAGATGGTGGTGTGGCTGCCCAGGTCAGCTCTGCCCCGTGCTGTGATCAGGCACCCCGA 2738 Query 2787 GCT-TCGATGAGGAAGGCCACTATGGGGCCATCCTACCCCAGGTGGTGACTGCTGGCACC 2845 || | ||||||||||||| ||||||||||||||| ||||| ||||||||||| |||||| Sbjct 2739 -CTAT-GATGAGGAAGGCCTCTATGGGGCCATCCTGCCCCAAGTGGTGACTGCCGGCACC 2796 Query 2846 ATCACCCGTCGAGCTGTGGAGCCCACGTGGCTCACTGCCAGTAATGCTCGGCCTGACCGG 2905 ||||| || || ||||||||||||||||||||||||||||| ||||| ||||||||||| Sbjct 2797 ATCACTCGCCGGGCTGTGGAGCCCACGTGGCTCACTGCCAGCAATGCCCGGCCTGACCGA 2856 Query 2906 GTAGGCAGTGAGTTGAAAGCCATGGTGCAGGCTCCACCTGGCTATGTCCTTGTGGGTGCT 2965 |||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||| Sbjct 2857 GTAGGCAGTGAGTTGAAAGCCATGGTGCAGGCCCCACCTGGCTACACCCTTGTGGGTGCT 2916 Query 2966 GATGTGGACTCACAGGAACTGTGGATCGCAGCTGTACTTGGAGATGCTCACTTTGCTGGG 3025 ||||||||||| || || |||||||| |||||||| |||||||| || |||||||| || Sbjct 2917 GATGTGGACTCTCAAGAGCTGTGGATTGCAGCTGTGCTTGGAGACGCCCACTTTGCCGGC 2976 Query 3026 ATGCATGGCTGCACGGCCTTTGGCTGGATGACTCTGCAGGGCAGGAAGAGCAGAGGCACT 3085 |||||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||| Sbjct 2977 ATGCATGGCTGCACAGCCTTTGGATGGATGACACTGCAGGGCAGGAAGAGCAGGGGCACT 3036 Query 3086 GATCTGCACAGCAAGACAGCTGCCACTGTGGGCATCAGCCGAGAGCATGCCAAAATCTTC 3145 ||||| ||||| |||||||| | || |||||||||||||| |||||||||||| ||||| Sbjct 3037 GATCTACACAGTAAGACAGCCACTACCGTGGGCATCAGCCGTGAGCATGCCAAAGTCTTC 3096 Query 3146 AACTATGGCCGCATCTATGGGGCTGGGCAGTCCTTTGCTGAGCGCCTACTGATGCAGTTC 3205 ||||| |||||||||||||||||||||||| |||||||||||||| |||| |||||||| Sbjct 3097 AACTACGGCCGCATCTATGGGGCTGGGCAGCCCTTTGCTGAGCGCTTACTAATGCAGTTT 3156 Query 3206 AACCACAGGCTCACA-AGGCAGGAGGCAGCTGAGAAGGCCCAGCAGATGTATGC-AGTCA 3263 |||||| ||||||| || |||||||||||||||||||||||||||||||| || | ||| Sbjct 3157 AACCACCGGCTCACGCAG-CAGGAGGCAGCTGAGAAGGCCCAGCAGATGTACGCCA-TCA 3214 Query 3264 CAAAAGGCCTGCGCCGGTATCGGCTGTCTGCGGATGGTGAGTGGCTGGTGAAACAGTTGA 3323 | || ||||| ||| ||||||||||||| | || || ||||||||||||| ||||| Sbjct 3215 CCAAGGGCCTCCGCTGGTATCGGCTGTCGGATGAGGGCGAGTGGCTGGTGAGGGAGTTGC 3274 Query 3324 ATCTTCCTGTGGACAGGACAGAGGACGGCTGGGTCTCCCTACAAGATCTTCG-AATGATC 3382 | || || ||||||||||| |||| |||||| | ||||| || ||||| || || | || Sbjct 3275 ACCTCCCAGTGGACAGGACTGAGGGTGGCTGGATTTCCCTGCAGGATCTGCGCAAGG-TC 3333 Query 3383 C-GAAGAGAAGCTTCAAGGAAGTCACGAT-GGAAGAAGTGGGAGGTAGCCT-CTGAACGA 3439 | || |||||||| |||| ||||||| | |||||||||||||||| | | ||||||| Sbjct 3334 CAGA-GAGAAGCTGCAAGAAAGTCAC-ACCGGAAGAAGTGGGAGGT-GATTGCTGAACGG 3390 Query 3440 GCATGGACAGGGGG-CACAGAGTCAGAAATGTTTAATAAGCTGGAGAGTATTGCCATGTC 3498 ||||||| |||||| |||||||||||||||||| |||||||| ||||| ||||| | ||| Sbjct 3391 GCATGGA-AGGGGGGCACAGAGTCAGAAATGTTCAATAAGCTTGAGAGCATTGCTACGTC 3449 Query 3499 TGATACACCACGTACCCCAGTACTGGGCTGCTGCATCAGCAGAGCCTTGGAGCCCTCAGT 3558 ||| | |||||||||||| || ||||||||| |||||||| ||||| |||||||||| | Sbjct 3450 TGACATACCACGTACCCCGGTGCTGGGCTGCCGCATCAGCCGAGCCCTGGAGCCCTCGGC 3509 Query 3559 TGTCCAGGGAGAGTTTATAACCAGTCGTGTGAACTGGGTGGTACAGAGCTCTGCTGTAGA 3618 |||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| || Sbjct 3510 TGTCCAGGGAGAGTTTATGACCAGCCGTGTGAATTGGGTGGTACAGAGCTCTGCTGTTGA 3569 Query 3619 CTACTTACATCTCATGCTTGTGGCCATGAAGTGGCTGTTTGAGGAATTTGCCATTGATGG 3678 ||||||||| |||||||||||||||||||||||||||||||| || |||||||| ||||| Sbjct 3570 CTACTTACACCTCATGCTTGTGGCCATGAAGTGGCTGTTTGAAGAGTTTGCCATAGATGG 3629 Query 3679 GCGCTTCTGCATCAGCATCCACGACGAGGTTCGCTACCTGGTGCGTGAGGAGGACCGCTA 3738 ||||||||||||||||||||| ||||| ||||||||||||||||| |||||||||||||| Sbjct 3630 GCGCTTCTGCATCAGCATCCATGACGAAGTTCGCTACCTGGTGCGGGAGGAGGACCGCTA 3689 Query 3739 CCGTGCCGCCCTGGCACTGCAGATCACCAATCTCCTGACCAGGTGCATGTTTGCCTATAA 3798 |||||| |||||||| |||||||||||||| ||| |||||||||||||||||||||| || Sbjct 3690 CCGTGCTGCCCTGGCCCTGCAGATCACCAACCTCTTGACCAGGTGCATGTTTGCCTACAA 3749 Query 3799 GCTGGGTCTGAATGATCT-GCCCCAGTCAGTCGCCTTTTTCAGTGCAGTAGACATTGACC 3857 ||||||||||||||| || |||||||||||||||||||||||||||||| || ||||||| Sbjct 3750 GCTGGGTCTGAATGA-CTTGCCCCAGTCAGTCGCCTTTTTCAGTGCAGTTGATATTGACC 3808 Query 3858 AGTGCCTCAGGAAGGAAGTGACCATGGACTGTAAAACTCCTTCTAACCCAACTGGGATGG 3917 ||||||||||||||||||||||||||| |||||||| ||||| |||||||||||||||| Sbjct 3809 GGTGCCTCAGGAAGGAAGTGACCATGGATTGTAAAACCCCTTCCAACCCAACTGGGATGG 3868 Query 3918 AAAGGAGATATGGGATCCCCCAGGGTGAAGCACTGGATATTTACCAGATAATTGAACTCA 3977 |||||||||| ||||| |||||||||||||| |||||||||||||||||||||||||||| Sbjct 3869 AAAGGAGATACGGGATTCCCCAGGGTGAAGCGCTGGATATTTACCAGATAATTGAACTCA 3928 Query 3978 CCAAAGGCTCCTTGGAAAAACGAAGCCAGCCTGGACCCTAGCTCTGTCTGGAGGTTCTGT 4037 ||||||||||||||||||||||||||||||||||||| |||| ||| ||||||| ||||| Sbjct 3929 CCAAAGGCTCCTTGGAAAAACGAAGCCAGCCTGGACCATAGCACTGCCTGGAGGCTCTGT 3988 Query 4038 ATTTGCTCCTGTGGAGCTTTATTGGAGCGGTGCAGGTTCCTAAACTCAGGCTTTCAGATG 4097 ||||||||| |||||||| || || |||||||||| ||| |||||||||||||||| || Sbjct 3989 ATTTGCTCCCATGGAGCTTCATCGGGGCGGTGCAGGCTCCCAAACTCAGGCTTTCAGCTG 4048 Query 4098 TGCTTTTTTGCAAAAGG-C------A-G-CCA----TTTTTCTGTAGCAGGACCTGCCCA 4144 |||||||| |||||||| | | | ||| |||||| ||||||||||||||| | Sbjct 4049 TGCTTTTT-GCAAAAGGGCTTGCCTAAGGCCAGCCATTTTTCAGTAGCAGGACCTGCCAA 4107 Query 4145 GGAA-AGTCCTCCTAACGGAAGG--CAC---AATTCAGTGCGTTCAGAACCAGGACACCA 4198 | || | |||| ||||| ||||| || ||||||||| ||||||||| | || ||| Sbjct 4108 G-AAGATTCCTTCTAACTGAAGGTGCAGTTGAATTCAGTGGGTTCAGAACTAAGATGCCA 4166 Query 4199 ACATCAGTGCAGGCTGT-GTGACAAGGGGTA------CT-GTTGGGCACAAATGAAGCAG 4250 ||||| ||| |||||| | ||||||||| | || |||||| | ||| ||||||| Sbjct 4167 ACATCGGTGTGGGCTGTAG-GACAAGGGGCATTGTTGCTTGTTGGGTAAAAACGAAGCAG 4225 Query 4251 ATGCCCCAAAGGTCACATTAACTCAGGCATTTC-TTCCT-----CCT---CTTCTTGGCT 4301 | ||||||||| ||||||||||||||||||||| || | ||| |||||||||| Sbjct 4226 AAGCCCCAAAGTTCACATTAACTCAGGCATTTCATTTATTTTTTCCTTTTCTTCTTGGCT 4285 Query 4302 GGTTCTCTGTCCTGCTGTGTATG-TGCTGATGCAGTGCCCTAGAAGGG 4348 |||||| ||| ||| | ||| | |||||||||||||||||||||| Sbjct 4286 GGTTCTTTGTTCTGTTCACCATGCT-CTGATGCAGTGCCCTAGAAGGG 4332 >gb|U60325.1|HSU60325 UniGene infoGeoGene info Human DNA polymerase gamma mRNA, nuclear gene encoding mitochondrial protein, complete cds Length=4320 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 4277 bits (2316), Expect = 0.0 Identities = 3427/3950 (86%), Gaps = 129/3950 (3%) Strand=Plus/Plus Query 489 CGCAAATGCCCTCCTCCGAGAATGGGCAGCTGCGGCTCAACCC-TCTGCTCATCCAGATG 547 ||||| ||| ||||| ||| ||||||||||||| |||||| | || |||||||||| Sbjct 335 CGCAAGTGCTATCCTCGGAGGGCGGGCAGCTGCGGCACAACCCAT-TGGACATCCAGATG 393 Query 548 TTGTCGAGAGGCCTGCACGAGCAGATCTTCGGGTGCGGCGGGGAAATGCCCGACGAGGCC 607 | |||||||| ||||||||||| ||||||||| || ||||| ||||| | ||||||| Sbjct 394 CTCTCGAGAGGGCTGCACGAGCAAATCTTCGGGCAAGGAGGGGAGATGCCTGGCGAGGCC 453 Query 608 GCGGTGCAG-CGCAGCGTAGAGCACCTGCAGAAGCACGGGCTCTGGGGGCAGCCGGCCAC 666 ||||||| | |||||||| ||||||||||||||||||||||||||||||||||| ||| Sbjct 454 GCGGTGC-GCCGCAGCGTCGAGCACCTGCAGAAGCACGGGCTCTGGGGGCAGCCAGCCGT 512 Query 667 GCCCTTGCCAGACGTGGAGCTGCGCCTGCC-CCGGCTCTTCGGGGGCAACCTGGACCAGC 725 ||||||||| |||||||||||||||||||| || |||| ||||| |||||||||||||| Sbjct 513 GCCCTTGCCCGACGTGGAGCTGCGCCTGCCGCC-CCTCTACGGGGACAACCTGGACCAGC 571 Query 726 ACTTCCGCCTCCTGGCCCAGAAGCAGAGCCTGCCTTACTTGGAGGCGGCCGCCTCGTTAT 785 |||||||||||||||||||||||||||||||||| ||| ||||||||||| || | | | Sbjct 572 ACTTCCGCCTCCTGGCCCAGAAGCAGAGCCTGCCCTACCTGGAGGCGGCCAACTTGCTGT 631 Query 786 TGGAGGCCCAATTGCCCCCCG-AGCCCAAGAGC-TGGGCCTGGGCGGAGGGCTGGACCCG 843 || ||||||| || |||||| ||||| | || |||||||||||||||||||||||||| Sbjct 632 TGCAGGCCCAGCTG-CCCCCGAAGCCCCCG-GCTTGGGCCTGGGCGGAGGGCTGGACCCG 689 Query 844 GTACGGCCCCGAGGGGGAGGCCGAACCCGTGGCCATCCCCGAGGAGCGGGCCCTGGTGTT 903 ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| Sbjct 690 GTACGGCCCCGAGGGGGAGGCCGTACCCGTGGCCATCCCCGAGGAGCGGGCCCTGGTGTT 749 Query 904 CGACGTGGAGGTCTGCTTGGCAGAGGGAACCTGCCCCACTTTGGCGGTGGCCATATCCCC 963 |||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| Sbjct 750 CGACGTGGAGGTCTGCTTGGCAGAGGGAACTTGCCCCACATTGGCGGTGGCCATATCCCC 809 Query 964 CTCGGCCTGGTATTCCTGGTGCAGCCGGCGGCTGGTGGAAGAGCGTTACTCTTGGACCAG 1023 |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| Sbjct 810 CTCGGCCTGGTATTCCTGGTGCAGCCAGCGGCTGGTGGAAGAGCGTTACTCTTGGACCAG 869 Query 1024 CCAGCTATCGCCGGCTGACCTAATCCCTTTGGGGGGCTCC-ACTAGTGCCAGCAGCTCCA 1082 |||||| |||||||||||||| ||||| ||| || | || ||| ||||||||||| ||| Sbjct 870 CCAGCTGTCGCCGGCTGACCTCATCCCCCTGGAGGTC-CCTACTGGTGCCAGCAGCCCCA 928 Query 1083 CCAAGCAG-GA-TGGGCAGGAACAGTTAGTGGTGGGGCACAATGTTTCCTTTGACCGAGC 1140 || || || || | ||||||| |||||||||||||||||||||||||||||||||||||| Sbjct 929 CCCAG-AGAGACT-GGCAGGAGCAGTTAGTGGTGGGGCACAATGTTTCCTTTGACCGAGC 986 Query 1141 CCATATCAGGGAACAGTATCTGATTCAGGACTCCCGGATGCGTTTTCTCGATACTATGAG 1200 ||||||||||| ||||| ||||| |||| ||||| |||||||| || || || ||||| Sbjct 987 TCATATCAGGGAGCAGTACCTGATCCAGGGTTCCCGCATGCGTTTCCTGGACACCATGAG 1046 Query 1201 CATGCACATGGCCATCTCGGGGCTGAGCAGCTTCCAGCGCAGCCTGTGGATGGGAGCCAA 1260 |||||||||||||||||| ||||| ||||||||||||||||| |||||||| | |||||| Sbjct 1047 CATGCACATGGCCATCTCAGGGCTAAGCAGCTTCCAGCGCAGTCTGTGGATAGCAGCCAA 1106 Query 1261 GCAGGG-AAAGCACAAGACCCAGCAGTCCACAAAGCGAGGGCAGAAGTCCCCGAGGAAAG 1319 |||||| ||| |||||| ||||| ||||||||| ||| |||||||||| |||||||| Sbjct 1107 GCAGGGCAAA-CACAAGGTCCAGCCCCCCACAAAGCAAGGCCAGAAGTCCCAGAGGAAAG 1165 Query 1320 CC--AA-TGGTCCAGCGATCTCATCTTGGGACTGGATGGATATCAGCAGTGCCAATAATC 1376 || || || |||||||||||||| ||||||||| |||| |||||||||| ||| | || Sbjct 1166 CCAGAAGAGGCCCAGCGATCTCATCCTGGGACTGGCTGGACATCAGCAGTGTCAACAGTC 1225 Query 1377 TTGCAGATGTGCACA-ACCTTTATGT-GGGGGGACCTCCCTTAGAGAAGGAGCCTCGGGA 1434 | ||||| ||||||| | |||||||| |||||| ||||||||||||||||||||||| || Sbjct 1226 TGGCAGAGGTGCACAGA-CTTTATGTAGGGGGG-CCTCCCTTAGAGAAGGAGCCTCGAGA 1283 Query 1435 GCTGTTCGTCAAAGGCAGCATGAGGGATATCCGAGAGAACTTCCAGGATCTGATGCAGTA 1494 ||||| || || |||| ||||| ||| || || |||||||||||||| ||||||||||| Sbjct 1284 ACTGTTTGTGAAGGGCACCATGAAGGACATTCGTGAGAACTTCCAGGACCTGATGCAGTA 1343 Query 1495 CTGCGCCC-GTGATGTGTGGGCCACCTTTGAGGTTTTCCAGCAGCAGCTGCCACTCTTCT 1553 ||| |||| | || |||||||||||| ||||||||||||||||||||| || ||||||| Sbjct 1344 CTGTGCCCAG-GACGTGTGGGCCACCCATGAGGTTTTCCAGCAGCAGCTACCGCTCTTCT 1402 Query 1554 TGGAGAGGTGTCCCCACCCAGTGACTCTGGCTGGCATGCTGGAGATGGGTGTGTCCTACC 1613 ||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| Sbjct 1403 TGGAGAGGTGTCCCCACCCAGTGACTCTGGCCGGCATGCTGGAGATGGGTGTCTCCTACC 1462 Query 1614 TGCCTGTCAACCAGAACTGGGAGCGTTACCTGACAGAGGCACAGAACACATATGAGGAGC 1673 |||||||||||||||||||||||||||||||| ||||||||||| ||| |||||||||| Sbjct 1463 TGCCTGTCAACCAGAACTGGGAGCGTTACCTGGCAGAGGCACAGGGCACTTATGAGGAGC 1522 Query 1674 TCCAGCGGGAGATGAAGAAGTCGCTGATGGATCTGGCTAATGATGCCTGTCAGTTGCTCT 1733 ||||||||||||||||||||||| ||||||||||||| ||||||||||| ||| |||||| Sbjct 1523 TCCAGCGGGAGATGAAGAAGTCGTTGATGGATCTGGCCAATGATGCCTGCCAGCTGCTCT 1582 Query 1734 CAGGAGAGAGGTACAAAGAAGACCCTTGGCTCTGGGACCTAGAATGGGATTTGCAGGAGT 1793 ||||||||||||||||||||||||| |||||||||||||| || ||||| |||| || | Sbjct 1583 CAGGAGAGAGGTACAAAGAAGACCCCTGGCTCTGGGACCTGGAGTGGGACCTGCAAGAAT 1642 Query 1794 TTAAGCAGAA-AAAGGCAAAGAAGGTGAAGAA-G--CCAGCCTCAGCCAGCAAGTTGCCC 1849 |||||||||| ||| || |||||||||||||| | |||||| ||||||||||||||||| Sbjct 1643 TTAAGCAGAAGAAA-GCTAAGAAGGTGAAGAAGGAACCAGCCACAGCCAGCAAGTTGCCC 1701 Query 1850 ATCGAGGGAGCT-GGGCCCTTTGGGGATCCCATGGATCAGGAAGATCCT-GGCCCGC-CC 1906 |||||||| ||| |||||| ||| |||||||||||||||||||| ||| ||||| | | Sbjct 1702 ATCGAGGGGGCTGGGGCCC-CTGGTGATCCCATGGATCAGGAAGA-CCTCGGCCC-CTGC 1758 Query 1907 AGCGAGGAGGAGGAGCTTCAGCGAAG-TGTAACAGCCCACAACC-GGTTACAGCAGCTG- 1963 || |||||||||||| |||| | ||| ||| | |||| | || | || ||| ||||| Sbjct 1759 AGTGAGGAGGAGGAGTTTCAAC-AAGATGTCATGGCCCGC-GCCTGCTTGCAGAAGCTGA 1816 Query 1964 AGGAGCACCACGGACCTCCTGCCTAAGCGACCCCAGCACCTTCCAGGACACCCTGGGTGG 2023 ||| | ||||| || |||||||| ||||| |||||||||||||| ||||||||||| ||| Sbjct 1817 AGG-GGACCACAGAGCTCCTGCCCAAGCGGCCCCAGCACCTTCCTGGACACCCTGGATGG 1875 Query 2024 TACCGGAAGCTCTGCCCTCGACTAGATGACCCTGCCTGGGCTCCC-GGCCCCAGCCTCCT 2082 ||||||||||||||||| || ||||| |||||||| ||| | ||| |||||||||||||| Sbjct 1876 TACCGGAAGCTCTGCCCCCGGCTAGACGACCCTGCATGGAC-CCCGGGCCCCAGCCTCCT 1934 Query 2083 CAGCCTGCAAATGCGGGTCACTCCTAAGCTCATGGCACTGACCTGGGATGGTTTTCCTCT 2142 ||||||||| ||||||||||| ||||| ||||||||||| ||||||||||| || ||||| Sbjct 1935 CAGCCTGCAGATGCGGGTCACACCTAAACTCATGGCACTTACCTGGGATGGCTTCCCTCT 1994 Query 2143 ACACTACTCAGACTC-TCATGGTTGGGGCTACCTAGTGCCTGGGCGTCGGGATAATCTGA 2201 ||||||||||| | |||||| ||||||||| | ||||||||||| ||||| || ||| Sbjct 1995 GCACTACTCAGA-GCGTCATGGCTGGGGCTACTTGGTGCCTGGGCGGCGGGACAACCTGG 2053 Query 2202 CCGAGCCGCCAGTGA-GCCCCACTGTAGAATCCGCTGCAGTAACCTGCCCCTACAGAGCC 2260 || ||| ||| | | | |||| | || || |||| || |||||||||||||||| Sbjct 2054 CCAAGCTGCC-GACAGGTACCACCCTGGAGTCAGCTGGGGTGGTCTGCCCCTACAGAGCC 2112 Query 2261 ATCGAGTCCTTATACAGGAAGCACTGCCTTGAACAGGGGAAGCAGCAATTGGA-GCCCCA 2319 ||||||||| | |||||||||||||| || ||||||||||||||||| | || |||||| Sbjct 2113 ATCGAGTCCCTGTACAGGAAGCACTGTCTCGAACAGGGGAAGCAGCAGCT-GATGCCCCA 2171 Query 2320 GGAGGTAGACCTGGCTGAGGAGTTCTTACTCACTGACAGTAGTGCCATGTGGCAAACGGT 2379 ||||| | |||||| ||||||||| | |||||||||| ||||||||| ||||||||||| Sbjct 2172 GGAGGCCGGCCTGGCGGAGGAGTTCCTGCTCACTGACAATAGTGCCATATGGCAAACGGT 2231 Query 2380 AGAAGAACTGGGCTGCTTAGACGTAGAGGCTGAGGCCAAGATGGAGAA-TT-C-AG-GGC 2435 ||||||||||| | |||||| || ||||||||||||||||||||||| || | || || Sbjct 2232 AGAAGAACTGGATTACTTAGAAGTGGAGGCTGAGGCCAAGATGGAGAACTTGCGAGCTGC 2291 Query 2436 --TG--A-GCCAACCTCTAGTTCTGCCTG-CTGCTTGTGCCCCCAAATCCAGCCAGCCCA 2489 || | | ||||| |||| |||| ||| | | | ||| |||||| || |||||||| Sbjct 2292 AGTGCCAGGTCAACCCCTAGCTCTGACTGCCCG-TGGTGGCCCCAAGGACACCCAGCCCA 2350 Query 2490 CG-TATCACCATGGCAACGGACCTTATAATGATGTGAATATCCCTGGTTGCTGGTTTTTC 2548 | |||||||||||||| |||||||| || || ||| | |||||||| |||||||||||| Sbjct 2351 -GCTATCACCATGGCAATGGACCTTACAACGACGTGGACATCCCTGGCTGCTGGTTTTTC 2409 Query 2549 AAGCTGCCTCACAAGGACGGTAACAACTACAATGTGGGCAGTCCCTTTGCCAAAGATTTC 2608 ||||||||||||||||| ||||| | || |||||||| || ||||||||||| || ||| Sbjct 2410 AAGCTGCCTCACAAGGATGGTAATAGCTGTAATGTGGGAAGCCCCTTTGCCAAGGACTTC 2469 Query 2609 CTGCCCAAGATGGAGGATGGCACCCTGCAGGCTGGCCCAGGAGGTGCCAGTGGGCCTCGT 2668 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct 2470 CTGCCCAAGATGGAGGATGGCACCCTGCAGGCTGGCCCAGGAGGTGCCAGTGGGCCCCGT 2529 Query 2669 GCCCTGGAAATAAATAAAATGATTTCTTTTTGGAGGAATGCTCATAAACGTATCAGTTCC 2728 || |||||||| || |||||||||||||| |||||||| || |||||||||||||| ||| Sbjct 2530 GCTCTGGAAATCAACAAAATGATTTCTTTCTGGAGGAACGCCCATAAACGTATCAGCTCC 2589 Query 2729 CAGATGGTGGTATGGCTCCCCAGGTCAGCTCTGCCCCGGGTTGTGACCAGGCACCCC-AG 2787 ||||||||||| ||||| |||||||||||||||||||| | ||||| |||||||||| | Sbjct 2590 CAGATGGTGGTGTGGCTGCCCAGGTCAGCTCTGCCCCGTGCTGTGATCAGGCACCCCGA- 2648 Query 2788 CT-TCGATGAGGAAGGCCACTATGGGGCCATCCTACCCCAGGTGGTGACTGCTGGCACCA 2846 || | ||||||||||||| ||||||||||||||| ||||| ||||||||||| ||||||| Sbjct 2649 CTAT-GATGAGGAAGGCCTCTATGGGGCCATCCTGCCCCAAGTGGTGACTGCCGGCACCA 2707 Query 2847 TCACCCGTCGAGCTGTGGAGCCCACGTGGCTCACTGCCAGTAATGCTCGGCCTGACCGGG 2906 |||| || || |||||||||||||| |||||||| ||||| ||||| ||||||||||| | Sbjct 2708 TCACTCGCCGGGCTGTGGAGCCCACATGGCTCACCGCCAGCAATGCCCGGCCTGACCGAG 2767 Query 2907 TAGGCAGTGAGTTGAAAGCCATGGTGCAGGCTCCACCTGGCTATGTCCTTGTGGGTGCTG 2966 ||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| Sbjct 2768 TAGGCAGTGAGTTGAAAGCCATGGTGCAGGCCCCACCTGGCTACACCCTTGTGGGTGCTG 2827 Query 2967 ATGTGGACTCACAGGAACTGTGGATCGCAGCTGTACTTGGAGATGCTCACTTTGCTGGGA 3026 |||||||||| || || |||||||| |||||||| |||||||| || |||||||| || | Sbjct 2828 ATGTGGACTCCCAAGAGCTGTGGATTGCAGCTGTGCTTGGAGACGCCCACTTTGCCGGCA 2887 Query 3027 TGCATGGCTGCACGGCCTTTGGCTGGATGACTCTGCAGGGCAGGAAGAGCAGAGGCACTG 3086 ||||||||||||| |||||||| |||||||| |||||||||||||||||||| ||||||| Sbjct 2888 TGCATGGCTGCACAGCCTTTGGGTGGATGACACTGCAGGGCAGGAAGAGCAGGGGCACTG 2947 Query 3087 ATCTGCACAGCAAGACAGCTGCCACTGTGGGCATCAGCCGAGAGCATGCCAAAATCTTCA 3146 |||| ||||| |||||||| | ||||||||||||||||| ||||||||||||||||||| Sbjct 2948 ATCTACACAGTAAGACAGCCACTACTGTGGGCATCAGCCGTGAGCATGCCAAAATCTTCA 3007 Query 3147 ACTATGGCCGCATCTATGGGGCTGGGCAGTCCTTTGCTGAGCGCCTACTGATGCAGTTCA 3206 |||| |||||||||||||| ||||||||| |||||||||||||| |||| |||||||| | Sbjct 3008 ACTACGGCCGCATCTATGGTGCTGGGCAGCCCTTTGCTGAGCGCTTACTAATGCAGTTTA 3067 Query 3207 ACCACAGGCTCACA-AGGCAGGAGGCAGCTGAGAAGGCCCAGCAGATGTATGCAGTCACA 3265 ||||| |||||||| || |||||||||||||||||||||||||||||||| || | ||| Sbjct 3068 ACCACCGGCTCACACAG-CAGGAGGCAGCTGAGAAGGCCCAGCAGATGTACGCTGCCACC 3126 Query 3266 AAAGGCCTGCGCCGGTATCGGCTGTCTGCGGATGGTGAGTGGCTGGTGAAACAGTTGAAT 3325 || ||||| ||| ||||||||||||| | || || ||||||||||||| ||||||| Sbjct 3127 AAGGGCCTCCGCTGGTATCGGCTGTCGGATGAGGGCGAGTGGCTGGTGAGGGAGTTGAAC 3186 Query 3326 CTTCCTGTGGACAGGACAGAGGACGGCTGGGTCTCCCTACAAGATCTTCG-AATGATCC- 3383 || || ||||||||||| |||| |||||| | ||||| || ||||| || || | ||| Sbjct 3187 CTCCCAGTGGACAGGACTGAGGGTGGCTGGATTTCCCTGCAGGATCTGCGCAAGG-TCCA 3245 Query 3384 GAAGAGAAGCTTCAAGGAAGTCAC-GATGGAAGAAGTGGGAGGTAGCCT-CTGAACGAGC 3441 || ||||| || |||||||||||| | ||||||||||||||||| | | ||||||| || Sbjct 3246 GA-GAGAAACTGCAAGGAAGTCACAG-TGGAAGAAGTGGGAGGTGGT-TGCTGAACGGGC 3302 Query 3442 ATGGACAGGGGG-CACAGAGTCAGAAATGTTTAATAAGCTGGAGAGTATTGCCATGTCTG 3500 ||||| |||||| |||||||||||||||||| |||||||| ||||| ||||| | ||||| Sbjct 3303 ATGGA-AGGGGGGCACAGAGTCAGAAATGTTCAATAAGCTTGAGAGCATTGCTACGTCTG 3361 Query 3501 ATACACCACGTACCCCAGTACTGGGCTGCTGCATCAGCAGAGCCTTGGAGCCCTCAGTTG 3560 | | |||||||||||| || |||||||||||||||||| ||||| |||||||||| | || Sbjct 3362 ACATACCACGTACCCCGGTGCTGGGCTGCTGCATCAGCCGAGCCCTGGAGCCCTCGGCTG 3421 Query 3561 TCCAGGGAGAGTTTATAACCAGTCGTGTGAACTGGGTGGTACAGAGCTCTGCTGTAGACT 3620 |||||| ||||||||| ||||| |||||||| ||||||||||||||||||||||| |||| Sbjct 3422 TCCAGGAAGAGTTTATGACCAGCCGTGTGAATTGGGTGGTACAGAGCTCTGCTGTTGACT 3481 Query 3621 ACTTACATCTCATGCTTGTGGCCATGAAGTGGCTGTTTGAGGAATTTGCCATTGATGGGC 3680 ||||||| |||||||||||||||||||||||||||||||| || |||||||| ||||||| Sbjct 3482 ACTTACACCTCATGCTTGTGGCCATGAAGTGGCTGTTTGAAGAGTTTGCCATAGATGGGC 3541 Query 3681 GCTTCTGCATCAGCATCCACGACGAGGTTCGCTACCTGGTGCGTGAGGAGGACCGCTACC 3740 ||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||| Sbjct 3542 GCTTCTGCATCAGCATCCATGACGAGGTTCGCTACCTGGTGCGGGAGGAGGACCGCTACC 3601 Query 3741 GTGCCGCCCTGGCACT-GCAGATCACCAATCTCCTGACCAGGTGCATGTTTGCCTATAAG 3799 | || |||||||| || |||||||||||| ||| |||||||||||||||||||||| ||| Sbjct 3602 GCGCTGCCCTGGC-CTTGCAGATCACCAACCTCTTGACCAGGTGCATGTTTGCCTACAAG 3660 Query 3800 CTGGGTCTGAATGATCT-GCCCCAGTCAGTCGCCTTTTTCAGTGCAGTAGACATTGACCA 3858 |||||||||||||| || |||||||||||||||||||||||||||||| || ||||||| Sbjct 3661 CTGGGTCTGAATGA-CTTGCCCCAGTCAGTCGCCTTTTTCAGTGCAGTCGATATTGACCG 3719 Query 3859 GTGCCTCAGGAAGGAAGTGACCATGGACTGTAAAACTCCTTCTAACCCAACTGGGATGGA 3918 ||||||||||||||||||||||||||| |||||||| ||||| ||||||||||||||||| Sbjct 3720 GTGCCTCAGGAAGGAAGTGACCATGGATTGTAAAACCCCTTCCAACCCAACTGGGATGGA 3779 Query 3919 AAGGAGATATGGGATCCCCCAGGGTGAAGCACTGGATATTTACCAGATAATTGAACTCAC 3978 ||||||||| ||||| |||||||||||||| ||||||||||||||||||||||||||||| Sbjct 3780 AAGGAGATACGGGATTCCCCAGGGTGAAGCGCTGGATATTTACCAGATAATTGAACTCAC 3839 Query 3979 CAAAGGCTCCTTGGAAAAACGAAGCCAGCCTGGACCCTAGCTCTGTCTGGAGGTTCTGTA 4038 |||||||||||||||||||||||||||||||||||| |||| ||| ||||||| |||||| Sbjct 3840 CAAAGGCTCCTTGGAAAAACGAAGCCAGCCTGGACCATAGCACTGCCTGGAGGCTCTGTA 3899 Query 4039 TTTGCTCCTGTGGAGCTTTATTGGAGCGGTGCAGGTTCCTAAACTCAGGCTTTCAGATGT 4098 |||||||| ||||||||| || || | |||||||| ||| |||||||||||||||| ||| Sbjct 3900 TTTGCTCCCGTGGAGCTTCATCGGGGTGGTGCAGGCTCCCAAACTCAGGCTTTCAGCTGT 3959 Query 4099 GCTTTTTTGCAAAAGG-C-----A-G-CCA----TTTTTCTGTAGCAGGACCTGCCCAGG 4146 ||||||| |||||||| | | | ||| |||||| ||||||||||||||| || Sbjct 3960 GCTTTTT-GCAAAAGGGCTTGCTAAGGCCAGCCATTTTTCAGTAGCAGGACCTGCCAAG- 4017 Query 4147 AA-AGTCCTCCTAACGGAAGG--CAC---AATTCAGTGCGTTCAGAACCAGGACACCAAC 4200 || | |||| ||||| ||||| || ||||||||| ||||||||||| || ||||| Sbjct 4018 AAGATTCCTTCTAACTGAAGGTGCAGTTGAATTCAGTGGGTTCAGAACCAAGATGCCAAC 4077 Query 4201 ATCAGTGCAGG-CTGT-GTGACAAGGGGTA------CT-GTTGGGCACAAATGAAGCAGA 4251 ||| ||| || || | ||||||||| | || |||||| | |||||||||||| Sbjct 4078 ATCGGTGT-GGACTACAG-GACAAGGGGCATTGTTGCTTGTTGGGTAAAAATGAAGCAGA 4135 Query 4252 TGCCCCAAAGGTCACATTAACTCAGGCATTTC-TTCCT-----CCT---CTTCTTGGCTG 4302 ||||||||| ||||||||||||||||||||| || | ||| ||||||||||| Sbjct 4136 AGCCCCAAAGTTCACATTAACTCAGGCATTTCATTTATTTTTTCCTTTTCTTCTTGGCTG 4195 Query 4303 GTTCTCTGTCCTG-CTGTGTATG-TGCTGATGCAGTGCCCTAGAAGGGGA 4350 ||||| ||| ||| | ||| | |||||||||||||||||||||||| Sbjct 4196 GTTCTTTGTTCTGTCCCCC-ATGCT-CTGATGCAGTGCCCTAGAAGGGGA 4243 Score = 248 bits (134), Expect = 1e-61 Identities = 236/283 (83%), Gaps = 15/283 (5%) Strand=Plus/Plus Query 203 AGGACTTGTGTGAGGAAGGCAGGCATGGTGAGACCTATTTCACTGACAGGAGCA-CAGAG 261 |||| ||| | | |||||||||||||||| | ||| || ||||||||||||| | ||||| Sbjct 1 AGGATTTG-GGGTGGAAGGCAGGCATGGTCA-ACCCATGTCACTGACAGGAG-AGCAGAG 57 Query 262 AGGGGACGCGTCTCTCTCTGA-GTCTTTCGGCCACTAAAAGCAGTCAAGCTGGAGCCCAA 320 | |||| ||||||||| | ||||| | |||| |||||| || ||||||||||||||| Sbjct 58 A-CAGACGTGTCTCTCTC-CACGTCTTCCAGCCAGTAAAAGAAGCCAAGCTGGAGCCCAA 115 Query 321 AGCCCGGTGCCCCGACTCACAGCG-GGGGGCTCCCTGCACCAACCATGAGCCGCCTGCTC 379 |||| |||| | ||||| ||||| ||||| ||||||||||||||||||||||||||||| Sbjct 116 AGCCAGGTGTTCTGACTCCCAGCGTGGGGG-TCCCTGCACCAACCATGAGCCGCCTGCTC 174 Query 380 TGGAAGAAGGTGGCTGGCGCCAAGGTCGC-CTCAGGGCCAGTACCAGCAACCGCG-CGCT 437 |||| ||||||||| ||||||| |||| | ||||||| || ||||| ||| | |||| Sbjct 175 TGGAGGAAGGTGGCCGGCGCCACCGTCGGGC-CAGGGCCGGTTCCAGCT-CCGGGGCGCT 232 Query 438 GGGTCTCCAGCTCCGTCCTCGACC-CCGTCCCCAGCGACGGGC 479 |||||||||||||||||| || | ||| |||||||||||||| Sbjct 233 GGGTCTCCAGCTCCGTCCCCG-CGTCCGACCCCAGCGACGGGC 274 >gb|BC042571.1| UniGene infoGene info Homo sapiens polymerase (DNA directed), gamma, mRNA (cDNA clone MGC:21267 IMAGE:4384475), complete cds Length=4440 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 4274 bits (2314), Expect = 0.0 Identities = 3427/3951 (86%), Gaps = 130/3951 (3%) Strand=Plus/Plus Query 489 CGCAAATGCCCTCCTCCGAGAATGGGCAGCTGCGGCTCAACCC-TCTGCTCATCCAGATG 547 ||||| ||| ||||| ||| ||||||||||||| |||||| | || |||||||||| Sbjct 443 CGCAAGTGCTATCCTCGGAGGGCGGGCAGCTGCGGCACAACCCAT-TGGACATCCAGATG 501 Query 548 TTGTCGAGAGGCCTGCACGAGCAGATCTTCGGGTGCGGCGGGGAAATGCCCGACGAGGCC 607 | |||||||| ||||||||||| ||||||||| || ||||| ||||| | ||||||| Sbjct 502 CTCTCGAGAGGGCTGCACGAGCAAATCTTCGGGCAAGGAGGGGAGATGCCTGGCGAGGCC 561 Query 608 GCGGTGCAG-CGCAGCGTAGAGCACCTGCAGAAGCACGGGCTCTGGGGGCAGCCGGCCAC 666 ||||||| | |||||||| ||||||||||||||||||||||||||||||||||| ||| Sbjct 562 GCGGTGC-GCCGCAGCGTCGAGCACCTGCAGAAGCACGGGCTCTGGGGGCAGCCAGCCGT 620 Query 667 GCCCTTGCCAGACGTGGAGCTGCGCCTGCC-CCGGCTCTTCGGGGGCAACCTGGACCAGC 725 ||||||||| |||||||||||||||||||| || |||| ||||| |||||||||||||| Sbjct 621 GCCCTTGCCCGACGTGGAGCTGCGCCTGCCGCC-CCTCTACGGGGACAACCTGGACCAGC 679 Query 726 ACTTCCGCCTCCTGGCCCAGAAGCAGAGCCTGCCTTACTTGGAGGCGGCCGCCTCGTTAT 785 |||||||||||||||||||||||||||||||||| ||| ||||||||||| || | | | Sbjct 680 ACTTCCGCCTCCTGGCCCAGAAGCAGAGCCTGCCCTACCTGGAGGCGGCCAACTTGCTGT 739 Query 786 TGGAGGCCCAATTGCCCCCCG-AGCCCAAGAGC-TGGGCCTGGGCGGAGGGCTGGACCCG 843 || ||||||| || |||||| ||||| | || |||||||||||||||||||||||||| Sbjct 740 TGCAGGCCCAGCTG-CCCCCGAAGCCCCCG-GCTTGGGCCTGGGCGGAGGGCTGGACCCG 797 Query 844 GTACGGCCCCGAGGGGGAGGCCGAACCCGTGGCCATCCCCGAGGAGCGGGCCCTGGTGTT 903 ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| Sbjct 798 GTACGGCCCCGAGGGGGAGGCCGTACCCGTGGCCATCCCCGAGGAGCGGGCCCTGGTGTT 857 Query 904 CGACGTGGAGGTCTGCTTGGCAGAGGGAACCTGCCCCACTTTGGCGGTGGCCATATCCCC 963 |||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| Sbjct 858 CGACGTGGAGGTCTGCTTGGCAGAGGGAACTTGCCCCACATTGGCGGTGGCCATATCCCC 917 Query 964 CTCGGCCTGGTATTCCTGGTGCAGCCGGCGGCTGGTGGAAGAGCGTTACTCTTGGACCAG 1023 |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| Sbjct 918 CTCGGCCTGGTATTCCTGGTGCAGCCAGCGGCTGGTGGAAGAGCGTTACTCTTGGACCAG 977 Query 1024 CCAGCTATCGCCGGCTGACCTAATCCCTTTGGGGGGCTCC-ACTAGTGCCAGCAGCTCCA 1082 |||||| |||||||||||||| ||||| ||| || | || ||| ||||||||||| ||| Sbjct 978 CCAGCTGTCGCCGGCTGACCTCATCCCCCTGGAGGTC-CCTACTGGTGCCAGCAGCCCCA 1036 Query 1083 CCAAGCAG-GA-TGGGCAGGAACAGTTAGTGGTGGGGCACAATGTTTCCTTTGACCGAGC 1140 || || || || | ||||||| |||||||||||||||||||||||||||||||||||||| Sbjct 1037 CCCAG-AGAGACT-GGCAGGAGCAGTTAGTGGTGGGGCACAATGTTTCCTTTGACCGAGC 1094 Query 1141 CCATATCAGGGAACAGTATCTGATTCAGGACTCCCGGATGCGTTTTCTCGATACTATGAG 1200 ||||||||||| ||||| ||||| |||| ||||| |||||||| || || || ||||| Sbjct 1095 TCATATCAGGGAGCAGTACCTGATCCAGGGTTCCCGCATGCGTTTCCTGGACACCATGAG 1154 Query 1201 CATGCACATGGCCATCTCGGGGCTGAGCAGCTTCCAGCGCAGCCTGTGGATGGGAGCCAA 1260 |||||||||||||||||| ||||| ||||||||||||||||| |||||||| | |||||| Sbjct 1155 CATGCACATGGCCATCTCAGGGCTAAGCAGCTTCCAGCGCAGTCTGTGGATAGCAGCCAA 1214 Query 1261 GCAGGG-AAAGCACAAGACCCAGCAGTCCACAAAGCGAGGGCAGAAGTCCCCGAGGAAAG 1319 |||||| ||| |||||| ||||| ||||||||| ||| |||||||||| |||||||| Sbjct 1215 GCAGGGCAAA-CACAAGGTCCAGCCCCCCACAAAGCAAGGCCAGAAGTCCCAGAGGAAAG 1273 Query 1320 CC--AA-TGGTCCAGCGATCTCATCTTGGGACTGGATGGATATCAGCAGTGCCAATAATC 1376 || || || |||||||||||||| ||||||||| |||| |||||||||| ||| | || Sbjct 1274 CCAGAAGAGGCCCAGCGATCTCATCCTGGGACTGGCTGGACATCAGCAGTGTCAACAGTC 1333 Query 1377 TTGCAGATGTGCACA-ACCTTTATGT-GGGGGGACCTCCCTTAGAGAAGGAGCCTCGGGA 1434 | ||||| ||||||| | |||||||| |||||| ||||||||||||||||||||||| || Sbjct 1334 TGGCAGAGGTGCACAGA-CTTTATGTAGGGGGG-CCTCCCTTAGAGAAGGAGCCTCGAGA 1391 Query 1435 GCTGTTCGTCAAAGGCAGCATGAGGGATATCCGAGAGAACTTCCAGGATCTGATGCAGTA 1494 ||||| || || |||| ||||| ||| || || |||||||||||||| ||||||||||| Sbjct 1392 ACTGTTTGTGAAGGGCACCATGAAGGACATTCGTGAGAACTTCCAGGACCTGATGCAGTA 1451 Query 1495 CTGCGCCC-GTGATGTGTGGGCCACCTTTGAGGTTTTCCAGCAGCAGCTGCCACTCTTCT 1553 ||| |||| | || |||||||||||| ||||||||||||||||||||| || ||||||| Sbjct 1452 CTGTGCCCAG-GACGTGTGGGCCACCCATGAGGTTTTCCAGCAGCAGCTACCGCTCTTCT 1510 Query 1554 TGGAGAGGTGTCCCCACCCAGTGACTCTGGCTGGCATGCTGGAGATGGGTGTGTCCTACC 1613 ||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| Sbjct 1511 TGGAGAGGTGTCCCCACCCAGTGACTCTGGCCGGCATGCTGGAGATGGGTGTCTCCTACC 1570 Query 1614 TGCCTGTCAACCAGAACTGGGAGCGTTACCTGACAGAGGCACAGAACACATATGAGGAGC 1673 |||||||||||||||||||||||||||||||| ||||||||||| ||| |||||||||| Sbjct 1571 TGCCTGTCAACCAGAACTGGGAGCGTTACCTGGCAGAGGCACAGGGCACTTATGAGGAGC 1630 Query 1674 TCCAGCGGGAGATGAAGAAGTCGCTGATGGATCTGGCTAATGATGCCTGTCAGTTGCTCT 1733 ||||||||||||||||||||||| ||||||||||||| ||||||||||| ||| |||||| Sbjct 1631 TCCAGCGGGAGATGAAGAAGTCGTTGATGGATCTGGCCAATGATGCCTGCCAGCTGCTCT 1690 Query 1734 CAGGAGAGAGGTACAAAGAAGACCCTTGGCTCTGGGACCTAGAATGGGATTTGCAGGAGT 1793 ||||||||||||||||||||||||| |||||||||||||| || ||||| |||| || | Sbjct 1691 CAGGAGAGAGGTACAAAGAAGACCCCTGGCTCTGGGACCTGGAGTGGGACCTGCAAGAAT 1750 Query 1794 TTAAGCAGAA-AAAGGCAAAGAAGGTGAAGAA-G--CCAGCCTCAGCCAGCAAGTTGCCC 1849 |||||||||| ||| || |||||||||||||| | |||||| ||||||||||||||||| Sbjct 1751 TTAAGCAGAAGAAA-GCTAAGAAGGTGAAGAAGGAACCAGCCACAGCCAGCAAGTTGCCC 1809 Query 1850 ATCGAGGGAGCT-GGGCCCTTTGGGGATCCCATGGATCAGGAAGATCCT-GGCCCGC-CC 1906 |||||||| ||| |||||| ||| |||||||||||||||||||| ||| ||||| | | Sbjct 1810 ATCGAGGGGGCTGGGGCCC-CTGGTGATCCCATGGATCAGGAAGA-CCTCGGCCC-CTGC 1866 Query 1907 AGCGAGGAGGAGGAGCTTCAGCGAAG-TGTAACAGCCCACAACC-GGTTACAGCAGCTG- 1963 || |||||||||||| |||| | ||| ||| | |||| | || | || ||| ||||| Sbjct 1867 AGTGAGGAGGAGGAGTTTCAAC-AAGATGTCATGGCCCGC-GCCTGCTTGCAGAAGCTGA 1924 Query 1964 AGGAGCACCACGGACCTCCTGCCTAAGCGACCCCAGCACCTTCCAGGACACCCTGGGTGG 2023 ||| | ||||| || |||||||| ||||| |||||||||||||| ||||||||||| ||| Sbjct 1925 AGG-GGACCACAGAGCTCCTGCCCAAGCGGCCCCAGCACCTTCCTGGACACCCTGGATGG 1983 Query 2024 TACCGGAAGCTCTGCCCTCGACTAGATGACCCTGCCTGGGCTCCC-GGCCCCAGCCTCCT 2082 ||||||||||||||||| || ||||| |||||||| ||| | ||| |||||||||||||| Sbjct 1984 TACCGGAAGCTCTGCCCCCGGCTAGACGACCCTGCATGGAC-CCCGGGCCCCAGCCTCCT 2042 Query 2083 CAGCCTGCAAATGCGGGTCACTCCTAAGCTCATGGCACTGACCTGGGATGGTTTTCCTCT 2142 ||||||||| ||||||||||| ||||| ||||||||||| ||||||||||| || ||||| Sbjct 2043 CAGCCTGCAGATGCGGGTCACACCTAAACTCATGGCACTTACCTGGGATGGCTTCCCTCT 2102 Query 2143 ACACTACTCAGACTC-TCATGGTTGGGGCTACCTAGTGCCTGGGCGTCGGGATAATCTGA 2201 ||||||||||| | |||||| ||||||||| | ||||||||||| ||||| || ||| Sbjct 2103 GCACTACTCAGA-GCGTCATGGCTGGGGCTACTTGGTGCCTGGGCGGCGGGACAACCTGG 2161 Query 2202 CCGAGCCGCCAGTGA-GCCCCACTGTAGAATCCGCTGCAGTAACCTGCCCCTACAGAGCC 2260 || ||| ||| | | | |||| | || || |||| || |||||||||||||||| Sbjct 2162 CCAAGCTGCC-GACAGGTACCACCCTGGAGTCAGCTGGGGTGGTCTGCCCCTACAGAGCC 2220 Query 2261 ATCGAGTCCTTATACAGGAAGCACTGCCTTGAACAGGGGAAGCAGCAATTGGA-GCCCCA 2319 ||||||||| | |||||||||||||| || ||||||||||||||||| | || |||||| Sbjct 2221 ATCGAGTCCCTGTACAGGAAGCACTGTCTCGAACAGGGGAAGCAGCAGCT-GATGCCCCA 2279 Query 2320 GGAGGTAGACCTGGCTGAGGAGTTCTTACTCACTGACAGTAGTGCCATGTGGCAAACGGT 2379 ||||| | |||||| ||||||||| | |||||||||| ||||||||| ||||||||||| Sbjct 2280 GGAGGCCGGCCTGGCGGAGGAGTTCCTGCTCACTGACAATAGTGCCATATGGCAAACGGT 2339 Query 2380 AGAAGAACTGGGCTGCTTAGACGTAGAGGCTGAGGCCAAGATGGAGAA-TT-C-AG-GGC 2435 ||||||||||| | |||||| || ||||||||||||||||||||||| || | || || Sbjct 2340 AGAAGAACTGGATTACTTAGAAGTGGAGGCTGAGGCCAAGATGGAGAACTTGCGAGCTGC 2399 Query 2436 --TG--A-GCCAACCTCTAGTTCTGCCTG-CTGCTTGTGCCCCCAAATCCAGCCAGCCCA 2489 || | | ||||| |||| |||| ||| | | | ||| |||||| || |||||||| Sbjct 2400 AGTGCCAGGTCAACCCCTAGCTCTGACTGCCCG-TGGTGGCCCCAAGGACACCCAGCCCA 2458 Query 2490 CG-TATCACCATGGCAACGGACCTTATAATGATGTGAATATCCCTGGTTGCTGGTTTTTC 2548 | |||||||||||||| |||||||| || || ||| | |||||||| |||||||||||| Sbjct 2459 -GCTATCACCATGGCAATGGACCTTACAACGACGTGGACATCCCTGGCTGCTGGTTTTTC 2517 Query 2549 AAGCTGCCTCACAAGGACGGTAACAACTACAATGTGGGCAGTCCCTTTGCCAAAGATTTC 2608 ||||||||||||||||| ||||| | || |||||||| || ||||||||||| || ||| Sbjct 2518 AAGCTGCCTCACAAGGATGGTAATAGCTGTAATGTGGGAAGCCCCTTTGCCAAGGACTTC 2577 Query 2609 CTGCCCAAGATGGAGGATGGCACCCTGCAGGCTGGCCCAGGAGGTGCCAGTGGGCCTCGT 2668 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct 2578 CTGCCCAAGATGGAGGATGGCACCCTGCAGGCTGGCCCAGGAGGTGCCAGTGGGCCCCGT 2637 Query 2669 GCCCTGGAAATAAATAAAATGATTTCTTTTTGGAGGAATGCTCATAAACGTATCAGTTCC 2728 || |||||||| || |||||||||||||| |||||||| || |||||||||||||| ||| Sbjct 2638 GCTCTGGAAATCAACAAAATGATTTCTTTCTGGAGGAACGCCCATAAACGTATCAGCTCC 2697 Query 2729 CAGATGGTGGTATGGCTCCCCAGGTCAGCTCTGCCCCGGGTTGTGACCAGGCACCCC-AG 2787 ||||||||||| ||||| |||||||||||||||||||| | ||||| |||||||||| | Sbjct 2698 CAGATGGTGGTGTGGCTGCCCAGGTCAGCTCTGCCCCGTGCTGTGATCAGGCACCCCGA- 2756 Query 2788 CT-TCGATGAGGAAGGCCACTATGGGGCCATCCTACCCCAGGTGGTGACTGCTGGCACCA 2846 || | ||||||||||||| ||||||||||||||| ||||| ||||||||||| ||||||| Sbjct 2757 CTAT-GATGAGGAAGGCCTCTATGGGGCCATCCTGCCCCAAGTGGTGACTGCCGGCACCA 2815 Query 2847 TCACCCGTCGAGCTGTGGAGCCCACGTGGCTCACTGCCAGTAATGCTCGGCCTGACCGGG 2906 |||| || || |||||||||||||| |||||||| ||||| ||||| ||||||||||| | Sbjct 2816 TCACTCGCCGGGCTGTGGAGCCCACATGGCTCACCGCCAGCAATGCCCGGCCTGACCGAG 2875 Query 2907 TAGGCAGTGAGTTGAAAGCCATGGTGCAGGCTCCACCTGGCTATGTCCTTGTGGGTGCTG 2966 ||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| Sbjct 2876 TAGGCAGTGAGTTGAAAGCCATGGTGCAGGCCCCACCTGGCTACACCCTTGTGGGTGCTG 2935 Query 2967 ATGTGGACTCACAGGAACTGTGGATCGCAGCTGTACTTGGAGATGCTCACTTTGCTGGGA 3026 |||||||||| || || |||||||| |||||||| |||||||| || |||||||| || | Sbjct 2936 ATGTGGACTCCCAAGAGCTGTGGATTGCAGCTGTGCTTGGAGACGCCCACTTTGCCGGCA 2995 Query 3027 TGCATGGCTGCACGGCCTTTGGCTGGATGACTCTGCAGGGCAGGAAGAGCAGAGGCACTG 3086 ||||||||||||| |||||||| |||||||| |||||||||||||||||||| ||||||| Sbjct 2996 TGCATGGCTGCACAGCCTTTGGGTGGATGACACTGCAGGGCAGGAAGAGCAGGGGCACTG 3055 Query 3087 ATCTGCACAGCAAGACAGCTGCCACTGTGGGCATCAGCCGAGAGCATGCCAAAATCTTCA 3146 |||| ||||| |||||||| | ||||||||||||||||| ||||||||||||||||||| Sbjct 3056 ATCTACACAGTAAGACAGCCACTACTGTGGGCATCAGCCGTGAGCATGCCAAAATCTTCA 3115 Query 3147 ACTATGGCCGCATCTATGGGGCTGGGCAGTCCTTTGCTGAGCGCCTACTGATGCAGTTCA 3206 |||| |||||||||||||| ||||||||| |||||||||||||| |||| |||||||| | Sbjct 3116 ACTACGGCCGCATCTATGGTGCTGGGCAGCCCTTTGCTGAGCGCTTACTAATGCAGTTTA 3175 Query 3207 ACCACAGGCTCACA-AGGCAGGAGGCAGCTGAGAAGGCCCAGCAGATGTATGCAGTCACA 3265 ||||| |||||||| || |||||||||||||||||||||||||||||||| || | ||| Sbjct 3176 ACCACCGGCTCACACAG-CAGGAGGCAGCTGAGAAGGCCCAGCAGATGTACGCTGCCACC 3234 Query 3266 AAAGGCCTGCGCCGGTATCGGCTGTCTGCGGATGGTGAGTGGCTGGTGAAACAGTTGAAT 3325 || ||||| ||| ||||||||||||| | || || ||||||||||||| ||||||| Sbjct 3235 AAGGGCCTCCGCTGGTATCGGCTGTCGGATGAGGGCGAGTGGCTGGTGAGGGAGTTGAAC 3294 Query 3326 CTTCCTGTGGACAGGACAGAGGACGGCTGGGTCTCCCTACAAGATCTTCG-AATGATCC- 3383 || || ||||||||||| |||| |||||| | ||||| || ||||| || || | ||| Sbjct 3295 CTCCCAGTGGACAGGACTGAGGGTGGCTGGATTTCCCTGCAGGATCTGCGCAAGG-TCCA 3353 Query 3384 GAAGAGAAGCTTCAAGGAAGTCAC-GATGGAAGAAGTGGGAGGTAGCCT-CTGAACGAGC 3441 || ||||| || |||||||||||| | ||||||||||||||||| | | ||||||| || Sbjct 3354 GA-GAGAAACTGCAAGGAAGTCACAG-TGGAAGAAGTGGGAGGTGGT-TGCTGAACGGGC 3410 Query 3442 ATGGACAGGGGG-CACAGAGTCAGAAATGTTTAATAAGCTGGAGAGTATTGCCATGTCTG 3500 ||||| |||||| |||||||||||||||||| |||||||| ||||| ||||| | ||||| Sbjct 3411 ATGGA-AGGGGGGCACAGAGTCAGAAATGTTCAATAAGCTTGAGAGCATTGCTACGTCTG 3469 Query 3501 ATACACCACGTACCCCAGTACTGGGCTGCTGCATCAGCAGAGCCTTGGAGCCCTCAGTTG 3560 | | |||||||||||| || |||||||||||||||||| ||||| |||||||||| | || Sbjct 3470 ACATACCACGTACCCCGGTGCTGGGCTGCTGCATCAGCCGAGCCCTGGAGCCCTCGGCTG 3529 Query 3561 TCCAGGGAGAGTTTATAACCAGTCGTGTGAACTGGGTGGTACAGAGCTCTGCTGTAGACT 3620 |||||| ||||||||| ||||| |||||||| ||||||||||||||||||||||| |||| Sbjct 3530 TCCAGGAAGAGTTTATGACCAGCCGTGTGAATTGGGTGGTACAGAGCTCTGCTGTTGACT 3589 Query 3621 ACTTACATCTCATGCTTGTGGCCATGAAGTGGCTGTTTGAGGAATTTGCCATTGATGGGC 3680 ||||||| |||||||||||||||||||||||||||||||| || |||||||| ||||||| Sbjct 3590 ACTTACACCTCATGCTTGTGGCCATGAAGTGGCTGTTTGAAGAGTTTGCCATAGATGGGC 3649 Query 3681 GCTTCTGCATCAGCATCCACGACGAGGTTCGCTACCTGGTGCGTGAGGAGGACCGCTACC 3740 ||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||| Sbjct 3650 GCTTCTGCATCAGCATCCATGACGAGGTTCGCTACCTGGTGCGGGAGGAGGACCGCTACC 3709 Query 3741 GTGCCGCCCTGGCACT-GCAGATCACCAATCTCCTGACCAGGTGCATGTTTGCCTATAAG 3799 | || |||||||| || |||||||||||| ||| |||||||||||||||||||||| ||| Sbjct 3710 GCGCTGCCCTGGC-CTTGCAGATCACCAACCTCTTGACCAGGTGCATGTTTGCCTACAAG 3768 Query 3800 CTGGGTCTGAATGATCT-GCCCCAGTCAGTCGCCTTTTTCAGTGCAGTAGACATTGACCA 3858 |||||||||||||| || |||||||||||||||||||||||||||||| || ||||||| Sbjct 3769 CTGGGTCTGAATGA-CTTGCCCCAGTCAGTCGCCTTTTTCAGTGCAGTCGATATTGACCG 3827 Query 3859 GTGCCTCAGGAAGGAAGTGACCATGGACTGTAAAACTCCTTCTAACCCAACTGGGATGGA 3918 ||||||||||||||||||||||||||| |||||||| ||||| ||||||||||||||||| Sbjct 3828 GTGCCTCAGGAAGGAAGTGACCATGGATTGTAAAACCCCTTCCAACCCAACTGGGATGGA 3887 Query 3919 AAGGAGATATGGGATCCCCCAGGGTGAAGCACTGGATATTTACCAGATAATTGAACTCAC 3978 ||||||||| ||||| |||||||||||||| ||||||||||||||||||||||||||||| Sbjct 3888 AAGGAGATACGGGATTCCCCAGGGTGAAGCGCTGGATATTTACCAGATAATTGAACTCAC 3947 Query 3979 CAAAGGCTCCTTGGAAAAACGAAGCCAGCCTGGACCCTAGCTCTGTCTGGAGGTTCTGTA 4038 |||||||||||||||||||||||||||||||||||| |||| ||| ||||||| |||||| Sbjct 3948 CAAAGGCTCCTTGGAAAAACGAAGCCAGCCTGGACCATAGCACTGCCTGGAGGCTCTGTA 4007 Query 4039 TTTGCTCCTGTGGAGCTTTATTGGAGCGGTGCAGGTTCCTAAACTCAGGCTTTCAGATGT 4098 |||||||| ||||||||| || || | |||||||| ||| |||||||||||||||| ||| Sbjct 4008 TTTGCTCCCGTGGAGCTTCATCGGGGTGGTGCAGGCTCCCAAACTCAGGCTTTCAGCTGT 4067 Query 4099 GCTTTTTTGCAAAAGG-C------A-G-CCA----TTTTTCTGTAGCAGGACCTGCCCAG 4145 ||||||| |||||||| | | | ||| |||||| ||||||||||||||| || Sbjct 4068 GCTTTTT-GCAAAAGGGCTTGCCTAAGGCCAGCCATTTTTCAGTAGCAGGACCTGCCAAG 4126 Query 4146 GAA-AGTCCTCCTAACGGAAGG--CAC---AATTCAGTGCGTTCAGAACCAGGACACCAA 4199 || | |||| ||||| ||||| || ||||||||| ||||||||||| || |||| Sbjct 4127 -AAGATTCCTTCTAACTGAAGGTGCAGTTGAATTCAGTGGGTTCAGAACCAAGATGCCAA 4185 Query 4200 CATCAGTGCAGG-CTGT-GTGACAAGGGGTA------CT-GTTGGGCACAAATGAAGCAG 4250 |||| ||| || || | ||||||||| | || |||||| | ||||||||||| Sbjct 4186 CATCGGTGT-GGACTACAG-GACAAGGGGCATTGTTGCTTGTTGGGTAAAAATGAAGCAG 4243 Query 4251 ATGCCCCAAAGGTCACATTAACTCAGGCATTTC-TTCCT-----CCT---CTTCTTGGCT 4301 | ||||||||| ||||||||||||||||||||| || | ||| |||||||||| Sbjct 4244 AAGCCCCAAAGTTCACATTAACTCAGGCATTTCATTTATTTTTTCCTTTTCTTCTTGGCT 4303 Query 4302 GGTTCTCTGTCCTG-CTGTGTATG-TGCTGATGCAGTGCCCTAGAAGGGGA 4350 |||||| ||| ||| | ||| | |||||||||||||||||||||||| Sbjct 4304 GGTTCTTTGTTCTGTCCCCC-ATGCT-CTGATGCAGTGCCCTAGAAGGGGA 4352 Score = 309 bits (167), Expect = 6e-80 Identities = 320/391 (81%), Gaps = 21/391 (5%) Strand=Plus/Plus Query 100 GAGACCGCACGCCACCCTGAGGCTGCGTGGGCCGCGCG-CCGCGGACGCCGCGTCGT-CG 157 ||| || ||||| |||| |||||||||| ||||||||| | |||||||| | ||| | Sbjct 2 GAGGCCACACGCTACCCCGAGGCTGCGTAGGCCGCGCGAAGGGGGACGCCGTGCCGTGGG 61 Query 158 CC-GGGGCT-GTGGGCTGCCGCAGAACGGGAAGC-GCGAAGCGGACCGAGGACTTGTGTG 214 || |||| | | ||| || ||||| |||||||| || | |||||||||| ||| | | Sbjct 62 CCTGGGG-TCG-GGGGAGCAGCAGACCGGGAAGCACCG-TGAGGACCGAGGATTTG-GGG 117 Query 215 AGGAAGGCAGGCATGGTGAGACCTATTTCACTGACAGGAGCA-CAGAGAGGGGACGCGTC 273 |||||||||||||||| | ||| |||||||||||||||| | |||||| ||||| ||| Sbjct 118 TGGAAGGCAGGCATGGTCAAACCCATTTCACTGACAGGAG-AGCAGAGACAGGACGTGTC 176 Query 274 TCTCTCTGA-GTCTTTCGGCCACTAAAAGCAGTCAAGCTGGAGCCCAAAGCCCGGTGCCC 332 |||||| | ||||| | |||| |||||| || ||||||||||||||||||| |||| | Sbjct 177 TCTCTC-CACGTCTTCCAGCCAGTAAAAGAAGCCAAGCTGGAGCCCAAAGCCAGGTGTTC 235 Query 333 CGACTCACAGCG-GGGGGCTCCCTGCACCAACCATGAGCCGCCTGCTCTGGAAGAAGGTG 391 ||||| ||||| ||||| ||||||||||||||||||||||||||||||||| ||||||| Sbjct 236 TGACTCCCAGCGTGGGGG-TCCCTGCACCAACCATGAGCCGCCTGCTCTGGAGGAAGGTG 294 Query 392 GCTGGCGCCAAGGTCGC-CTCAGGGCCAGTACCAGCAACCGCG-CGCTGGGTCTCCAGCT 449 || ||||||| |||| | ||||||| || ||||| ||| | |||||||||||||||| Sbjct 295 GCCGGCGCCACCGTCGGGC-CAGGGCCGGTTCCAGCT-CCGGGGCGCTGGGTCTCCAGCT 352 Query 450 CCGTCCTCGACC-CCGTCCCCAGCGACGGGC 479 |||||| || | ||| |||||||||||||| Sbjct 353 CCGTCCCCG-CGTCCGACCCCAGCGACGGGC 382 >gb|BC050559.1| UniGene infoGene info Homo sapiens polymerase (DNA directed), gamma, mRNA (cDNA clone MGC:57709 IMAGE:6042595), complete cds Length=4503 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 4274 bits (2314), Expect = 0.0 Identities = 3427/3951 (86%), Gaps = 130/3951 (3%) Strand=Plus/Plus Query 489 CGCAAATGCCCTCCTCCGAGAATGGGCAGCTGCGGCTCAACCC-TCTGCTCATCCAGATG 547 ||||| ||| ||||| ||| ||||||||||||| |||||| | || |||||||||| Sbjct 427 CGCAAGTGCTATCCTCGGAGGGCGGGCAGCTGCGGCACAACCCAT-TGGACATCCAGATG 485 Query 548 TTGTCGAGAGGCCTGCACGAGCAGATCTTCGGGTGCGGCGGGGAAATGCCCGACGAGGCC 607 | |||||||| ||||||||||| ||||||||| || ||||| ||||| | ||||||| Sbjct 486 CTCTCGAGAGGGCTGCACGAGCAAATCTTCGGGCAAGGAGGGGAGATGCCTGGCGAGGCC 545 Query 608 GCGGTGCAG-CGCAGCGTAGAGCACCTGCAGAAGCACGGGCTCTGGGGGCAGCCGGCCAC 666 ||||||| | |||||||| ||||||||||||||||||||||||||||||||||| ||| Sbjct 546 GCGGTGC-GCCGCAGCGTCGAGCACCTGCAGAAGCACGGGCTCTGGGGGCAGCCAGCCGT 604 Query 667 GCCCTTGCCAGACGTGGAGCTGCGCCTGCC-CCGGCTCTTCGGGGGCAACCTGGACCAGC 725 ||||||||| |||||||||||||||||||| || |||| ||||| |||||||||||||| Sbjct 605 GCCCTTGCCCGACGTGGAGCTGCGCCTGCCGCC-CCTCTACGGGGACAACCTGGACCAGC 663 Query 726 ACTTCCGCCTCCTGGCCCAGAAGCAGAGCCTGCCTTACTTGGAGGCGGCCGCCTCGTTAT 785 |||||||||||||||||||||||||||||||||| ||| ||||||||||| || | | | Sbjct 664 ACTTCCGCCTCCTGGCCCAGAAGCAGAGCCTGCCCTACCTGGAGGCGGCCAACTTGCTGT 723 Query 786 TGGAGGCCCAATTGCCCCCCG-AGCCCAAGAGC-TGGGCCTGGGCGGAGGGCTGGACCCG 843 || ||||||| || |||||| ||||| | || |||||||||||||||||||||||||| Sbjct 724 TGCAGGCCCAGCTG-CCCCCGAAGCCCCCG-GCTTGGGCCTGGGCGGAGGGCTGGACCCG 781 Query 844 GTACGGCCCCGAGGGGGAGGCCGAACCCGTGGCCATCCCCGAGGAGCGGGCCCTGGTGTT 903 ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| Sbjct 782 GTACGGCCCCGAGGGGGAGGCCGTACCCGTGGCCATCCCCGAGGAGCGGGCCCTGGTGTT 841 Query 904 CGACGTGGAGGTCTGCTTGGCAGAGGGAACCTGCCCCACTTTGGCGGTGGCCATATCCCC 963 |||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| Sbjct 842 CGACGTGGAGGTCTGCTTGGCAGAGGGAACTTGCCCCACATTGGCGGTGGCCATATCCCC 901 Query 964 CTCGGCCTGGTATTCCTGGTGCAGCCGGCGGCTGGTGGAAGAGCGTTACTCTTGGACCAG 1023 |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| Sbjct 902 CTCGGCCTGGTATTCCTGGTGCAGCCAGCGGCTGGTGGAAGAGCGTTACTCTTGGACCAG 961 Query 1024 CCAGCTATCGCCGGCTGACCTAATCCCTTTGGGGGGCTCC-ACTAGTGCCAGCAGCTCCA 1082 |||||| |||||||||||||| ||||| ||| || | || ||| ||||||||||| ||| Sbjct 962 CCAGCTGTCGCCGGCTGACCTCATCCCCCTGGAGGTC-CCTACTGGTGCCAGCAGCCCCA 1020 Query 1083 CCAAGCAG-GA-TGGGCAGGAACAGTTAGTGGTGGGGCACAATGTTTCCTTTGACCGAGC 1140 || || || || | ||||||| |||||||||||||||||||||||||||||||||||||| Sbjct 1021 CCCAG-AGAGACT-GGCAGGAGCAGTTAGTGGTGGGGCACAATGTTTCCTTTGACCGAGC 1078 Query 1141 CCATATCAGGGAACAGTATCTGATTCAGGACTCCCGGATGCGTTTTCTCGATACTATGAG 1200 ||||||||||| ||||| ||||| |||| ||||| |||||||| || || || ||||| Sbjct 1079 TCATATCAGGGAGCAGTACCTGATCCAGGGTTCCCGCATGCGTTTCCTGGACACCATGAG 1138 Query 1201 CATGCACATGGCCATCTCGGGGCTGAGCAGCTTCCAGCGCAGCCTGTGGATGGGAGCCAA 1260 |||||||||||||||||| ||||| ||||||||||||||||| |||||||| | |||||| Sbjct 1139 CATGCACATGGCCATCTCAGGGCTAAGCAGCTTCCAGCGCAGTCTGTGGATAGCAGCCAA 1198 Query 1261 GCAGGG-AAAGCACAAGACCCAGCAGTCCACAAAGCGAGGGCAGAAGTCCCCGAGGAAAG 1319 |||||| ||| |||||| ||||| ||||||||| ||| |||||||||| |||||||| Sbjct 1199 GCAGGGCAAA-CACAAGGTCCAGCCCCCCACAAAGCAAGGCCAGAAGTCCCAGAGGAAAG 1257 Query 1320 CC--AA-TGGTCCAGCGATCTCATCTTGGGACTGGATGGATATCAGCAGTGCCAATAATC 1376 || || || |||||||||||||| ||||||||| |||| |||||||||| ||| | || Sbjct 1258 CCAGAAGAGGCCCAGCGATCTCATCCTGGGACTGGCTGGACATCAGCAGTGTCAACAGTC 1317 Query 1377 TTGCAGATGTGCACA-ACCTTTATGT-GGGGGGACCTCCCTTAGAGAAGGAGCCTCGGGA 1434 | ||||| ||||||| | |||||||| |||||| ||||||||||||||||||||||| || Sbjct 1318 TGGCAGAGGTGCACAGA-CTTTATGTAGGGGGG-CCTCCCTTAGAGAAGGAGCCTCGAGA 1375 Query 1435 GCTGTTCGTCAAAGGCAGCATGAGGGATATCCGAGAGAACTTCCAGGATCTGATGCAGTA 1494 ||||| || || |||| ||||| ||| || || |||||||||||||| ||||||||||| Sbjct 1376 ACTGTTTGTGAAGGGCACCATGAAGGACATTCGTGAGAACTTCCAGGACCTGATGCAGTA 1435 Query 1495 CTGCGCCC-GTGATGTGTGGGCCACCTTTGAGGTTTTCCAGCAGCAGCTGCCACTCTTCT 1553 ||| |||| | || |||||||||||| ||||||||||||||||||||| || ||||||| Sbjct 1436 CTGTGCCCAG-GACGTGTGGGCCACCCATGAGGTTTTCCAGCAGCAGCTACCGCTCTTCT 1494 Query 1554 TGGAGAGGTGTCCCCACCCAGTGACTCTGGCTGGCATGCTGGAGATGGGTGTGTCCTACC 1613 ||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| Sbjct 1495 TGGAGAGGTGTCCCCACCCAGTGACTCTGGCCGGCATGCTGGAGATGGGTGTCTCCTACC 1554 Query 1614 TGCCTGTCAACCAGAACTGGGAGCGTTACCTGACAGAGGCACAGAACACATATGAGGAGC 1673 |||||||||||||||||||||||||||||||| ||||||||||| ||| |||||||||| Sbjct 1555 TGCCTGTCAACCAGAACTGGGAGCGTTACCTGGCAGAGGCACAGGGCACTTATGAGGAGC 1614 Query 1674 TCCAGCGGGAGATGAAGAAGTCGCTGATGGATCTGGCTAATGATGCCTGTCAGTTGCTCT 1733 ||||||||||||||||||||||| ||||||||||||| ||||||||||| ||| |||||| Sbjct 1615 TCCAGCGGGAGATGAAGAAGTCGTTGATGGATCTGGCCAATGATGCCTGCCAGCTGCTCT 1674 Query 1734 CAGGAGAGAGGTACAAAGAAGACCCTTGGCTCTGGGACCTAGAATGGGATTTGCAGGAGT 1793 ||||||||||||||||||||||||| |||||||||||||| || ||||| |||| || | Sbjct 1675 CAGGAGAGAGGTACAAAGAAGACCCCTGGCTCTGGGACCTGGAGTGGGACCTGCAAGAAT 1734 Query 1794 TTAAGCAGAA-AAAGGCAAAGAAGGTGAAGAA-G--CCAGCCTCAGCCAGCAAGTTGCCC 1849 |||||||||| ||| || |||||||||||||| | |||||| ||||||||||||||||| Sbjct 1735 TTAAGCAGAAGAAA-GCTAAGAAGGTGAAGAAGGAACCAGCCACAGCCAGCAAGTTGCCC 1793 Query 1850 ATCGAGGGAGCT-GGGCCCTTTGGGGATCCCATGGATCAGGAAGATCCT-GGCCCGC-CC 1906 |||||||| ||| |||||| ||| |||||||||||||||||||| ||| ||||| | | Sbjct 1794 ATCGAGGGGGCTGGGGCCC-CTGGTGATCCCATGGATCAGGAAGA-CCTCGGCCC-CTGC 1850 Query 1907 AGCGAGGAGGAGGAGCTTCAGCGAAG-TGTAACAGCCCACAACC-GGTTACAGCAGCTG- 1963 || |||||||||||| |||| | ||| ||| | |||| | || | || ||| ||||| Sbjct 1851 AGTGAGGAGGAGGAGTTTCAAC-AAGATGTCATGGCCCGC-GCCTGCTTGCAGAAGCTGA 1908 Query 1964 AGGAGCACCACGGACCTCCTGCCTAAGCGACCCCAGCACCTTCCAGGACACCCTGGGTGG 2023 ||| | ||||| || |||||||| ||||| |||||||||||||| ||||||||||| ||| Sbjct 1909 AGG-GGACCACAGAGCTCCTGCCCAAGCGGCCCCAGCACCTTCCTGGACACCCTGGATGG 1967 Query 2024 TACCGGAAGCTCTGCCCTCGACTAGATGACCCTGCCTGGGCTCCC-GGCCCCAGCCTCCT 2082 ||||||||||||||||| || ||||| |||||||| ||| | ||| |||||||||||||| Sbjct 1968 TACCGGAAGCTCTGCCCCCGGCTAGACGACCCTGCATGGAC-CCCGGGCCCCAGCCTCCT 2026 Query 2083 CAGCCTGCAAATGCGGGTCACTCCTAAGCTCATGGCACTGACCTGGGATGGTTTTCCTCT 2142 ||||||||| ||||||||||| ||||| ||||||||||| ||||||||||| || ||||| Sbjct 2027 CAGCCTGCAGATGCGGGTCACACCTAAACTCATGGCACTTACCTGGGATGGCTTCCCTCT 2086 Query 2143 ACACTACTCAGACTC-TCATGGTTGGGGCTACCTAGTGCCTGGGCGTCGGGATAATCTGA 2201 ||||||||||| | |||||| ||||||||| | ||||||||||| ||||| || ||| Sbjct 2087 GCACTACTCAGA-GCGTCATGGCTGGGGCTACTTGGTGCCTGGGCGGCGGGACAACCTGG 2145 Query 2202 CCGAGCCGCCAGTGA-GCCCCACTGTAGAATCCGCTGCAGTAACCTGCCCCTACAGAGCC 2260 || ||| ||| | | | |||| | || || |||| || |||||||||||||||| Sbjct 2146 CCAAGCTGCC-GACAGGTACCACCCTGGAGTCAGCTGGGGTGGTCTGCCCCTACAGAGCC 2204 Query 2261 ATCGAGTCCTTATACAGGAAGCACTGCCTTGAACAGGGGAAGCAGCAATTGGA-GCCCCA 2319 ||||||||| | |||||||||||||| || ||||||||||||||||| | || |||||| Sbjct 2205 ATCGAGTCCCTGTACAGGAAGCACTGTCTCGAACAGGGGAAGCAGCAGCT-GATGCCCCA 2263 Query 2320 GGAGGTAGACCTGGCTGAGGAGTTCTTACTCACTGACAGTAGTGCCATGTGGCAAACGGT 2379 ||||| | |||||| ||||||||| | |||||||||| ||||||||| ||||||||||| Sbjct 2264 GGAGGCCGGCCTGGCGGAGGAGTTCCTGCTCACTGACAATAGTGCCATATGGCAAACGGT 2323 Query 2380 AGAAGAACTGGGCTGCTTAGACGTAGAGGCTGAGGCCAAGATGGAGAA-TT-C-AG-GGC 2435 ||||||||||| | |||||| || ||||||||||||||||||||||| || | || || Sbjct 2324 AGAAGAACTGGATTACTTAGAAGTGGAGGCTGAGGCCAAGATGGAGAACTTGCGAGCTGC 2383 Query 2436 --TG--A-GCCAACCTCTAGTTCTGCCTG-CTGCTTGTGCCCCCAAATCCAGCCAGCCCA 2489 || | | ||||| |||| |||| ||| | | | ||| |||||| || |||||||| Sbjct 2384 AGTGCCAGGTCAACCCCTAGCTCTGACTGCCCG-TGGTGGCCCCAAGGACACCCAGCCCA 2442 Query 2490 CG-TATCACCATGGCAACGGACCTTATAATGATGTGAATATCCCTGGTTGCTGGTTTTTC 2548 | |||||||||||||| |||||||| || || ||| | |||||||| |||||||||||| Sbjct 2443 -GCTATCACCATGGCAATGGACCTTACAACGACGTGGACATCCCTGGCTGCTGGTTTTTC 2501 Query 2549 AAGCTGCCTCACAAGGACGGTAACAACTACAATGTGGGCAGTCCCTTTGCCAAAGATTTC 2608 ||||||||||||||||| ||||| | || |||||||| || ||||||||||| || ||| Sbjct 2502 AAGCTGCCTCACAAGGATGGTAATAGCTGTAATGTGGGAAGCCCCTTTGCCAAGGACTTC 2561 Query 2609 CTGCCCAAGATGGAGGATGGCACCCTGCAGGCTGGCCCAGGAGGTGCCAGTGGGCCTCGT 2668 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct 2562 CTGCCCAAGATGGAGGATGGCACCCTGCAGGCTGGCCCAGGAGGTGCCAGTGGGCCCCGT 2621 Query 2669 GCCCTGGAAATAAATAAAATGATTTCTTTTTGGAGGAATGCTCATAAACGTATCAGTTCC 2728 || |||||||| || |||||||||||||| |||||||| || |||||||||||||| ||| Sbjct 2622 GCTCTGGAAATCAACAAAATGATTTCTTTCTGGAGGAACGCCCATAAACGTATCAGCTCC 2681 Query 2729 CAGATGGTGGTATGGCTCCCCAGGTCAGCTCTGCCCCGGGTTGTGACCAGGCACCCC-AG 2787 ||||||||||| ||||| |||||||||||||||||||| | ||||| |||||||||| | Sbjct 2682 CAGATGGTGGTGTGGCTGCCCAGGTCAGCTCTGCCCCGTGCTGTGATCAGGCACCCCGA- 2740 Query 2788 CT-TCGATGAGGAAGGCCACTATGGGGCCATCCTACCCCAGGTGGTGACTGCTGGCACCA 2846 || | ||||||||||||| ||||||||||||||| ||||| ||||||||||| ||||||| Sbjct 2741 CTAT-GATGAGGAAGGCCTCTATGGGGCCATCCTGCCCCAAGTGGTGACTGCCGGCACCA 2799 Query 2847 TCACCCGTCGAGCTGTGGAGCCCACGTGGCTCACTGCCAGTAATGCTCGGCCTGACCGGG 2906 |||| || || |||||||||||||| |||||||| ||||| ||||| ||||||||||| | Sbjct 2800 TCACTCGCCGGGCTGTGGAGCCCACATGGCTCACCGCCAGCAATGCCCGGCCTGACCGAG 2859 Query 2907 TAGGCAGTGAGTTGAAAGCCATGGTGCAGGCTCCACCTGGCTATGTCCTTGTGGGTGCTG 2966 ||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| Sbjct 2860 TAGGCAGTGAGTTGAAAGCCATGGTGCAGGCCCCACCTGGCTACACCCTTGTGGGTGCTG 2919 Query 2967 ATGTGGACTCACAGGAACTGTGGATCGCAGCTGTACTTGGAGATGCTCACTTTGCTGGGA 3026 |||||||||| || || |||||||| |||||||| |||||||| || |||||||| || | Sbjct 2920 ATGTGGACTCCCAAGAGCTGTGGATTGCAGCTGTGCTTGGAGACGCCCACTTTGCCGGCA 2979 Query 3027 TGCATGGCTGCACGGCCTTTGGCTGGATGACTCTGCAGGGCAGGAAGAGCAGAGGCACTG 3086 ||||||||||||| |||||||| |||||||| |||||||||||||||||||| ||||||| Sbjct 2980 TGCATGGCTGCACAGCCTTTGGGTGGATGACACTGCAGGGCAGGAAGAGCAGGGGCACTG 3039 Query 3087 ATCTGCACAGCAAGACAGCTGCCACTGTGGGCATCAGCCGAGAGCATGCCAAAATCTTCA 3146 |||| ||||| |||||||| | ||||||||||||||||| ||||||||||||||||||| Sbjct 3040 ATCTACACAGTAAGACAGCCACTACTGTGGGCATCAGCCGTGAGCATGCCAAAATCTTCA 3099 Query 3147 ACTATGGCCGCATCTATGGGGCTGGGCAGTCCTTTGCTGAGCGCCTACTGATGCAGTTCA 3206 |||| |||||||||||||| ||||||||| |||||||||||||| |||| |||||||| | Sbjct 3100 ACTACGGCCGCATCTATGGTGCTGGGCAGCCCTTTGCTGAGCGCTTACTAATGCAGTTTA 3159 Query 3207 ACCACAGGCTCACA-AGGCAGGAGGCAGCTGAGAAGGCCCAGCAGATGTATGCAGTCACA 3265 ||||| |||||||| || |||||||||||||||||||||||||||||||| || | ||| Sbjct 3160 ACCACCGGCTCACACAG-CAGGAGGCAGCTGAGAAGGCCCAGCAGATGTACGCTGCCACC 3218 Query 3266 AAAGGCCTGCGCCGGTATCGGCTGTCTGCGGATGGTGAGTGGCTGGTGAAACAGTTGAAT 3325 || ||||| ||| ||||||||||||| | || || ||||||||||||| ||||||| Sbjct 3219 AAGGGCCTCCGCTGGTATCGGCTGTCGGATGAGGGCGAGTGGCTGGTGAGGGAGTTGAAC 3278 Query 3326 CTTCCTGTGGACAGGACAGAGGACGGCTGGGTCTCCCTACAAGATCTTCG-AATGATCC- 3383 || || ||||||||||| |||| |||||| | ||||| || ||||| || || | ||| Sbjct 3279 CTCCCAGTGGACAGGACTGAGGGTGGCTGGATTTCCCTGCAGGATCTGCGCAAGG-TCCA 3337 Query 3384 GAAGAGAAGCTTCAAGGAAGTCAC-GATGGAAGAAGTGGGAGGTAGCCT-CTGAACGAGC 3441 || ||||| || |||||||||||| | ||||||||||||||||| | | ||||||| || Sbjct 3338 GA-GAGAAACTGCAAGGAAGTCACAG-TGGAAGAAGTGGGAGGTGGT-TGCTGAACGGGC 3394 Query 3442 ATGGACAGGGGG-CACAGAGTCAGAAATGTTTAATAAGCTGGAGAGTATTGCCATGTCTG 3500 ||||| |||||| |||||||||||||||||| |||||||| ||||| ||||| | ||||| Sbjct 3395 ATGGA-AGGGGGGCACAGAGTCAGAAATGTTCAATAAGCTTGAGAGCATTGCTACGTCTG 3453 Query 3501 ATACACCACGTACCCCAGTACTGGGCTGCTGCATCAGCAGAGCCTTGGAGCCCTCAGTTG 3560 | | |||||||||||| || |||||||||||||||||| ||||| |||||||||| | || Sbjct 3454 ACATACCACGTACCCCGGTGCTGGGCTGCTGCATCAGCCGAGCCCTGGAGCCCTCGGCTG 3513 Query 3561 TCCAGGGAGAGTTTATAACCAGTCGTGTGAACTGGGTGGTACAGAGCTCTGCTGTAGACT 3620 |||||| ||||||||| ||||| |||||||| ||||||||||||||||||||||| |||| Sbjct 3514 TCCAGGAAGAGTTTATGACCAGCCGTGTGAATTGGGTGGTACAGAGCTCTGCTGTTGACT 3573 Query 3621 ACTTACATCTCATGCTTGTGGCCATGAAGTGGCTGTTTGAGGAATTTGCCATTGATGGGC 3680 ||||||| |||||||||||||||||||||||||||||||| || |||||||| ||||||| Sbjct 3574 ACTTACACCTCATGCTTGTGGCCATGAAGTGGCTGTTTGAAGAGTTTGCCATAGATGGGC 3633 Query 3681 GCTTCTGCATCAGCATCCACGACGAGGTTCGCTACCTGGTGCGTGAGGAGGACCGCTACC 3740 ||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||| Sbjct 3634 GCTTCTGCATCAGCATCCATGACGAGGTTCGCTACCTGGTGCGGGAGGAGGACCGCTACC 3693 Query 3741 GTGCCGCCCTGGCACT-GCAGATCACCAATCTCCTGACCAGGTGCATGTTTGCCTATAAG 3799 | || |||||||| || |||||||||||| ||| |||||||||||||||||||||| ||| Sbjct 3694 GCGCTGCCCTGGC-CTTGCAGATCACCAACCTCTTGACCAGGTGCATGTTTGCCTACAAG 3752 Query 3800 CTGGGTCTGAATGATCT-GCCCCAGTCAGTCGCCTTTTTCAGTGCAGTAGACATTGACCA 3858 |||||||||||||| || |||||||||||||||||||||||||||||| || ||||||| Sbjct 3753 CTGGGTCTGAATGA-CTTGCCCCAGTCAGTCGCCTTTTTCAGTGCAGTCGATATTGACCG 3811 Query 3859 GTGCCTCAGGAAGGAAGTGACCATGGACTGTAAAACTCCTTCTAACCCAACTGGGATGGA 3918 ||||||||||||||||||||||||||| |||||||| ||||| ||||||||||||||||| Sbjct 3812 GTGCCTCAGGAAGGAAGTGACCATGGATTGTAAAACCCCTTCCAACCCAACTGGGATGGA 3871 Query 3919 AAGGAGATATGGGATCCCCCAGGGTGAAGCACTGGATATTTACCAGATAATTGAACTCAC 3978 ||||||||| ||||| |||||||||||||| ||||||||||||||||||||||||||||| Sbjct 3872 AAGGAGATACGGGATTCCCCAGGGTGAAGCGCTGGATATTTACCAGATAATTGAACTCAC 3931 Query 3979 CAAAGGCTCCTTGGAAAAACGAAGCCAGCCTGGACCCTAGCTCTGTCTGGAGGTTCTGTA 4038 |||||||||||||||||||||||||||||||||||| |||| ||| ||||||| |||||| Sbjct 3932 CAAAGGCTCCTTGGAAAAACGAAGCCAGCCTGGACCATAGCACTGCCTGGAGGCTCTGTA 3991 Query 4039 TTTGCTCCTGTGGAGCTTTATTGGAGCGGTGCAGGTTCCTAAACTCAGGCTTTCAGATGT 4098 |||||||| ||||||||| || || | |||||||| ||| |||||||||||||||| ||| Sbjct 3992 TTTGCTCCCGTGGAGCTTCATCGGGGTGGTGCAGGCTCCCAAACTCAGGCTTTCAGCTGT 4051 Query 4099 GCTTTTTTGCAAAAGG-C------A-G-CCA----TTTTTCTGTAGCAGGACCTGCCCAG 4145 ||||||| |||||||| | | | ||| |||||| ||||||||||||||| || Sbjct 4052 GCTTTTT-GCAAAAGGGCTTGCCTAAGGCCAGCCATTTTTCAGTAGCAGGACCTGCCAAG 4110 Query 4146 GAA-AGTCCTCCTAACGGAAGG--CAC---AATTCAGTGCGTTCAGAACCAGGACACCAA 4199 || | |||| ||||| ||||| || ||||||||| ||||||||||| || |||| Sbjct 4111 -AAGATTCCTTCTAACTGAAGGTGCAGTTGAATTCAGTGGGTTCAGAACCAAGATGCCAA 4169 Query 4200 CATCAGTGCAGG-CTGT-GTGACAAGGGGTA------CT-GTTGGGCACAAATGAAGCAG 4250 |||| ||| || || | ||||||||| | || |||||| | ||||||||||| Sbjct 4170 CATCGGTGT-GGACTACAG-GACAAGGGGCATTGTTGCTTGTTGGGTAAAAATGAAGCAG 4227 Query 4251 ATGCCCCAAAGGTCACATTAACTCAGGCATTTC-TTCCT-----CCT---CTTCTTGGCT 4301 | ||||||||| ||||||||||||||||||||| || | ||| |||||||||| Sbjct 4228 AAGCCCCAAAGTTCACATTAACTCAGGCATTTCATTTATTTTTTCCTTTTCTTCTTGGCT 4287 Query 4302 GGTTCTCTGTCCTG-CTGTGTATG-TGCTGATGCAGTGCCCTAGAAGGGGA 4350 |||||| ||| ||| | ||| | |||||||||||||||||||||||| Sbjct 4288 GGTTCTTTGTTCTGTCCCCC-ATGCT-CTGATGCAGTGCCCTAGAAGGGGA 4336 Score = 261 bits (141), Expect = 2e-65 Identities = 229/270 (84%), Gaps = 12/270 (4%) Strand=Plus/Plus Query 216 GGAAGGCAGGCATGGTGAGACCTATTTCACTGACAGGAGCA-CAGAGAGGGGACGCGTCT 274 |||||||||||||||| | ||| |||||||||||||||| | |||||| ||||| |||| Sbjct 103 GGAAGGCAGGCATGGTCAAACCCATTTCACTGACAGGAG-AGCAGAGACAGGACGTGTCT 161 Query 275 CTCTCTGA-GTCTTTCGGCCACTAAAAGCAGTCAAGCTGGAGCCCAAAGCCCGGTGCCCC 333 ||||| | ||||| | |||| |||||| || ||||||||||||||||||| |||| | Sbjct 162 CTCTC-CACGTCTTCCAGCCAGTAAAAGAAGCCAAGCTGGAGCCCAAAGCCAGGTGTTCT 220 Query 334 GACTCACAGCG-GGGGGCTCCCTGCACCAACCATGAGCCGCCTGCTCTGGAAGAAGGTGG 392 ||||| ||||| ||||| ||||||||||||||||||||||||||||||||| |||||||| Sbjct 221 GACTCCCAGCGTGGGGG-TCCCTGCACCAACCATGAGCCGCCTGCTCTGGAGGAAGGTGG 279 Query 393 CTGGCGCCAAGGTCGC-CTCAGGGCCAGTACCAGCAACCGCG-CGCTGGGTCTCCAGCTC 450 | ||||||| |||| | ||||||| || ||||| ||| | ||||||||||||||||| Sbjct 280 CCGGCGCCACCGTCGGGC-CAGGGCCGGTTCCAGCT-CCGGGGCGCTGGGTCTCCAGCTC 337 Query 451 CGTCCTCGACC-CCGTCCCCAGCGACGGGC 479 ||||| || | ||| |||||||||||||| Sbjct 338 CGTCCCCG-CGTCCGACCCCAGCGACGGGC 366 >ref|NM_002693.1| UniGene infoGeoGene info Homo sapiens polymerase (DNA directed), gamma (POLG), mRNA emb|X98093.1|MIHSDNAPL UniGene infoGeoGene info H.sapiens mRNA for DNA polymerase gamma, mitochondrial protein Length=4465 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 4274 bits (2314), Expect = 0.0 Identities = 3427/3951 (86%), Gaps = 130/3951 (3%) Strand=Plus/Plus Query 489 CGCAAATGCCCTCCTCCGAGAATGGGCAGCTGCGGCTCAACCC-TCTGCTCATCCAGATG 547 ||||| ||| ||||| ||| ||||||||||||| |||||| | || |||||||||| Sbjct 458 CGCAAGTGCTATCCTCGGAGGGCGGGCAGCTGCGGCACAACCCAT-TGGACATCCAGATG 516 Query 548 TTGTCGAGAGGCCTGCACGAGCAGATCTTCGGGTGCGGCGGGGAAATGCCCGACGAGGCC 607 | |||||||| ||||||||||| ||||||||| || ||||| ||||| | ||||||| Sbjct 517 CTCTCGAGAGGGCTGCACGAGCAAATCTTCGGGCAAGGAGGGGAGATGCCTGGCGAGGCC 576 Query 608 GCGGTGCAG-CGCAGCGTAGAGCACCTGCAGAAGCACGGGCTCTGGGGGCAGCCGGCCAC 666 ||||||| | |||||||| ||||||||||||||||||||||||||||||||||| ||| Sbjct 577 GCGGTGC-GCCGCAGCGTCGAGCACCTGCAGAAGCACGGGCTCTGGGGGCAGCCAGCCGT 635 Query 667 GCCCTTGCCAGACGTGGAGCTGCGCCTGCC-CCGGCTCTTCGGGGGCAACCTGGACCAGC 725 ||||||||| |||||||||||||||||||| || |||| ||||| |||||||||||||| Sbjct 636 GCCCTTGCCCGACGTGGAGCTGCGCCTGCCGCC-CCTCTACGGGGACAACCTGGACCAGC 694 Query 726 ACTTCCGCCTCCTGGCCCAGAAGCAGAGCCTGCCTTACTTGGAGGCGGCCGCCTCGTTAT 785 |||||||||||||||||||||||||||||||||| ||| ||||||||||| || | | | Sbjct 695 ACTTCCGCCTCCTGGCCCAGAAGCAGAGCCTGCCCTACCTGGAGGCGGCCAACTTGCTGT 754 Query 786 TGGAGGCCCAATTGCCCCCCG-AGCCCAAGAGC-TGGGCCTGGGCGGAGGGCTGGACCCG 843 || ||||||| || |||||| ||||| | || |||||||||||||||||||||||||| Sbjct 755 TGCAGGCCCAGCTG-CCCCCGAAGCCCCCG-GCTTGGGCCTGGGCGGAGGGCTGGACCCG 812 Query 844 GTACGGCCCCGAGGGGGAGGCCGAACCCGTGGCCATCCCCGAGGAGCGGGCCCTGGTGTT 903 ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| Sbjct 813 GTACGGCCCCGAGGGGGAGGCCGTACCCGTGGCCATCCCCGAGGAGCGGGCCCTGGTGTT 872 Query 904 CGACGTGGAGGTCTGCTTGGCAGAGGGAACCTGCCCCACTTTGGCGGTGGCCATATCCCC 963 |||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| Sbjct 873 CGACGTGGAGGTCTGCTTGGCAGAGGGAACTTGCCCCACATTGGCGGTGGCCATATCCCC 932 Query 964 CTCGGCCTGGTATTCCTGGTGCAGCCGGCGGCTGGTGGAAGAGCGTTACTCTTGGACCAG 1023 |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| Sbjct 933 CTCGGCCTGGTATTCCTGGTGCAGCCAGCGGCTGGTGGAAGAGCGTTACTCTTGGACCAG 992 Query 1024 CCAGCTATCGCCGGCTGACCTAATCCCTTTGGGGGGCTCC-ACTAGTGCCAGCAGCTCCA 1082 |||||| |||||||||||||| ||||| ||| || | || ||| ||||||||||| ||| Sbjct 993 CCAGCTGTCGCCGGCTGACCTCATCCCCCTGGAGGTC-CCTACTGGTGCCAGCAGCCCCA 1051 Query 1083 CCAAGCAG-GA-TGGGCAGGAACAGTTAGTGGTGGGGCACAATGTTTCCTTTGACCGAGC 1140 || || || || | ||||||| |||||||||||||||||||||||||||||||||||||| Sbjct 1052 CCCAG-AGAGACT-GGCAGGAGCAGTTAGTGGTGGGGCACAATGTTTCCTTTGACCGAGC 1109 Query 1141 CCATATCAGGGAACAGTATCTGATTCAGGACTCCCGGATGCGTTTTCTCGATACTATGAG 1200 ||||||||||| ||||| ||||| |||| ||||| |||||||| || || || ||||| Sbjct 1110 TCATATCAGGGAGCAGTACCTGATCCAGGGTTCCCGCATGCGTTTCCTGGACACCATGAG 1169 Query 1201 CATGCACATGGCCATCTCGGGGCTGAGCAGCTTCCAGCGCAGCCTGTGGATGGGAGCCAA 1260 |||||||||||||||||| ||||| ||||||||||||||||| |||||||| | |||||| Sbjct 1170 CATGCACATGGCCATCTCAGGGCTAAGCAGCTTCCAGCGCAGTCTGTGGATAGCAGCCAA 1229 Query 1261 GCAGGG-AAAGCACAAGACCCAGCAGTCCACAAAGCGAGGGCAGAAGTCCCCGAGGAAAG 1319 |||||| ||| |||||| ||||| ||||||||| ||| |||||||||| |||||||| Sbjct 1230 GCAGGGCAAA-CACAAGGTCCAGCCCCCCACAAAGCAAGGCCAGAAGTCCCAGAGGAAAG 1288 Query 1320 CC--AA-TGGTCCAGCGATCTCATCTTGGGACTGGATGGATATCAGCAGTGCCAATAATC 1376 || || || |||||||||||||| ||||||||| |||| |||||||||| ||| | || Sbjct 1289 CCAGAAGAGGCCCAGCGATCTCATCCTGGGACTGGCTGGACATCAGCAGTGTCAACAGTC 1348 Query 1377 TTGCAGATGTGCACA-ACCTTTATGT-GGGGGGACCTCCCTTAGAGAAGGAGCCTCGGGA 1434 | ||||| ||||||| | |||||||| |||||| ||||||||||||||||||||||| || Sbjct 1349 TGGCAGAGGTGCACAGA-CTTTATGTAGGGGGG-CCTCCCTTAGAGAAGGAGCCTCGAGA 1406 Query 1435 GCTGTTCGTCAAAGGCAGCATGAGGGATATCCGAGAGAACTTCCAGGATCTGATGCAGTA 1494 ||||| || || |||| ||||| ||| || || |||||||||||||| ||||||||||| Sbjct 1407 ACTGTTTGTGAAGGGCACCATGAAGGACATTCGTGAGAACTTCCAGGACCTGATGCAGTA 1466 Query 1495 CTGCGCCC-GTGATGTGTGGGCCACCTTTGAGGTTTTCCAGCAGCAGCTGCCACTCTTCT 1553 ||| |||| | || |||||||||||| ||||||||||||||||||||| || ||||||| Sbjct 1467 CTGTGCCCAG-GACGTGTGGGCCACCCATGAGGTTTTCCAGCAGCAGCTACCGCTCTTCT 1525 Query 1554 TGGAGAGGTGTCCCCACCCAGTGACTCTGGCTGGCATGCTGGAGATGGGTGTGTCCTACC 1613 ||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| Sbjct 1526 TGGAGAGGTGTCCCCACCCAGTGACTCTGGCCGGCATGCTGGAGATGGGTGTCTCCTACC 1585 Query 1614 TGCCTGTCAACCAGAACTGGGAGCGTTACCTGACAGAGGCACAGAACACATATGAGGAGC 1673 |||||||||||||||||||||||||||||||| ||||||||||| ||| |||||||||| Sbjct 1586 TGCCTGTCAACCAGAACTGGGAGCGTTACCTGGCAGAGGCACAGGGCACTTATGAGGAGC 1645 Query 1674 TCCAGCGGGAGATGAAGAAGTCGCTGATGGATCTGGCTAATGATGCCTGTCAGTTGCTCT 1733 ||||||||||||||||||||||| ||||||||||||| ||||||||||| ||| |||||| Sbjct 1646 TCCAGCGGGAGATGAAGAAGTCGTTGATGGATCTGGCCAATGATGCCTGCCAGCTGCTCT 1705 Query 1734 CAGGAGAGAGGTACAAAGAAGACCCTTGGCTCTGGGACCTAGAATGGGATTTGCAGGAGT 1793 ||||||||||||||||||||||||| |||||||||||||| || ||||| |||| || | Sbjct 1706 CAGGAGAGAGGTACAAAGAAGACCCCTGGCTCTGGGACCTGGAGTGGGACCTGCAAGAAT 1765 Query 1794 TTAAGCAGAA-AAAGGCAAAGAAGGTGAAGAA-G--CCAGCCTCAGCCAGCAAGTTGCCC 1849 |||||||||| ||| || |||||||||||||| | |||||| ||||||||||||||||| Sbjct 1766 TTAAGCAGAAGAAA-GCTAAGAAGGTGAAGAAGGAACCAGCCACAGCCAGCAAGTTGCCC 1824 Query 1850 ATCGAGGGAGCT-GGGCCCTTTGGGGATCCCATGGATCAGGAAGATCCT-GGCCCGC-CC 1906 |||||||| ||| |||||| ||| |||||||||||||||||||| ||| ||||| | | Sbjct 1825 ATCGAGGGGGCTGGGGCCC-CTGGTGATCCCATGGATCAGGAAGA-CCTCGGCCC-CTGC 1881 Query 1907 AGCGAGGAGGAGGAGCTTCAGCGAAG-TGTAACAGCCCACAACC-GGTTACAGCAGCTG- 1963 || |||||||||||| |||| | ||| ||| | |||| | || | || ||| ||||| Sbjct 1882 AGTGAGGAGGAGGAGTTTCAAC-AAGATGTCATGGCCCGC-GCCTGCTTGCAGAAGCTGA 1939 Query 1964 AGGAGCACCACGGACCTCCTGCCTAAGCGACCCCAGCACCTTCCAGGACACCCTGGGTGG 2023 ||| | ||||| || |||||||| ||||| |||||||||||||| ||||||||||| ||| Sbjct 1940 AGG-GGACCACAGAGCTCCTGCCCAAGCGGCCCCAGCACCTTCCTGGACACCCTGGATGG 1998 Query 2024 TACCGGAAGCTCTGCCCTCGACTAGATGACCCTGCCTGGGCTCCC-GGCCCCAGCCTCCT 2082 ||||||||||||||||| || ||||| |||||||| ||| | ||| |||||||||||||| Sbjct 1999 TACCGGAAGCTCTGCCCCCGGCTAGACGACCCTGCATGGAC-CCCGGGCCCCAGCCTCCT 2057 Query 2083 CAGCCTGCAAATGCGGGTCACTCCTAAGCTCATGGCACTGACCTGGGATGGTTTTCCTCT 2142 ||||||||| ||||||||||| ||||| ||||||||||| ||||||||||| || ||||| Sbjct 2058 CAGCCTGCAGATGCGGGTCACACCTAAACTCATGGCACTTACCTGGGATGGCTTCCCTCT 2117 Query 2143 ACACTACTCAGACTC-TCATGGTTGGGGCTACCTAGTGCCTGGGCGTCGGGATAATCTGA 2201 ||||||||||| | |||||| ||||||||| | ||||||||||| ||||| || ||| Sbjct 2118 GCACTACTCAGA-GCGTCATGGCTGGGGCTACTTGGTGCCTGGGCGGCGGGACAACCTGG 2176 Query 2202 CCGAGCCGCCAGTGA-GCCCCACTGTAGAATCCGCTGCAGTAACCTGCCCCTACAGAGCC 2260 || ||| ||| | | | |||| | || || |||| || |||||||||||||||| Sbjct 2177 CCAAGCTGCC-GACAGGTACCACCCTGGAGTCAGCTGGGGTGGTCTGCCCCTACAGAGCC 2235 Query 2261 ATCGAGTCCTTATACAGGAAGCACTGCCTTGAACAGGGGAAGCAGCAATTGGA-GCCCCA 2319 ||||||||| | |||||||||||||| || ||||||||||||||||| | || |||||| Sbjct 2236 ATCGAGTCCCTGTACAGGAAGCACTGTCTCGAACAGGGGAAGCAGCAGCT-GATGCCCCA 2294 Query 2320 GGAGGTAGACCTGGCTGAGGAGTTCTTACTCACTGACAGTAGTGCCATGTGGCAAACGGT 2379 ||||| | |||||| ||||||||| | |||||||||| ||||||||| ||||||||||| Sbjct 2295 GGAGGCCGGCCTGGCGGAGGAGTTCCTGCTCACTGACAATAGTGCCATATGGCAAACGGT 2354 Query 2380 AGAAGAACTGGGCTGCTTAGACGTAGAGGCTGAGGCCAAGATGGAGAA-TT-C-AG-GGC 2435 ||||||||||| | |||||| || ||||||||||||||||||||||| || | || || Sbjct 2355 AGAAGAACTGGATTACTTAGAAGTGGAGGCTGAGGCCAAGATGGAGAACTTGCGAGCTGC 2414 Query 2436 --TG--A-GCCAACCTCTAGTTCTGCCTG-CTGCTTGTGCCCCCAAATCCAGCCAGCCCA 2489 || | | ||||| |||| |||| ||| | | | ||| |||||| || |||||||| Sbjct 2415 AGTGCCAGGTCAACCCCTAGCTCTGACTGCCCG-TGGTGGCCCCAAGGACACCCAGCCCA 2473 Query 2490 CG-TATCACCATGGCAACGGACCTTATAATGATGTGAATATCCCTGGTTGCTGGTTTTTC 2548 | |||||||||||||| |||||||| || || ||| | |||||||| |||||||||||| Sbjct 2474 -GCTATCACCATGGCAATGGACCTTACAACGACGTGGACATCCCTGGCTGCTGGTTTTTC 2532 Query 2549 AAGCTGCCTCACAAGGACGGTAACAACTACAATGTGGGCAGTCCCTTTGCCAAAGATTTC 2608 ||||||||||||||||| ||||| | || |||||||| || ||||||||||| || ||| Sbjct 2533 AAGCTGCCTCACAAGGATGGTAATAGCTGTAATGTGGGAAGCCCCTTTGCCAAGGACTTC 2592 Query 2609 CTGCCCAAGATGGAGGATGGCACCCTGCAGGCTGGCCCAGGAGGTGCCAGTGGGCCTCGT 2668 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct 2593 CTGCCCAAGATGGAGGATGGCACCCTGCAGGCTGGCCCAGGAGGTGCCAGTGGGCCCCGT 2652 Query 2669 GCCCTGGAAATAAATAAAATGATTTCTTTTTGGAGGAATGCTCATAAACGTATCAGTTCC 2728 || |||||||| || |||||||||||||| |||||||| || |||||||||||||| ||| Sbjct 2653 GCTCTGGAAATCAACAAAATGATTTCTTTCTGGAGGAACGCCCATAAACGTATCAGCTCC 2712 Query 2729 CAGATGGTGGTATGGCTCCCCAGGTCAGCTCTGCCCCGGGTTGTGACCAGGCACCCC-AG 2787 ||||||||||| ||||| |||||||||||||||||||| | ||||| |||||||||| | Sbjct 2713 CAGATGGTGGTGTGGCTGCCCAGGTCAGCTCTGCCCCGTGCTGTGATCAGGCACCCCGA- 2771 Query 2788 CT-TCGATGAGGAAGGCCACTATGGGGCCATCCTACCCCAGGTGGTGACTGCTGGCACCA 2846 || | ||||||||||||| ||||||||||||||| ||||| ||||||||||| ||||||| Sbjct 2772 CTAT-GATGAGGAAGGCCTCTATGGGGCCATCCTGCCCCAAGTGGTGACTGCCGGCACCA 2830 Query 2847 TCACCCGTCGAGCTGTGGAGCCCACGTGGCTCACTGCCAGTAATGCTCGGCCTGACCGGG 2906 |||| || || |||||||||||||| |||||||| ||||| ||||| ||||||||||| | Sbjct 2831 TCACTCGCCGGGCTGTGGAGCCCACATGGCTCACCGCCAGCAATGCCCGGCCTGACCGAG 2890 Query 2907 TAGGCAGTGAGTTGAAAGCCATGGTGCAGGCTCCACCTGGCTATGTCCTTGTGGGTGCTG 2966 ||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| Sbjct 2891 TAGGCAGTGAGTTGAAAGCCATGGTGCAGGCCCCACCTGGCTACACCCTTGTGGGTGCTG 2950 Query 2967 ATGTGGACTCACAGGAACTGTGGATCGCAGCTGTACTTGGAGATGCTCACTTTGCTGGGA 3026 |||||||||| || || |||||||| |||||||| |||||||| || |||||||| || | Sbjct 2951 ATGTGGACTCCCAAGAGCTGTGGATTGCAGCTGTGCTTGGAGACGCCCACTTTGCCGGCA 3010 Query 3027 TGCATGGCTGCACGGCCTTTGGCTGGATGACTCTGCAGGGCAGGAAGAGCAGAGGCACTG 3086 ||||||||||||| |||||||| |||||||| |||||||||||||||||||| ||||||| Sbjct 3011 TGCATGGCTGCACAGCCTTTGGGTGGATGACACTGCAGGGCAGGAAGAGCAGGGGCACTG 3070 Query 3087 ATCTGCACAGCAAGACAGCTGCCACTGTGGGCATCAGCCGAGAGCATGCCAAAATCTTCA 3146 |||| ||||| |||||||| | ||||||||||||||||| ||||||||||||||||||| Sbjct 3071 ATCTACACAGTAAGACAGCCACTACTGTGGGCATCAGCCGTGAGCATGCCAAAATCTTCA 3130 Query 3147 ACTATGGCCGCATCTATGGGGCTGGGCAGTCCTTTGCTGAGCGCCTACTGATGCAGTTCA 3206 |||| |||||||||||||| ||||||||| |||||||||||||| |||| |||||||| | Sbjct 3131 ACTACGGCCGCATCTATGGTGCTGGGCAGCCCTTTGCTGAGCGCTTACTAATGCAGTTTA 3190 Query 3207 ACCACAGGCTCACA-AGGCAGGAGGCAGCTGAGAAGGCCCAGCAGATGTATGCAGTCACA 3265 ||||| |||||||| || |||||||||||||||||||||||||||||||| || | ||| Sbjct 3191 ACCACCGGCTCACACAG-CAGGAGGCAGCTGAGAAGGCCCAGCAGATGTACGCTGCCACC 3249 Query 3266 AAAGGCCTGCGCCGGTATCGGCTGTCTGCGGATGGTGAGTGGCTGGTGAAACAGTTGAAT 3325 || ||||| ||| ||||||||||||| | || || ||||||||||||| ||||||| Sbjct 3250 AAGGGCCTCCGCTGGTATCGGCTGTCGGATGAGGGCGAGTGGCTGGTGAGGGAGTTGAAC 3309 Query 3326 CTTCCTGTGGACAGGACAGAGGACGGCTGGGTCTCCCTACAAGATCTTCG-AATGATCC- 3383 || || ||||||||||| |||| |||||| | ||||| || ||||| || || | ||| Sbjct 3310 CTCCCAGTGGACAGGACTGAGGGTGGCTGGATTTCCCTGCAGGATCTGCGCAAGG-TCCA 3368 Query 3384 GAAGAGAAGCTTCAAGGAAGTCAC-GATGGAAGAAGTGGGAGGTAGCCT-CTGAACGAGC 3441 || ||||| || |||||||||||| | ||||||||||||||||| | | ||||||| || Sbjct 3369 GA-GAGAAACTGCAAGGAAGTCACAG-TGGAAGAAGTGGGAGGTGGT-TGCTGAACGGGC 3425 Query 3442 ATGGACAGGGGG-CACAGAGTCAGAAATGTTTAATAAGCTGGAGAGTATTGCCATGTCTG 3500 ||||| |||||| |||||||||||||||||| |||||||| ||||| ||||| | ||||| Sbjct 3426 ATGGA-AGGGGGGCACAGAGTCAGAAATGTTCAATAAGCTTGAGAGCATTGCTACGTCTG 3484 Query 3501 ATACACCACGTACCCCAGTACTGGGCTGCTGCATCAGCAGAGCCTTGGAGCCCTCAGTTG 3560 | | |||||||||||| || |||||||||||||||||| ||||| |||||||||| | || Sbjct 3485 ACATACCACGTACCCCGGTGCTGGGCTGCTGCATCAGCCGAGCCCTGGAGCCCTCGGCTG 3544 Query 3561 TCCAGGGAGAGTTTATAACCAGTCGTGTGAACTGGGTGGTACAGAGCTCTGCTGTAGACT 3620 |||||| ||||||||| ||||| |||||||| ||||||||||||||||||||||| |||| Sbjct 3545 TCCAGGAAGAGTTTATGACCAGCCGTGTGAATTGGGTGGTACAGAGCTCTGCTGTTGACT 3604 Query 3621 ACTTACATCTCATGCTTGTGGCCATGAAGTGGCTGTTTGAGGAATTTGCCATTGATGGGC 3680 ||||||| |||||||||||||||||||||||||||||||| || |||||||| ||||||| Sbjct 3605 ACTTACACCTCATGCTTGTGGCCATGAAGTGGCTGTTTGAAGAGTTTGCCATAGATGGGC 3664 Query 3681 GCTTCTGCATCAGCATCCACGACGAGGTTCGCTACCTGGTGCGTGAGGAGGACCGCTACC 3740 ||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||| Sbjct 3665 GCTTCTGCATCAGCATCCATGACGAGGTTCGCTACCTGGTGCGGGAGGAGGACCGCTACC 3724 Query 3741 GTGCCGCCCTGGCACT-GCAGATCACCAATCTCCTGACCAGGTGCATGTTTGCCTATAAG 3799 | || |||||||| || |||||||||||| ||| |||||||||||||||||||||| ||| Sbjct 3725 GCGCTGCCCTGGC-CTTGCAGATCACCAACCTCTTGACCAGGTGCATGTTTGCCTACAAG 3783 Query 3800 CTGGGTCTGAATGATCT-GCCCCAGTCAGTCGCCTTTTTCAGTGCAGTAGACATTGACCA 3858 |||||||||||||| || |||||||||||||||||||||||||||||| || ||||||| Sbjct 3784 CTGGGTCTGAATGA-CTTGCCCCAGTCAGTCGCCTTTTTCAGTGCAGTCGATATTGACCG 3842 Query 3859 GTGCCTCAGGAAGGAAGTGACCATGGACTGTAAAACTCCTTCTAACCCAACTGGGATGGA 3918 ||||||||||||||||||||||||||| |||||||| ||||| ||||||||||||||||| Sbjct 3843 GTGCCTCAGGAAGGAAGTGACCATGGATTGTAAAACCCCTTCCAACCCAACTGGGATGGA 3902 Query 3919 AAGGAGATATGGGATCCCCCAGGGTGAAGCACTGGATATTTACCAGATAATTGAACTCAC 3978 ||||||||| ||||| |||||||||||||| ||||||||||||||||||||||||||||| Sbjct 3903 AAGGAGATACGGGATTCCCCAGGGTGAAGCGCTGGATATTTACCAGATAATTGAACTCAC 3962 Query 3979 CAAAGGCTCCTTGGAAAAACGAAGCCAGCCTGGACCCTAGCTCTGTCTGGAGGTTCTGTA 4038 |||||||||||||||||||||||||||||||||||| |||| ||| ||||||| |||||| Sbjct 3963 CAAAGGCTCCTTGGAAAAACGAAGCCAGCCTGGACCATAGCACTGCCTGGAGGCTCTGTA 4022 Query 4039 TTTGCTCCTGTGGAGCTTTATTGGAGCGGTGCAGGTTCCTAAACTCAGGCTTTCAGATGT 4098 |||||||| ||||||||| || || | |||||||| ||| |||||||||||||||| ||| Sbjct 4023 TTTGCTCCCGTGGAGCTTCATCGGGGTGGTGCAGGCTCCCAAACTCAGGCTTTCAGCTGT 4082 Query 4099 GCTTTTTTGCAAAAGG-C------A-G-CCA----TTTTTCTGTAGCAGGACCTGCCCAG 4145 ||||||| |||||||| | | | ||| |||||| ||||||||||||||| || Sbjct 4083 GCTTTTT-GCAAAAGGGCTTGCCTAAGGCCAGCCATTTTTCAGTAGCAGGACCTGCCAAG 4141 Query 4146 GAA-AGTCCTCCTAACGGAAGG--CAC---AATTCAGTGCGTTCAGAACCAGGACACCAA 4199 || | |||| ||||| ||||| || ||||||||| ||||||||||| || |||| Sbjct 4142 -AAGATTCCTTCTAACTGAAGGTGCAGTTGAATTCAGTGGGTTCAGAACCAAGATGCCAA 4200 Query 4200 CATCAGTGCAGG-CTGT-GTGACAAGGGGTA------CT-GTTGGGCACAAATGAAGCAG 4250 |||| ||| || || | ||||||||| | || |||||| | ||||||||||| Sbjct 4201 CATCGGTGT-GGACTACAG-GACAAGGGGCATTGTTGCTTGTTGGGTAAAAATGAAGCAG 4258 Query 4251 ATGCCCCAAAGGTCACATTAACTCAGGCATTTC-TTCCT-----CCT---CTTCTTGGCT 4301 | ||||||||| ||||||||||||||||||||| || | ||| |||||||||| Sbjct 4259 AAGCCCCAAAGTTCACATTAACTCAGGCATTTCATTTATTTTTTCCTTTTCTTCTTGGCT 4318 Query 4302 GGTTCTCTGTCCTG-CTGTGTATG-TGCTGATGCAGTGCCCTAGAAGGGGA 4350 |||||| ||| ||| | ||| | |||||||||||||||||||||||| Sbjct 4319 GGTTCTTTGTTCTGTCCCCC-ATGCT-CTGATGCAGTGCCCTAGAAGGGGA 4367 Score = 309 bits (167), Expect = 6e-80 Identities = 320/391 (81%), Gaps = 21/391 (5%) Strand=Plus/Plus Query 100 GAGACCGCACGCCACCCTGAGGCTGCGTGGGCCGCGCG-CCGCGGACGCCGCGTCGT-CG 157 ||| || ||||| |||| |||||||||| ||||||||| | |||||||| | ||| | Sbjct 17 GAGGCCACACGCTACCCCGAGGCTGCGTAGGCCGCGCGAAGGGGGACGCCGTGCCGTGGG 76 Query 158 CC-GGGGCT-GTGGGCTGCCGCAGAACGGGAAGC-GCGAAGCGGACCGAGGACTTGTGTG 214 || |||| | | ||| || ||||| |||||||| || | |||||||||| ||| | | Sbjct 77 CCTGGGG-TCG-GGGGAGCAGCAGACCGGGAAGCACCG-TGAGGACCGAGGATTTG-GGG 132 Query 215 AGGAAGGCAGGCATGGTGAGACCTATTTCACTGACAGGAGCA-CAGAGAGGGGACGCGTC 273 |||||||||||||||| | ||| |||||||||||||||| | |||||| ||||| ||| Sbjct 133 TGGAAGGCAGGCATGGTCAAACCCATTTCACTGACAGGAG-AGCAGAGACAGGACGTGTC 191 Query 274 TCTCTCTGA-GTCTTTCGGCCACTAAAAGCAGTCAAGCTGGAGCCCAAAGCCCGGTGCCC 332 |||||| | ||||| | |||| |||||| || ||||||||||||||||||| |||| | Sbjct 192 TCTCTC-CACGTCTTCCAGCCAGTAAAAGAAGCCAAGCTGGAGCCCAAAGCCAGGTGTTC 250 Query 333 CGACTCACAGCG-GGGGGCTCCCTGCACCAACCATGAGCCGCCTGCTCTGGAAGAAGGTG 391 ||||| ||||| ||||| ||||||||||||||||||||||||||||||||| ||||||| Sbjct 251 TGACTCCCAGCGTGGGGG-TCCCTGCACCAACCATGAGCCGCCTGCTCTGGAGGAAGGTG 309 Query 392 GCTGGCGCCAAGGTCGC-CTCAGGGCCAGTACCAGCAACCGCG-CGCTGGGTCTCCAGCT 449 || ||||||| |||| | ||||||| || ||||| ||| | |||||||||||||||| Sbjct 310 GCCGGCGCCACCGTCGGGC-CAGGGCCGGTTCCAGCT-CCGGGGCGCTGGGTCTCCAGCT 367 Query 450 CCGTCCTCGACC-CCGTCCCCAGCGACGGGC 479 |||||| || | ||| |||||||||||||| Sbjct 368 CCGTCCCCG-CGTCCGACCCCAGCGACGGGC 397 >dbj|D84103.1| UniGene infoGeoGene info Homo sapiens mRNA for mitochondrial DNA polymerase gamma, complete cds Length=4263 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 4263 bits (2308), Expect = 0.0 Identities = 3426/3952 (86%), Gaps = 131/3952 (3%) Strand=Plus/Plus Query 489 CGCAAATGCCCTCCTCCGAGAATGGGCAGCTGCGGCTCAACCC-TCTGCTCATCCAGATG 547 ||||| ||| ||||| ||| ||||||||||||| |||||| | || |||||||||| Sbjct 282 CGCAAGTGCTATCCTCGGAGGGCGGGCAGCTGCGGCACAACCCAT-TGGACATCCAGATG 340 Query 548 TTGTCGAGAGGCCTGCACGAGCAGATCTTCGGGTGCGGCGGGGAAATGCCCGACGAGGCC 607 | |||||||| ||||||||||| ||||||||| || ||||| ||||| | ||||||| Sbjct 341 CTCTCGAGAGGGCTGCACGAGCAAATCTTCGGGCAAGGAGGGGAGATGCCTGGCGAGGCC 400 Query 608 GCGGTGCAG-CGCAGCGTAGAGCACCTGCAGAAGCACGGGCTCTGGGGGCAGCCGGCCAC 666 ||||||| | |||||||| ||||||||||||||||||||||||||||||||||| ||| Sbjct 401 GCGGTGC-GCCGCAGCGTCGAGCACCTGCAGAAGCACGGGCTCTGGGGGCAGCCAGCCGT 459 Query 667 GCCCTTGCCAGACGTGGAGCTGCGCCTGCC-CCGGCTCTTCGGGGGCAACCTGGACCAGC 725 ||||||||| |||||||||||||||||||| || |||| ||||| |||||||||||||| Sbjct 460 GCCCTTGCCCGACGTGGAGCTGCGCCTGCCGCC-CCTCTACGGGGACAACCTGGACCAGC 518 Query 726 ACTTCCGCCTCCTGGCCCAGAAGCAGAGCCTGCCTTACTTGGAGGCGGCCGCCTCGTTAT 785 |||||||||||||||||||||||||||||||||| ||| ||||||||||| || | | | Sbjct 519 ACTTCCGCCTCCTGGCCCAGAAGCAGAGCCTGCCCTACCTGGAGGCGGCCAACTTGCTGT 578 Query 786 TGGAGGCCCAATTGCCCCCCG-AGCCCAAGAGC-TGGGCCTGGGCGGAGGGCTGGACCCG 843 || ||||||| || |||||| ||||| | || |||||||||||||||||||||||||| Sbjct 579 TGCAGGCCCAGCTG-CCCCCGAAGCCCCCG-GCTTGGGCCTGGGCGGAGGGCTGGACCCG 636 Query 844 GTACGGCCCCGAGGGGGAGGCCGAACCCGTGGCCATCCCCGAGGAGCGGGCCCTGGTGTT 903 ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| Sbjct 637 GTACGGCCCCGAGGGGGAGGCCGTACCCGTGGCCATCCCCGAGGAGCGGGCCCTGGTGTT 696 Query 904 CGACGTGGAGGTCTGCTTGGCAGAGGGAACCTGCCCCACTTTGGCGGTGGCCATATCCCC 963 |||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| Sbjct 697 CGACGTGGAGGTCTGCTTGGCAGAGGGAACTTGCCCCACATTGGCGGTGGCCATATCCCC 756 Query 964 CTCGGCCTGGTATTCCTGGTGCAGCCGGCGGCTGGTGGAAGAGCGTTACTCTTGGACCAG 1023 |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| Sbjct 757 CTCGGCCTGGTATTCCTGGTGCAGCCAGCGGCTGGTGGAAGAGCGTTACTCTTGGACCAG 816 Query 1024 CCAGCTATCGCCGGCTGACCTAATCCCTTTGGGGGGCTCC-ACTAGTGCCAGCAGCTCCA 1082 |||||| |||||||||||||| ||||| ||| || | || ||| ||||||||||| ||| Sbjct 817 CCAGCTGTCGCCGGCTGACCTCATCCCCCTGGAGGTC-CCTACTGGTGCCAGCAGCCCCA 875 Query 1083 CCAAGCAG-GA-TGGGCAGGAACAGTTAGTGGTGGGGCACAATGTTTCCTTTGACCGAGC 1140 || || || || | ||||||| |||||||||||||||||||||||||||||||||||||| Sbjct 876 CCCAG-AGAGACT-GGCAGGAGCAGTTAGTGGTGGGGCACAATGTTTCCTTTGACCGAGC 933 Query 1141 CCATATCAGGGAACAGTATCTGATTCAGGACTCCCGGATGCGTTTTCTCGATACTATGAG 1200 ||||||||||| ||||| ||||| |||| ||||| |||||||| || || || ||||| Sbjct 934 TCATATCAGGGAGCAGTACCTGATCCAGGGTTCCCGCATGCGTTTCCTGGACACCATGAG 993 Query 1201 CATGCACATGGCCATCTCGGGGCTGAGCAGCTTCCAGCGCAGCCTGTGGATGGGAGCCAA 1260 |||||||||||||||||| ||||| ||||||||||||||||| |||||||| | |||||| Sbjct 994 CATGCACATGGCCATCTCAGGGCTAAGCAGCTTCCAGCGCAGTCTGTGGATAGCAGCCAA 1053 Query 1261 GCAGGG-AAAGCACAAGACCCAGCAGTCCACAAAGCGAGGGCAGAAGTCCCCGAGGAAAG 1319 |||||| ||| |||||| ||||| ||||||| | ||| |||||||||| |||||||| Sbjct 1054 GCAGGGCAAA-CACAAGGTCCAGCCCCCCACAAAACAAGGCCAGAAGTCCCAGAGGAAAG 1112 Query 1320 CC--AA-TGGTCCAGCGATCTCATCTTGGGACTGGATGGATATCAGCAGTGCCAATAATC 1376 || || || |||||||||||||| ||||||||| |||| |||||||||| ||| | || Sbjct 1113 CCAGAAGAGGCCCAGCGATCTCATCCTGGGACTGGCTGGACATCAGCAGTGTCAACAGTC 1172 Query 1377 TTGCAGATGTGCACA-ACCTTTATGT-GGGGGGACCTCCCTTAGAGAAGGAGCCTCGGGA 1434 | ||||| ||||||| | |||||||| |||||| ||||||||||||||||||||||| || Sbjct 1173 TGGCAGAGGTGCACAGA-CTTTATGTAGGGGGG-CCTCCCTTAGAGAAGGAGCCTCGAGA 1230 Query 1435 GCTGTTCGTCAAAGGCAGCATGAGGGATATCCGAGAGAACTTCCAGGATCTGATGCAGTA 1494 ||||| || || |||| ||||| ||| || || |||||||||||||| ||||||||||| Sbjct 1231 ACTGTTTGTGAAGGGCACCATGAAGGACATTCGTGAGAACTTCCAGGACCTGATGCAGTA 1290 Query 1495 CTGCGCCC-GTGATGTGTGGGCCACCTTTGAGGTTTTCCAGCAGCAGCTGCCACTCTTCT 1553 ||| |||| | || |||||||||||| ||||||||||||||||||||| || ||||||| Sbjct 1291 CTGTGCCCAG-GACGTGTGGGCCACCCATGAGGTTTTCCAGCAGCAGCTACCGCTCTTCT 1349 Query 1554 TGGAGAGGTGTCCCCACCCAGTGACTCTGGCTGGCATGCTGGAGATGGGTGTGTCCTACC 1613 ||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| Sbjct 1350 TGGAGAGGTGTCCCCACCCAGTGACTCTGGCCGGCATGCTGGAGATGGGTGTCTCCTACC 1409 Query 1614 TGCCTGTCAACCAGAACTGGGAGCGTTACCTGACAGAGGCACAGAACACATATGAGGAGC 1673 |||||||||||||||||||||||||||||||| ||||||||||| ||| |||||||||| Sbjct 1410 TGCCTGTCAACCAGAACTGGGAGCGTTACCTGGCAGAGGCACAGGGCACTTATGAGGAGC 1469 Query 1674 TCCAGCGGGAGATGAAGAAGTCGCTGATGGATCTGGCTAATGATGCCTGTCAGTTGCTCT 1733 ||||||||||||||||||||||| ||||||||||||| ||||||||||| ||| |||||| Sbjct 1470 TCCAGCGGGAGATGAAGAAGTCGTTGATGGATCTGGCCAATGATGCCTGCCAGCTGCTCT 1529 Query 1734 CAGGAGAGAGGTACAAAGAAGACCCTTGGCTCTGGGACCTAGAATGGGATTTGCAGGAGT 1793 ||||||||||||||||||||||||| |||||||||||||| || ||||| |||| || | Sbjct 1530 CAGGAGAGAGGTACAAAGAAGACCCCTGGCTCTGGGACCTGGAGTGGGACCTGCAAGAAT 1589 Query 1794 TTAAGCAGAA-AAAGGCAAAGAAGGTGAAGAA-G--CCAGCCTCAGCCAGCAAGTTGCCC 1849 |||||||||| ||| || |||||||||||||| | |||||| ||||||||||||||||| Sbjct 1590 TTAAGCAGAAGAAA-GCTAAGAAGGTGAAGAAGGAACCAGCCACAGCCAGCAAGTTGCCC 1648 Query 1850 ATCGAGGGAGCT-GGGCCCTTTGGGGATCCCATGGATCAGGAAGATCCT-GGCCCGC-CC 1906 |||||||| ||| |||||| ||| |||||||||||||||||||| ||| ||||| | | Sbjct 1649 ATCGAGGGGGCTGGGGCCC-CTGGTGATCCCATGGATCAGGAAGA-CCTCGGCCC-CTGC 1705 Query 1907 AGCGAGGAGGAGGAGCTTCAGCGAAG-TGTAACAGCCCACAACC-GGTTACAGCAGCTG- 1963 || |||||||||||| |||| | ||| ||| | |||| | || | || ||| ||||| Sbjct 1706 AGTGAGGAGGAGGAGTTTCAAC-AAGATGTCATGGCCCGC-GCCTGCTTGCAGAAGCTGA 1763 Query 1964 AGGAGCACCACGGACCTCCTGCCTAAGCGACCCCAGCACCTTCCAGGACACCCTGGGTGG 2023 ||| | ||||| || |||||||| ||||| |||||||||||||| ||||||||||| ||| Sbjct 1764 AGG-GGACCACAGAGCTCCTGCCCAAGCGGCCCCAGCACCTTCCTGGACACCCTGGATGG 1822 Query 2024 TACCGGAAGCTCTGCCCTCGACTAGATGACCCTGCCTGGGCTCCC-GGCCCCAGCCTCCT 2082 ||||||||||||||||| || ||||| |||||||| ||| | ||| |||||||||||||| Sbjct 1823 TACCGGAAGCTCTGCCCCCGGCTAGACGACCCTGCATGGAC-CCCGGGCCCCAGCCTCCT 1881 Query 2083 CAGCCTGCAAATGCGGGTCACTCCTAAGCTCATGGCACTGACCTGGGATGGTTTTCCTCT 2142 ||||||||| ||||||||||| ||||| ||||||||||| ||||||||||| || ||||| Sbjct 1882 CAGCCTGCAGATGCGGGTCACACCTAAACTCATGGCACTTACCTGGGATGGCTTCCCTCT 1941 Query 2143 ACACTACTCAGACTC-TCATGGTTGGGGCTACCTAGTGCCTGGGCGTCGGGATAATCTGA 2201 ||||||||||| | |||||| ||||||||| | ||||||||||| ||||| || ||| Sbjct 1942 GCACTACTCAGA-GCGTCATGGCTGGGGCTACTTGGTGCCTGGGCGGCGGGACAACCTGG 2000 Query 2202 CCGAGCCGCCAGTGA-GCCCCACTGTAGAATCCGCTGCAGTAACCTGCCCCTACAGAGCC 2260 || ||| ||| | | | |||| | || || |||| || |||||||||||||||| Sbjct 2001 CCAAGCTGCC-GACAGGTACCACCCTGGAGTCAGCTGGGGTGGTCTGCCCCTACAGAGCC 2059 Query 2261 ATCGAGTCCTTATACAGGAAGCACTGCCTTGAACAGGGGAAGCAGCAATTGGA-GCCCCA 2319 ||||||||| | |||||||||||||| || ||||||||||||||||| | || |||||| Sbjct 2060 ATCGAGTCCCTGTACAGGAAGCACTGTCTCGAACAGGGGAAGCAGCAGCT-GATGCCCCA 2118 Query 2320 GGAGGTAGACCTGGCTGAGGAGTTCTTACTCACTGACAGTAGTGCCATGTGGCAAACGGT 2379 ||||| | |||||| ||||||||| | |||||||||| ||||||||| ||||||||||| Sbjct 2119 GGAGGCCGGCCTGGCGGAGGAGTTCCTGCTCACTGACAATAGTGCCATATGGCAAACGGT 2178 Query 2380 AGAAGAACTGGGCTGCTTAGACGTAGAGGCTGAGGCCAAGATGGAGAA-TT-C-AG-GGC 2435 ||||||||||| | |||||| || ||||||||||||||||||||||| || | || || Sbjct 2179 AGAAGAACTGGATTACTTAGAAGTGGAGGCTGAGGCCAAGATGGAGAACTTGCGAGCTGC 2238 Query 2436 --TG--A-GCCAACCTCTAGTTCTGCCTG-CTGCTTGTGCCCCCAAATCCAGCCAGCCCA 2489 || | | ||||| |||| |||| ||| | | | ||| |||||| || |||||||| Sbjct 2239 AGTGCCAGGTCAACCCCTAGCTCTGACTGCCCG-TGGTGGCCCCAAGGACACCCAGCCCA 2297 Query 2490 CG-TATCACCATGGCAACGGACCTTATAATGATGTGAATATCCCTGGTTGCTGGTTTTTC 2548 | |||||||||||||| |||||||| || || ||| | |||||||| |||||||||||| Sbjct 2298 -GCTATCACCATGGCAATGGACCTTACAACGACGTGGACATCCCTGGCTGCTGGTTTTTC 2356 Query 2549 AAGCTGCCTCACAAGGACGGTAACAACTACAATGTGGGCAGTCCCTTTGCCAAAGATTTC 2608 ||||||||||||||||| ||||| | || |||||||| || ||||||||||| || ||| Sbjct 2357 AAGCTGCCTCACAAGGATGGTAATAGCTGTAATGTGGGAAGCCCCTTTGCCAAGGACTTC 2416 Query 2609 CTGCCCAAGATGGAGGATGGCACCCTGCAGGCTGGCCCAGGAGGTGCCAGTGGGCCTCGT 2668 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct 2417 CTGCCCAAGATGGAGGATGGCACCCTGCAGGCTGGCCCAGGAGGTGCCAGTGGGCCCCGT 2476 Query 2669 GCCCTGGAAATAAATAAAATGATTTCTTTTTGGAGGAATGCTCATAAACGTATCAGTTCC 2728 || |||||||| || |||||||||||||| |||||||| || |||||||||||||| ||| Sbjct 2477 GCTCTGGAAATCAACAAAATGATTTCTTTCTGGAGGAACGCCCATAAACGTATCAGCTCC 2536 Query 2729 CAGATGGTGGTATGGCTCCCCAGGTCAGCTCTGCCCCGGGTTGTGACCAGGCACCCC-AG 2787 ||||||||||| ||||| |||||||||||||||||||| | ||||| |||||||||| | Sbjct 2537 CAGATGGTGGTGTGGCTGCCCAGGTCAGCTCTGCCCCGTGCTGTGATCAGGCACCCCGA- 2595 Query 2788 CT-TCGATGAGGAAGGCCACTATGGGGCCATCCTACCCCAGGTGGTGACTGCTGGCACCA 2846 || | ||||||||||||| ||||||||||||||| ||||| ||||||||||| ||||||| Sbjct 2596 CTAT-GATGAGGAAGGCCTCTATGGGGCCATCCTGCCCCAAGTGGTGACTGCCGGCACCA 2654 Query 2847 TCACCCGTCGAGCTGTGGAGCCCACGTGGCTCACTGCCAGTAATGCTCGGCCTGACCGGG 2906 |||| || || |||||||||||||| |||||||| ||||| ||||| ||||||||||| | Sbjct 2655 TCACTCGCCGGGCTGTGGAGCCCACATGGCTCACCGCCAGCAATGCCCGGCCTGACCGAG 2714 Query 2907 TAGGCAGTGAGTTGAAAGCCATGGTGCAGGCTCCACCTGGCTATGTCCTTGTGGGTGCTG 2966 ||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| Sbjct 2715 TAGGCAGTGAGTTGAAAGCCATGGTGCAGGCCCCACCTGGCTACACCCTTGTGGGTGCTG 2774 Query 2967 ATGTGGACTCACAGGAACTGTGGATCGCAGCTGTACTTGGAGATGCTCACTTTGCTGGGA 3026 |||||||||| || || |||||||| |||||||| |||||||| || |||||||| || | Sbjct 2775 ATGTGGACTCCCAAGAGCTGTGGATTGCAGCTGTGCTTGGAGACGCCCACTTTGCCGGCA 2834 Query 3027 TGCATGGCTGCACGGCCTTTGGCTGGATGACTCTGCAGGGCAGGAAGAGCAGAGGCACTG 3086 ||||||||||||| |||||||| |||||||| |||||||||||||||||||| ||||||| Sbjct 2835 TGCATGGCTGCACAGCCTTTGGGTGGATGACACTGCAGGGCAGGAAGAGCAGGGGCACTG 2894 Query 3087 ATCTGCACAGCAAGACAGCTGCCACTGTGGGCATCAGCCGAGAGCATGCCAAAATCTTCA 3146 |||| ||||| |||||||| | ||||||||||||||||| ||||||||||||||||||| Sbjct 2895 ATCTACACAGTAAGACAGCCACTACTGTGGGCATCAGCCGTGAGCATGCCAAAATCTTCA 2954 Query 3147 ACTATGGCCGCATCTATGGGGCTGGGCAGTCCTTTGCTGAGCGCCTACTGATGCAGTTCA 3206 |||| |||||||||||||| ||||||||| |||||||||||||| |||| |||||||| | Sbjct 2955 ACTACGGCCGCATCTATGGTGCTGGGCAGCCCTTTGCTGAGCGCTTACTAATGCAGTTTA 3014 Query 3207 ACCACAGGCTCACA-AGGCAGGAGGCAGCTGAGAAGGCCCAGCAGATGTATGCAGTCACA 3265 ||||| |||||||| || |||||||||||||||||||||||||||||||| || | ||| Sbjct 3015 ACCACCGGCTCACACAG-CAGGAGGCAGCTGAGAAGGCCCAGCAGATGTACGCTGCCACC 3073 Query 3266 AAAGGCCTGCGCCGGTATCGGCTGTCTGCGGATGGTGAGTGGCTGGTGAAACAGTTGAAT 3325 || ||||| ||| ||||||||||||| | || || ||||||||||||| ||||||| Sbjct 3074 AAGGGCCTCCGCTGGTATCGGCTGTCGGATGAGGGCGAGTGGCTGGTGAGGGAGTTGAAC 3133 Query 3326 CTTCCTGTGGACAGGACAGAGGACGGCTGGGTCTCCCTACAAGATCTTCG-AATGATCC- 3383 || || ||||||||||| |||| |||||| | ||||| || ||||| || || | ||| Sbjct 3134 CTCCCAGTGGACAGGACTGAGGGTGGCTGGATTTCCCTGCAGGATCTGCGCAAGG-TCCA 3192 Query 3384 GAAGAGAAGCTTCAAGGAAGTCAC-GATGGAAGAAGTGGGAGGTAGCCT-CTGAACGAGC 3441 || ||||| || |||||||||||| | ||||||||||||||||| | | ||||||| || Sbjct 3193 GA-GAGAAACTGCAAGGAAGTCACAG-TGGAAGAAGTGGGAGGTGGT-TGCTGAACGGGC 3249 Query 3442 ATGGACAGGGGG-CACAGAGTCAGAAATGTTTAATAAGCTGGAGAGTATTGCCATGTCTG 3500 ||||| |||||| |||||||||||||||||| |||||||| ||||| ||||| | ||||| Sbjct 3250 ATGGA-AGGGGGGCACAGAGTCAGAAATGTTCAATAAGCTTGAGAGCATTGCTACGTCTG 3308 Query 3501 ATACACCACGTACCCCAGTACTGGGCTGCTGCATCAGCAGAGCCTTGGAGCCCTCAGTTG 3560 | | |||||||||||| || |||||||||||||||||| ||||| |||||||||| | || Sbjct 3309 ACATACCACGTACCCCGGTGCTGGGCTGCTGCATCAGCCGAGCCCTGGAGCCCTCGGCTG 3368 Query 3561 TCCAGGGAGAGTTTATAACCAGTCGTGTGAACTGGGTGGTACAGAGCTCTGCTGTAGACT 3620 |||||| ||||||||| ||||| |||||||| ||||||||||||||||||||||| |||| Sbjct 3369 TCCAGGAAGAGTTTATGACCAGCCGTGTGAATTGGGTGGTACAGAGCTCTGCTGTTGACT 3428 Query 3621 ACTTACATCTCATGCTTGTGGCCATGAAGTGGCTGTTTGAGGAATTTGCCATTGATGGGC 3680 ||||||| |||||||||||||||||||||||||||||||| || |||||||| ||||||| Sbjct 3429 ACTTACACCTCATGCTTGTGGCCATGAAGTGGCTGTTTGAAGAGTTTGCCATAGATGGGC 3488 Query 3681 GCTTCTGCATCAGCATCCACGACGAGGTTCGCTACCTGGTGCGTGAGGAGGACCGCTACC 3740 ||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||| Sbjct 3489 GCTTCTGCATCAGCATCCATGACGAGGTTCGCTACCTGGTGCGGGAGGAGGACCGCTACC 3548 Query 3741 GTGCCGCCCTGGCACT-GCAGATCACCAATCTCCTGACCAGGTGCATGTTTGCCTATAAG 3799 | || |||||||| || |||||||||||| ||| |||||||||||||||||||||| ||| Sbjct 3549 GCGCTGCCCTGGC-CTTGCAGATCACCAACCTCTTGACCAGGTGCATGTTTGCCTACAAG 3607 Query 3800 CTGGGTCTGAATGATCT-GCCCCAGTCAGTCGCCTTTTTCAGTGCAGTAGACATTGACCA 3858 |||||||||||||| || |||||||||||||||||||||||||||||| || ||||||| Sbjct 3608 CTGGGTCTGAATGA-CTTGCCCCAGTCAGTCGCCTTTTTCAGTGCAGTCGATATTGACCG 3666 Query 3859 GTGCCTCAGGAAGGAAGTGACCATGGACTGTAAAACTCCTTCTAACCCAACTGGGATGGA 3918 ||||||||||||||||||||||||||| |||||||| ||||| ||||||||||||||||| Sbjct 3667 GTGCCTCAGGAAGGAAGTGACCATGGATTGTAAAACCCCTTCCAACCCAACTGGGATGGA 3726 Query 3919 AAGGAGATATGGGATCCCCCAGGGTGAAGCACTGGATATTTACCAGATAATTGAACTCAC 3978 ||||||||| ||||| |||||||||||||| ||||||||||||||||||||||||||||| Sbjct 3727 AAGGAGATACGGGATTCCCCAGGGTGAAGCGCTGGATATTTACCAGATAATTGAACTCAC 3786 Query 3979 CAAAGGCTCCTTGGAAAAACGAAGCCAGCCTGGACCCTAGCTCTGTCTGGAGGTTCTGTA 4038 |||||||||||||||||||||||||||||||||||| |||| ||| ||||||| |||||| Sbjct 3787 CAAAGGCTCCTTGGAAAAACGAAGCCAGCCTGGACCATAGCACTGCCTGGAGGCTCTGTA 3846 Query 4039 TTTGCTCCTGTGGAGCTTTATTGGAGCGG-TGCAGGTTCCTAAACTCAGGCTTTCAGATG 4097 |||||||| ||||||||| || || | || |||||| ||| |||||||||||||||| || Sbjct 3847 TTTGCTCCCGTGGAGCTTCATCGGGGTGGGTGCAGGCTCCCAAACTCAGGCTTTCAGCTG 3906 Query 4098 TGCTTTTTTGCAAAA-GGC------A-G-CCA----TTTTTCTGTAGCAGGACCTGCCCA 4144 |||||||| |||||| ||| | | ||| |||||| ||||||||||||||| | Sbjct 3907 TGCTTTTT-GCAAAACGGCTTGCCTAAGGCCAGCCATTTTTCAGTAGCAGGACCTGCCAA 3965 Query 4145 GGAA-AGTCCTCCTAACGGAAGG--CAC---AATTCAGTGCGTTCAGAACCAGGACACCA 4198 | || | |||| ||||| ||||| || ||||||||| ||||||||||| || ||| Sbjct 3966 G-AAGATTCCTTCTAACTGAAGGTGCAGTTGAATTCAGTGGGTTCAGAACCAAGATGCCA 4024 Query 4199 ACATCAGTGCAGG-CTGT-GTGACAAGGGGTA------CT-GTTGGGCACAAATGAAGCA 4249 ||||| ||| || || | ||||||||| | || |||||| | |||||||||| Sbjct 4025 ACATCGGTGT-GGACTACAG-GACAAGGGGCATTGTTGCTTGTTGGGTAAAAATGAAGCA 4082 Query 4250 GATGCCCCAAAGGTCACATTAACTCAGGCATTTC-TTCCT-----CCT---CTTCTTGGC 4300 || ||||||||| ||||||||||||||||||||| || | ||| ||||||||| Sbjct 4083 GAAGCCCCAAAGTTCACATTAACTCAGGCATTTCATTTATTTTTTCCTTTTCTTCTTGGC 4142 Query 4301 TGGTTCTCTGTCCTG-CTGTGTATG-TGCTGATGCAGTGCCCTAGAAGGGGA 4350 ||||||| ||| ||| | ||| | |||||||||||||||||||||||| Sbjct 4143 TGGTTCTTTGTTCTGTCCCCC-ATGCT-CTGATGCAGTGCCCTAGAAGGGGA 4192 Score = 209 bits (113), Expect = 7e-50 Identities = 186/220 (84%), Gaps = 10/220 (4%) Strand=Plus/Plus Query 265 GGACGCGTCTCTCTCTGA-GTCTTTCGGCCACTAAAAGCAGTCAAGCTGGAGCCCAAAGC 323 ||||| ||||||||| | ||||| | |||| |||||| || |||||||||||||||||| Sbjct 1 GGACGTGTCTCTCTC-CACGTCTTCCAGCCAGTAAAAGAAGCCAAGCTGGAGCCCAAAGC 59 Query 324 CCGGTGCCCCGACTCACAGCG-GGGGGCTCCCTGCACCAACCATGAGCCGCCTGCTCTGG 382 | |||| | ||||| ||||| ||||| |||||||||||||||||||||||||||||||| Sbjct 60 CAGGTGTTCTGACTCCCAGCGTGGGGG-TCCCTGCACCAACCATGAGCCGCCTGCTCTGG 118 Query 383 AAGAAGGTGGCTGGCGCCAAGGTCGC-CTCAGGGCCAGTACCAGCAACCGCG-CGCTGGG 440 | ||||||||| ||||||| |||| | ||||||| || ||||| ||| | ||||||| Sbjct 119 AGGAAGGTGGCCGGCGCCACCGTCGGGC-CAGGGCCGGTTCCAGCT-CCGGGGCGCTGGG 176 Query 441 TCTCCAGCTCCGTCCTCGACC-CCGTCCCCAGCGACGGGC 479 ||||||||||||||| || | ||| |||||||||||||| Sbjct 177 TCTCCAGCTCCGTCCCCG-CGTCCGACCCCAGCGACGGGC 215 >ref|XM_523149.2| Gene info PREDICTED: Pan troglodytes polymerase (DNA directed), gamma (POLG), mRNA Length=4226 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 4193 bits (2270), Expect = 0.0 Identities = 3295/3781 (87%), Gaps = 106/3781 (2%) Strand=Plus/Plus Query 489 CGCAAATGCCCTCCTCCGAGAATGGGCAGCTGCGGCTCAACCC-TCTGCTCATCCAGATG 547 ||||| ||| ||||| ||| ||||||| ||||| |||||| | || |||||||||| Sbjct 473 CGCAAGTGCTATCCTCGGAGGGCGGGCAGCCGCGGCACAACCCAT-TGGACATCCAGATG 531 Query 548 TTGTCGAGAGGCCTGCACGAGCAGATCTTCGGGTGCGGCGGGGAAATGCCCGACGAGGCC 607 | |||||||| ||||||||||| ||||||||| || ||||| ||||| | ||||||| Sbjct 532 CTCTCGAGAGGGCTGCACGAGCAAATCTTCGGGCAAGGAGGGGAGATGCCTGGCGAGGCC 591 Query 608 GCGGTGCAG-CGCAGCGTAGAGCACCTGCAGAAGCACGGGCTCTGGGGGCAGCCGGCCAC 666 ||||||| | |||||||| ||||||||||||||||||||||||||||||||||| ||| Sbjct 592 GCGGTGC-GCCGCAGCGTCGAGCACCTGCAGAAGCACGGGCTCTGGGGGCAGCCAGCCGT 650 Query 667 GCCCTTGCCAGACGTGGAGCTGCGCCTGCC-CCGGCTCTTCGGGGGCAACCTGGACCAGC 725 ||||||||| |||||||||||||||||||| || |||| ||||| |||||||||||||| Sbjct 651 GCCCTTGCCCGACGTGGAGCTGCGCCTGCCGCC-CCTCTACGGGGACAACCTGGACCAGC 709 Query 726 ACTTCCGCCTCCTGGCCCAGAAGCAGAGCCTGCCTTACTTGGAGGCGGCCGCCTCGTTAT 785 |||||||||||||||||||||||||||||||||| ||| ||||||||||| || | | | Sbjct 710 ACTTCCGCCTCCTGGCCCAGAAGCAGAGCCTGCCCTACCTGGAGGCGGCCAACTTGCTGT 769 Query 786 TGGAGGCCCAATTGCCCCCCG-AGCCCAAGAGC-TGGGCCTGGGCGGAGGGCTGGACCCG 843 || ||||||| || |||||| ||||| | || |||||||||||||||||||||||||| Sbjct 770 TGCAGGCCCAGCTG-CCCCCGAAGCCCCCG-GCTTGGGCCTGGGCGGAGGGCTGGACCCG 827 Query 844 GTACGGCCCCGAGGGGGAGGCCGAACCCGTGGCCATCCCCGAGGAGCGGGCCCTGGTGTT 903 ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| Sbjct 828 GTACGGCCCCGAGGGGGAGGCCGTACCCGTGGCCATCCCCGAGGAGCGGGCCCTGGTGTT 887 Query 904 CGACGTGGAGGTCTGCTTGGCAGAGGGAACCTGCCCCACTTTGGCGGTGGCCATATCCCC 963 |||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| Sbjct 888 CGACGTGGAGGTCTGCTTGGCAGAGGGAACTTGCCCCACATTGGCGGTGGCCATATCCCC 947 Query 964 CTCGGCCTGGTATTCCTGGTGCAGCCGGCGGCTGGTGGAAGAGCGTTACTCTTGGACCAG 1023 |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| Sbjct 948 CTCGGCCTGGTATTCCTGGTGCAGCCAGCGGCTGGTGGAAGAGCGTTACTCTTGGACCAG 1007 Query 1024 CCAGCTATCGCCGGCTGACCTAATCCCTTTGGGGGGCTCC-ACTAGTGCCAGCAGCTCCA 1082 |||||| |||||||||||||| ||||| ||| || | || |||||||||||||| ||| Sbjct 1008 CCAGCTGTCGCCGGCTGACCTCATCCCCCTGGAGGTC-CCTGCTAGTGCCAGCAGCCCCA 1066 Query 1083 CCAAGCAG-GA-TGGGCAGGAACAGTTAGTGGTGGGGCACAATGTTTCCTTTGACCGAGC 1140 || || || || | ||||||| |||||||||||||||||||||||||||||||||||||| Sbjct 1067 CCCAG-AGAGACT-GGCAGGAGCAGTTAGTGGTGGGGCACAATGTTTCCTTTGACCGAGC 1124 Query 1141 CCATATCAGGGAACAGTATCTGATTCAGGACTCCCGGATGCGTTTTCTCGATACTATGAG 1200 ||||||||||| ||||| ||||| |||| ||||| |||||||| || || || ||||| Sbjct 1125 TCATATCAGGGAGCAGTACCTGATCCAGGGTTCCCGCATGCGTTTCCTGGACACCATGAG 1184 Query 1201 CATGCACATGGCCATCTCGGGGCTGAGCAGCTTCCAGCGCAGCCTGTGGATGGGAGCCAA 1260 |||||||||||||||||| ||||| ||||||||||||||||| |||||||| | |||||| Sbjct 1185 CATGCACATGGCCATCTCAGGGCTAAGCAGCTTCCAGCGCAGTCTGTGGATAGCAGCCAA 1244 Query 1261 GCAGGGAAAGCACAAGACCCAGCAGTCCACAAAGCGAGGGCAGAAGTCCCCGAGGAAAGC 1320 |||||| ||||||||| ||||| |||||||||| ||| |||||||||| ||||||||| Sbjct 1245 GCAGGGCAAGCACAAGGTCCAGCCCTCCACAAAGCAAGGCCAGAAGTCCCAGAGGAAAGC 1304 Query 1321 C--AA-TGGTCCAGCGATCTCATCTTGGGACTGGATGGATATCAGCAGTGCCAATAATCT 1377 | || || |||||||||||||| ||||||||| |||| |||||||||| ||| | ||| Sbjct 1305 CAGAAGAGGCCCAGCGATCTCATCCTGGGACTGGCTGGACATCAGCAGTGTCAACAGTCT 1364 Query 1378 TGCAGATGTGCACA-ACCTTTATGT-GGGGGGACCTCCCTTAGAGAAGGAGCCTCGGGAG 1435 ||||| ||||||| | |||||||| |||||| ||||||||||||||||||||||| || Sbjct 1365 GGCAGAGGTGCACAGA-CTTTATGTAGGGGGG-CCTCCCTTAGAGAAGGAGCCTCGAGAA 1422 Query 1436 CTGTTCGTCAAAGGCAGCATGAGGGATATCCGAGAGAACTTCCAGGATCTGATGCAGTAC 1495 ||||| || || |||| ||||| ||| || || |||||||||||||| |||||||||||| Sbjct 1423 CTGTTTGTGAAGGGCACCATGAAGGACATTCGTGAGAACTTCCAGGACCTGATGCAGTAC 1482 Query 1496 TGCGCCC-GTGATGTGTGGGCCACCTTTGAGGTTTTCCAGCAGCAGCTGCCACTCTTCTT 1554 || |||| | || |||||||||||| ||||||||||||||||||||| || |||||||| Sbjct 1483 TGTGCCCAG-GACGTGTGGGCCACCCATGAGGTTTTCCAGCAGCAGCTACCGCTCTTCTT 1541 Query 1555 GGAGAGGTGTCCCCACCCAGTGACTCTGGCTGGCATGCTGGAGATGGGTGTGTCCTACCT 1614 |||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||| Sbjct 1542 GGAGAGGTGTCCCCACCCAGTGACTCTGGCCGGCATGCTGGAGATGGGTGTCTCCTACCT 1601 Query 1615 GCCTGTCAACCAGAACTGGGAGCGTTACCTGACAGAGGCACAGAACACATATGAGGAGCT 1674 ||||||||||||||||||||||||||||||| ||||||||||| ||| ||||||||||| Sbjct 1602 GCCTGTCAACCAGAACTGGGAGCGTTACCTGGCAGAGGCACAGGGCACTTATGAGGAGCT 1661 Query 1675 CCAGCGGGAGATGAAGAAGTCGCTGATGGATCTGGCTAATGATGCCTGTCAGTTGCTCTC 1734 |||||||||||||||||||||| ||||||||||||| ||||||||||| ||| ||||||| Sbjct 1662 CCAGCGGGAGATGAAGAAGTCGTTGATGGATCTGGCCAATGATGCCTGCCAGCTGCTCTC 1721 Query 1735 AGGAGAGAGGTACAAAGAAGACCCTTGGCTCTGGGACCTAGAATGGGATTTGCAGGAGTT 1794 |||||||||||||||||| ||||| |||||||||||||| || ||||| |||| || || Sbjct 1722 AGGAGAGAGGTACAAAGACGACCCCTGGCTCTGGGACCTGGAGTGGGACCTGCAAGAATT 1781 Query 1795 TAAGCAGAA-AAAGGCAAAGAAGGTGAAGAA-G--CCAGCCTCAGCCAGCAAGTTGCCCA 1850 ||||||||| ||| || | |||||||||||| | |||||| |||||||||||||||||| Sbjct 1782 TAAGCAGAAGAAA-GCTAGGAAGGTGAAGAAGGAACCAGCCACAGCCAGCAAGTTGCCCA 1840 Query 1851 TCGAGGGAGCT-GGGCCCTTTGGGGATCCCATGGATCAGGAAGATCCT-GGCCCGC-CCA 1907 ||||||| ||| |||||| ||| |||||||||||||||||||| ||| ||||| | || Sbjct 1841 TCGAGGGGGCTGGGGCCC-CTGGTGATCCCATGGATCAGGAAGA-CCTCGGCCC-CTGCA 1897 Query 1908 GCGAGGAGGAGGAGCTTCAGCGAAG-TGTAACAGCCCACAACC-GGTTACAGCAGCTG-A 1964 | |||||||||||| |||| | ||| ||| | |||| | || | || ||| ||||| | Sbjct 1898 GTGAGGAGGAGGAGTTTCAAC-AAGATGTCATGGCCCGC-GCCTGCTTGCAGAAGCTGAA 1955 Query 1965 GGAGCACCACGGACCTCCTGCCTAAGCGACCCCAGCACCTTCCAGGACACCCTGGGTGGT 2024 || | ||||| || |||||||| ||||| |||||||||||||| ||||| ||||| |||| Sbjct 1956 GG-GGACCACAGAGCTCCTGCCCAAGCGGCCCCAGCACCTTCCTGGACATCCTGGATGGT 2014 Query 2025 ACCGGAAGCTCTGCCCTCGACTAGATGACCCTGCCTGGGCTCCC-GGCCCCAGCCTCCTC 2083 |||||||||||||||| || ||||| |||||||| ||| | ||| ||||||||||||||| Sbjct 2015 ACCGGAAGCTCTGCCCCCGGCTAGACGACCCTGCATGGAC-CCCGGGCCCCAGCCTCCTC 2073 Query 2084 AGCCTGCAAATGCGGGTCACTCCTAAGCTCATGGCACTGACCTGGGATGGTTTTCCTCTA 2143 |||||||| ||||||||||| ||||| ||||||||||||||||||||||| || ||||| Sbjct 2074 AGCCTGCAGATGCGGGTCACACCTAAACTCATGGCACTGACCTGGGATGGCTTCCCTCTG 2133 Query 2144 CACTACTCAGACTC-TCATGGTTGGGGCTACCTAGTGCCTGGGCGTCGGGATAATCTGAC 2202 ||||||||||| | |||||| ||||||||||| ||||||||||| ||||| || ||| | Sbjct 2134 CACTACTCAGA-GCGTCATGGCTGGGGCTACCTGGTGCCTGGGCGGCGGGACAACCTGGC 2192 Query 2203 CGAGCCGCCAGTGA-GCCCCACTGTAGAATCCGCTGCAGTAACCTGCCCCTACAGAGCCA 2261 | ||| ||| | | | |||| | || || |||| || ||||||||||||||||| Sbjct 2193 CAAGCTGCC-GACAGGTACCACCCTGGAGTCAGCTGGGGTGGTCTGCCCCTACAGAGCCA 2251 Query 2262 TCGAGTCCTTATACAGGAAGCACTGCCTTGAACAGGGGAAGCAGCAATTGGA-GCCCCAG 2320 |||||||| | |||||||||||||| || ||||||||||||||||| | || ||||||| Sbjct 2252 TCGAGTCCCTGTACAGGAAGCACTGTCTCGAACAGGGGAAGCAGCAGCT-GATGCCCCAG 2310 Query 2321 GAGGTAGACCTGGCTGAGGAGTTCTTACTCACTGACAGTAGTGCCATGTGGCAAACGGTA 2380 |||| | |||||| ||||||||| | |||||||||| ||||||||| |||||||||||| Sbjct 2311 GAGGCCGGCCTGGCCGAGGAGTTCCTGCTCACTGACAATAGTGCCATATGGCAAACGGTA 2370 Query 2381 GAAGAACTGGGCTGCTTAGACGTAGAGGCTGAGGCCAAGATGGAGAA-TT-C-AG-GGC- 2435 |||||||||| | |||||| || ||||||||||||||||||||||| || | || || Sbjct 2371 GAAGAACTGGATTACTTAGAAGTGGAGGCTGAGGCCAAGATGGAGAACTTGCGAGCTGCA 2430 Query 2436 -TG--A-GCCAACCTCTAGTTCTGCCTG-CTGCTTGTGCCCCCAAATCCAGCCAGCCCAC 2490 || | | ||||| |||| |||| ||| | | | ||| |||||| || |||||||| Sbjct 2431 GTGCCAGGTCAACCCCTAGCTCTGACTGCCCG-TGGTGGCCCCAAGGACACCCAGCCCA- 2488 Query 2491 G-TATCACCATGGCAACGGACCTTATAATGATGTGAATATCCCTGGTTGCTGGTTTTTCA 2549 | |||||||||||||| |||||||| || || ||| | |||||||| ||||||||||||| Sbjct 2489 GCTATCACCATGGCAATGGACCTTACAACGACGTGGACATCCCTGGCTGCTGGTTTTTCA 2548 Query 2550 AGCTGCCTCACAAGGACGGTAACAACTACAATGTGGGCAGTCCCTTTGCCAAAGATTTCC 2609 |||||||||||||||| ||||| | || |||||||| || ||||||||||| || |||| Sbjct 2549 AGCTGCCTCACAAGGATGGTAATAGCTGTAATGTGGGAAGCCCCTTTGCCAAGGACTTCC 2608 Query 2610 TGCCCAAGATGGAGGATGGCACCCTGCAGGCTGGCCCAGGAGGTGCCAGTGGGCCTCGTG 2669 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| Sbjct 2609 TGCCCAAGATGGAGGATGGCACCCTGCAGGCTGGCCCAGGAGGTGCCAGTGGGCCCCGTG 2668 Query 2670 CCCTGGAAATAAATAAAATGATTTCTTTTTGGAGGAATGCTCATAAACGTATCAGTTCCC 2729 | |||||||| || |||||||||||||| |||||||| || |||||||||||||| || | Sbjct 2669 CTCTGGAAATCAACAAAATGATTTCTTTCTGGAGGAACGCCCATAAACGTATCAGCTCTC 2728 Query 2730 AGATGGTGGTATGGCTCCCCAGGTCAGCTCTGCCCCGGGTTGTGACCAGGCACCCC-AGC 2788 |||||||||| ||||| |||||||||||||||||||| | ||||| |||||||||| | | Sbjct 2729 AGATGGTGGTGTGGCTGCCCAGGTCAGCTCTGCCCCGTGCTGTGATCAGGCACCCCGA-C 2787 Query 2789 T-TCGATGAGGAAGGCCACTATGGGGCCATCCTACCCCAGGTGGTGACTGCTGGCACCAT 2847 | | ||||||||||||| ||||||||||||||| ||||| ||||||||||| |||||||| Sbjct 2788 TAT-GATGAGGAAGGCCTCTATGGGGCCATCCTGCCCCAAGTGGTGACTGCCGGCACCAT 2846 Query 2848 CACCCGTCGAGCTGTGGAGCCCACGTGGCTCACTGCCAGTAATGCTCGGCCTGACCGGGT 2907 || || || |||||||||||||| |||||||| ||||| ||||| ||||||||||| || Sbjct 2847 TACTCGCCGGGCTGTGGAGCCCACATGGCTCACCGCCAGCAATGCCCGGCCTGACCGAGT 2906 Query 2908 AGGCAGTGAGTTGAAAGCCATGGTGCAGGCTCCACCTGGCTATGTCCTTGTGGGTGCTGA 2967 |||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||| Sbjct 2907 AGGCAGTGAGTTGAAAGCCATGGTGCAGGCCCCACCTGGCTACACCCTTGTGGGTGCTGA 2966 Query 2968 TGTGGACTCACAGGAACTGTGGATCGCAGCTGTACTTGGAGATGCTCACTTTGCTGGGAT 3027 ||||||||| || || |||||||| |||||||| |||||||| || |||||||| || || Sbjct 2967 TGTGGACTCCCAAGAGCTGTGGATTGCAGCTGTGCTTGGAGACGCCCACTTTGCCGGCAT 3026 Query 3028 GCATGGCTGCACGGCCTTTGGCTGGATGACTCTGCAGGGCAGGAAGAGCAGAGGCACTGA 3087 |||||||||||| |||||||| |||||||| |||||||||||||||||||| |||||||| Sbjct 3027 GCATGGCTGCACAGCCTTTGGGTGGATGACACTGCAGGGCAGGAAGAGCAGGGGCACTGA 3086 Query 3088 TCTGCACAGCAAGACAGCTGCCACTGTGGGCATCAGCCGAGAGCATGCCAAAATCTTCAA 3147 ||| ||||| |||||||| | ||||||||||||||||| |||||||||||||||||||| Sbjct 3087 TCTACACAGTAAGACAGCCACTACTGTGGGCATCAGCCGTGAGCATGCCAAAATCTTCAA 3146 Query 3148 CTATGGCCGCATCTATGGGGCTGGGCAGTCCTTTGCTGAGCGCCTACTGATGCAGTTCAA 3207 ||| |||||||||||||| ||||||||| |||||||||||||| |||| |||||||| || Sbjct 3147 CTACGGCCGCATCTATGGTGCTGGGCAGCCCTTTGCTGAGCGCTTACTAATGCAGTTTAA 3206 Query 3208 CCACAGGCTCACA-AGGCAGGAGGCAGCTGAGAAGGCCCAGCAGATGTATGCAGTCACAA 3266 |||| |||||||| || |||||||||||||||||||||||||||||||| || | ||| | Sbjct 3207 CCACCGGCTCACACAG-CAGGAGGCAGCTGAGAAGGCCCAGCAGATGTACGCTGCCACCA 3265 Query 3267 AAGGCCTGCGCCGGTATCGGCTGTCTGCGGATGGTGAGTGGCTGGTGAAACAGTTGAATC 3326 | ||||| ||| ||||||||||||| | || || ||||||||||||| ||||||| | Sbjct 3266 AGGGCCTCCGCTGGTATCGGCTGTCGGATGAGGGCGAGTGGCTGGTGAGGGAGTTGAACC 3325 Query 3327 TTCCTGTGGACAGGACAGAGGACGGCTGGGTCTCCCTACAAGATCTTCG-AATGATCC-G 3384 | || ||||||||||| |||| |||||| | ||||| || ||||| || || | ||| | Sbjct 3326 TCCCAGTGGACAGGACTGAGGGTGGCTGGATTTCCCTGCAGGATCTGCGCAAGG-TCCAG 3384 Query 3385 AAGAGAAGCTTCAAGGAAGTCAC-GATGGAAGAAGTGGGAGGTAGCCT-CTGAACGAGCA 3442 | ||||| || | |||||||||| | ||||||||||||||||| | | ||||||| ||| Sbjct 3385 A-GAGAAACTGCCAGGAAGTCACAG-TGGAAGAAGTGGGAGGTGGT-TGCTGAACGGGCA 3441 Query 3443 TGGACAGGGGG-CACAGAGTCAGAAATGTTTAATAAGCTGGAGAGTATTGCCATGTCTGA 3501 |||| |||||| |||||||||||||||||| |||||||| ||||| ||||||| |||||| Sbjct 3442 TGGA-AGGGGGGCACAGAGTCAGAAATGTTCAATAAGCTTGAGAGCATTGCCACGTCTGA 3500 Query 3502 TACACCACGTACCCCAGTACTGGGCTGCTGCATCAGCAGAGCCTTGGAGCCCTCAGTTGT 3561 | |||||||||||| || |||||||||||||||||| ||||| |||||||||| | ||| Sbjct 3501 CATACCACGTACCCCGGTGCTGGGCTGCTGCATCAGCCGAGCCCTGGAGCCCTCGGCTGT 3560 Query 3562 CCAGGGAGAGTTTATAACCAGTCGTGTGAACTGGGTGGTACAGAGCTCTGCTGTAGACTA 3621 ||||| ||||||||| ||||| |||||||| ||||||||||||||||||||||| ||||| Sbjct 3561 CCAGGAAGAGTTTATGACCAGCCGTGTGAATTGGGTGGTACAGAGCTCTGCTGTTGACTA 3620 Query 3622 CTTACATCTCATGCTTGTGGCCATGAAGTGGCTGTTTGAGGAATTTGCCATTGATGGGCG 3681 |||||| |||||||||||||||||||||||||||||||| || |||||||| |||||||| Sbjct 3621 CTTACACCTCATGCTTGTGGCCATGAAGTGGCTGTTTGAAGAGTTTGCCATAGATGGGCG 3680 Query 3682 CTTCTGCATCAGCATCCACGACGAGGTTCGCTACCTGGTGCGTGAGGAGGACCGCTACCG 3741 |||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||| Sbjct 3681 CTTCTGCATCAGCATCCATGACGAGGTTCGCTACCTGGTGCGGGAGGAGGACCGCTACCG 3740 Query 3742 TGCCGCCCTGGCACT-GCAGATCACCAATCTCCTGACCAGGTGCATGTTTGCCTATAAGC 3800 || |||||||| || |||||||||||| ||| |||||||||||||||||||||| |||| Sbjct 3741 CGCTGCCCTGGC-CTTGCAGATCACCAACCTCTTGACCAGGTGCATGTTTGCCTACAAGC 3799 Query 3801 TGGGTCTGAATGATCT-GCCCCAGTCAGTCGCCTTTTTCAGTGCAGTAGACATTGACCAG 3859 ||||||||||||| || |||||||||||||||||||||||||||||| || ||||||| | Sbjct 3800 TGGGTCTGAATGA-CTTGCCCCAGTCAGTCGCCTTTTTCAGTGCAGTCGATATTGACCGG 3858 Query 3860 TGCCTCAGGAAGGAAGTGACCATGGACTGTAAAACTCCTTCTAACCCAACTGGGATGGAA 3919 |||||||||||||||||||||||||| |||||||| ||||| |||||||||||||||||| Sbjct 3859 TGCCTCAGGAAGGAAGTGACCATGGATTGTAAAACCCCTTCCAACCCAACTGGGATGGAA 3918 Query 3920 AGGAGATATGGGATCCCCCAGGGTGAAGCACTGGATATTTACCAGATAATTGAACTCACC 3979 |||||||| ||||| |||||||||||||| |||||||||||||||||||||||||||||| Sbjct 3919 AGGAGATACGGGATTCCCCAGGGTGAAGCGCTGGATATTTACCAGATAATTGAACTCACC 3978 Query 3980 AAAGGCTCCTTGGAAAAACGAAGCCAGCCTGGACCCTAGCTCTGTCTGGAGGTTCTGTAT 4039 ||||||||||||||||||||||||||||||||||| |||| ||| ||||||| ||||||| Sbjct 3979 AAAGGCTCCTTGGAAAAACGAAGCCAGCCTGGACCATAGCACTGCCTGGAGGCTCTGTAT 4038 Query 4040 TTGCTCCTGTGGAGCTTTATT-GGAGCGGTGCAGGTTCCTAAACTCAGGCTTTCAGATGT 4098 ||||||| ||||||||| || || | |||||||| ||| |||||||||||||||| ||| Sbjct 4039 TTGCTCCCGTGGAGCTTCATCAGG-GTGGTGCAGGCTCCCAAACTCAGGCTTTCAGCTGT 4097 Query 4099 GCTTTTTTGCAAAAGG-C------A-G-CCA----TTTTTCTGTAGCAGGACCTGCCCAG 4145 ||||||| |||||||| | | | ||| |||||| ||||||||||||||| || Sbjct 4098 GCTTTTT-GCAAAAGGGCTTGCCTAAGGCCAGCCATTTTTCAGTAGCAGGACCTGCCAAG 4156 Query 4146 GAA-AGTCCTCCTAACGGAAGG--CAC---AATTCAGTGCGTTCAGAACCAGGACACCAA 4199 || | |||| ||||| ||||| || ||||||||| ||||||||||| || |||| Sbjct 4157 -AAGATTCCTTCTAACTGAAGGTGCAGTTGAATTCAGTGGGTTCAGAACCAAGATGCCAA 4215 Query 4200 C 4200 | Sbjct 4216 C 4216 Score = 265 bits (143), Expect = 1e-66 Identities = 313/390 (80%), Gaps = 31/390 (7%) Strand=Plus/Plus Query 100 GAGACCGCACGCCACCCTGAGGCTGCGTGGGCCGCGCG-CCGCGGACGCCGCGTCGT-CG 157 ||| || ||||| |||| |||||||||| ||||||||| | |||||||| | ||| | Sbjct 53 GAGGCCACACGCTACCCCGAGGCTGCGTAGGCCGCGCGAAGGGGGACGCCGTGCCGTGGG 112 Query 158 CC-GGGGCT-GTGGGCTGCCGCAGAACGGGAAGCGCGAAGCGGACCGAGGACTTGTGTGA 215 || |||| | | ||| ||||||| || || ||||| ||| || ||| | | Sbjct 113 CCTGGGG-TCG-GGGGAGCCGCAG-AC------CGGGAAGC--ACC---GATTTG-GGGT 157 Query 216 GGAAGGCAGGCATGGTGAGACCTATTTCACTGACAGGAGCA-CAGAGAGGGGACGCGTCT 274 |||||||||||||||| | ||| |||||||||||||||| | |||||| ||||| |||| Sbjct 158 GGAAGGCAGGCATGGTCAAACCCATTTCACTGACAGGAG-AGCAGAGACAGGACGTGTCT 216 Query 275 CTCTCTGA-GTCTTTCGGCCACTAAAAGCAGTCAAGCTGGAGCCCAAAGCCCGGTGCCCC 333 ||||| | ||||| | |||| |||||| || ||||||||||||||||||| |||| | Sbjct 217 CTCTC-CACGTCTTCCAGCCAGTAAAAGAAGCCAAGCTGGAGCCCAAAGCCAGGTGTTCT 275 Query 334 GACTCACAGCG-GGGGGCTCCCTGCACCAACCATGAGCCGCCTGCTCTGGAAGAAGGTGG 392 ||||| ||||| ||||| ||||||||||||||||||||||||||||||||| |||||||| Sbjct 276 GACTCCCAGCGTGGGGG-TCCCTGCACCAACCATGAGCCGCCTGCTCTGGAGGAAGGTGG 334 Query 393 CTGGCGCCAAGGTCGC-CTCAGGGCCAGTACCAGCAACCGCG-CGCTGGGTCTCCAGCTC 450 | ||||||| |||| | ||||||| || ||||| ||| | ||||||||||||||||| Sbjct 335 CCGGCGCCACCGTCGGGC-CAGGGCCGGTTCCAGCT-CCGGGGCGCTGGGTCTCCAGCTC 392 Query 451 CGTCCTCGACC-CCGTCCCCAGCGACGGGC 479 ||||| || | ||| |||||||||||||| Sbjct 393 CGTCCCCG-CGTCCGACCCCAGCGACGGGC 421 >ref|XR_028572.1| UniGene infoGene info PREDICTED: Bos taurus similar to DNA polymerase gamma (LOC533090), mRNA Length=3975 Score = 3965 bits (2147), Expect = 0.0 Identities = 3388/3980 (85%), Gaps = 114/3980 (2%) Strand=Plus/Plus Query 100 GAGACCGCACGCCACCCTGAGGCTGCGTGGGCCGCGCGCCGCGGACGCC---GCGTCGTC 156 ||| || || ||||||| |||||||| ||||||||| | ||| ||| |||||| | Sbjct 39 GAGGCCACAGGCCACCCCGAGGCTGCACAGGCCGCGCGGAG-GGA-GCCGGGGCGTCGCC 96 Query 157 -GCCGGGGCTGT-GGGCTGCCGCAGAACGGGAA-GC-GCGAAGCGGACCGAGGACTTGTG 212 ||| ||| | | ||| ||||||| || ||| || || |||||| ||||| ||||| Sbjct 97 AGCCTGGG-T-TCGGG-AGCCGCAG-ACCAGAAGGCACCG-GGCGGACTGAGGATTTGTG 151 Query 213 TGAGGAAGGCAGGCATGGTGAG-ACCTATTTCACTGACAGGAGCA-CAGAGAGGGGACGC 270 | |||||||||||||||| || ||| ||||| ||| ||||| | | |||| ||||| Sbjct 152 GGTGGAAGGCAGGCATGGTCAGAACC-ATTTCCCTGGCAGGA-AAGCGGAGACAGGACGT 209 Query 271 GTCTCTCTCTGA-GTCTTTCGGCCACTAAAAGCAGTCAAGCTGGAGCCCAAAGCCCGGTG 329 ||| ||||| | |||| || |||| | || || | ||||||||||||||||||| |||| Sbjct 210 GTCCCTCTC-CACGTCTCTCAGCCAGTGAACGCTGCCAAGCTGGAGCCCAAAGCCAGGTG 268 Query 330 CCCCGACTCACAGCGGGGGGCTCCCTGCACCAACCATGAGCCGCCTGCTCTGGAAGAAGG 389 || ||| | || || ||||||||||||||| |||||||||||||||||||||| ||||| Sbjct 269 TCCTGACGCCCACCGAGGGGCTCCCTGCACCCACCATGAGCCGCCTGCTCTGGAGGAAGG 328 Query 390 TGGCTGGCGCCAAGGTC-GCCTCAGGGCCAGTACCAGCAACCGCG-CGCTGGGTCTCCAG 447 |||| ||||||| ||| | | |||| || || ||||| ||||| || ||||||||||| Sbjct 329 TGGCCGGCGCCACCGTCGGGC-CAGGCCCGGTTCCAGC-TCCGCGACGTTGGGTCTCCAG 386 Query 448 CTCCGTCCT-CGACCCCGTCCCCAGCGACGGGCGGCCGCCGTCGCA---AATGCCCTCCT 503 ||||| ||| ||||||||||||||||||||||| |||| || |||| | |||| |||| Sbjct 387 CTCCG-CCTCCGACCCCGTCCCCAGCGACGGGCCGCCGTCGCCGCAGCCAGTGCCATCCT 445 Query 504 CCGAGAATGGGCAGCTGCGGCTCAA-CCCTCTGCTCATCCAGATGTTGTCGAGAGGCCTG 562 | | | ||||||||||||| ||| |||| ||| |||||||||| | |||||||| || Sbjct 446 CGGTGGGCGGGCAGCTGCGGCACAACCCCT-TGCACATCCAGATGCTCTCGAGAGGGCTC 504 Query 563 CACGAGCAGATCTTCGGGTGCGGCGGGGAAATGCCCGACGAGGCCGCGGTGCAG-CGCAG 621 |||||||||||||||||| ||||||||| | |||||||||||||||||||| | ||||| Sbjct 505 CACGAGCAGATCTTCGGGCCCGGCGGGGAGAGGCCCGACGAGGCCGCGGTGC-GCCGCAG 563 Query 622 CGTAGAGCACCTGCAGAAGCACGGGCTCTGGGGGCAGCCGGCCACGCCCTTGCCAGACGT 681 ||| ||||||||||||||||||||||||||||||||||| ||| |||||||||| ||||| Sbjct 564 CGTGGAGCACCTGCAGAAGCACGGGCTCTGGGGGCAGCCAGCCCCGCCCTTGCCCGACGT 623 Query 682 GGAGCTGCGCCTGCC-CCGGCTCTTCGGGGGCAACCTGGACCAGCACTTCCGCCTCCTGG 740 ||||||||||||||| || ||| ||||||||| ||||||||||||||||||| |||||| Sbjct 624 GGAGCTGCGCCTGCCGCC-CCTCCTCGGGGGCAGCCTGGACCAGCACTTCCGCATCCTGG 682 Query 741 CCCAGAAGCAGAGCCTGCCTTACTTGGAGGCGGCCGCCTCGTTATTGGAGGCCCAATTGC 800 | ||||||||||||||||| ||| ||||||||||| |||| | ||| |||| || ||| Sbjct 683 CGCAGAAGCAGAGCCTGCCCTACCTGGAGGCGGCCAACTCGCTCTTGCAGGCGCAGCTGC 742 Query 801 CCCC-CGAGCCCAAGAGCTGGGCCTGGGCGGAGGGCTGGACCCGGTACGGCCCCGAGGGG 859 |||| || |||| ||||||||||||||||||||||||||||||||||||||||| |||| Sbjct 743 CCCCGCG-GCCCCCGAGCTGGGCCTGGGCGGAGGGCTGGACCCGGTACGGCCCCGCGGGG 801 Query 860 GAGGCCGAACCCGTGGCCATCCCCGAGGAGCGGGCCCTGGTGTTCGACGTGGAGGTCTGC 919 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 802 GAGGCCGAACCCGTGGCCATCCCCGAGGAGCGGGCCCTGGTGTTCGACGTGGAGGTCTGC 861 Query 920 TTGGCAGAGGGAACCTGCCCCACTTTGGCGGTGGCCATATCCCCCTCGGCCTGGTATTCC 979 ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| Sbjct 862 TTGGCAGAGGGAACCTGCCCCACGTTGGCGGTGGCCATATCCCCCTCGGCCTGGTATTCC 921 Query 980 TGGTGCAGCCGGCGGCTGGTGGAAGAGCGTTACTCTTGGACCAGCCAGCTATCGCCGGCT 1039 |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| Sbjct 922 TGGTGCAGCCGGCGGCTGGTGGAAGAGCGTTACTCTTGGACCAGCCAGCTGTCGCCGGCT 981 Query 1040 GACCT-AATCCCTTTGGGGGGCTCCACT---AGTGCCAG-CAGCTCC-AC-CAAGCAG-G 1091 ||||| | |||| | || || ||| || |||||| | |||| || | | ||| | | Sbjct 982 GACCTCATTCCC-CT-GGAGG-TCC-CTGGCAGTGCC-GCCAGC-CCTGCTC-AGC-GAG 1033 Query 1092 ATGGGCAGGAACAGTTAGTGGTGGGGCACAATGTTTCCTTTGACCGAGCCCATATCAGGG 1151 | ||||||| | ||||||||||||||||||||| ||||| ||||||||||| ||| ||| Sbjct 1034 ACCGGCAGGAGCGGTTAGTGGTGGGGCACAATGTGTCCTTCGACCGAGCCCACATCCGGG 1093 Query 1152 AACAGTATCTGATTCAGGACTCCCGGATGCGTTTTCTCGATACTATGAGCATGCACATGG 1211 | ||||| ||||| |||| |||| ||||| || || || || |||||||||||||||| Sbjct 1094 AGCAGTACCTGATCCAGGGTTCCCACATGCGCTTCCTGGACACCATGAGCATGCACATGG 1153 Query 1212 CCATCTCGGGGCTGAGCAGCTTCCAGCGCAGCCTGTGGATGGGAGCCAAGCAGGGAAAGC 1271 ||||||||||||||||||||||||||||||| |||||||||| ||||||||||| |||| Sbjct 1154 CCATCTCGGGGCTGAGCAGCTTCCAGCGCAGTCTGTGGATGGCTGCCAAGCAGGGCAAGC 1213 Query 1272 ACAAGACCCAGCAGTCC-AC-AAAGCGAGGGCAGAAGTCCCCGAGGAAAGCCAATGGTCC 1329 ||||| ||| || || || || ||||| |||||||||| ||| |||||||| || || Sbjct 1214 ACAAGGCCCGGC-CCCCTACTCAA-CGAGGCCAGAAGTCCCAGAGCAAAGCCAACGGCCC 1271 Query 1330 AGCGATCTCATCTTGGGACTGGATGGATATCAGCAGTGCCAATAATCTTGCAGATGTGCA 1389 | ||||||| || ||||||||| |||| ||||| |||| |||||| || ||||| ||||| Sbjct 1272 ACCGATCTCGTCCTGGGACTGGCTGGACATCAGTAGTGTCAATAACCTGGCAGACGTGCA 1331 Query 1390 CAACCTTTATGTGGGGGGACCTC-CCTTAGAGAAGGAGCCTCGGGAGCTGTTCGTCAAAG 1448 | ||| || |||||||| |||| || | ||||||||||| || |||||||| ||||| | Sbjct 1332 CGGCCTCTACGTGGGGGGGCCTCGCC-TGGAGAAGGAGCCCCGCGAGCTGTTTGTCAAGG 1390 Query 1449 GCAGCATGAGGGATATCCGAGAGAACTTCCAGGATCTGATGCAGTACTGCGCCC-GTGAT 1507 ||| ||||| ||| ||||| |||||||||||||| |||||||||||||| |||| | || Sbjct 1391 GCAACATGAAGGACATCCGTGAGAACTTCCAGGACCTGATGCAGTACTGTGCCCAG-GAC 1449 Query 1508 GTGTGGGCCACCTTTGAGGTTTTCCAGCAGCAGCTGCCACTCTTCTTGGAGAGGTGTCCC 1567 | ||||||||||| ||||||||||||||||||||| ||||||||| |||||||||||||| Sbjct 1450 GCGTGGGCCACCTATGAGGTTTTCCAGCAGCAGCTTCCACTCTTCCTGGAGAGGTGTCCC 1509 Query 1568 CACCCAGTGACTCTGGCTGGCATGCTGGAGATGGGTGTGTCCTACCTGCCTGTCAACCAG 1627 ||||| |||||||||||||||||| ||||||||||||| ||||||||||| ||||||||| Sbjct 1510 CACCCGGTGACTCTGGCTGGCATGTTGGAGATGGGTGTCTCCTACCTGCCCGTCAACCAG 1569 Query 1628 AACTGGGAGCGTTACCTGACAGAGGCACAGAACACATATGAGGAGCTCCAGCGGGAGATG 1687 |||||||||||||||||| | ||||| ||| ||| || ||||||||||||||||||||| Sbjct 1570 AACTGGGAGCGTTACCTGGCGGAGGCCCAGGGCACCTACGAGGAGCTCCAGCGGGAGATG 1629 Query 1688 AAGAAGTCGCTGATGGATCTGGCTAATGATGCCTGTCAGTTGCTCTCAGGAGAGAGGTAC 1747 ||||||||||||||||| ||||| || || ||||| ||||||||||| |||||||||||| Sbjct 1630 AAGAAGTCGCTGATGGACCTGGCCAACGACGCCTGCCAGTTGCTCTCGGGAGAGAGGTAC 1689 Query 1748 AAAGAAGACCCTTGGCTCTGGGACCTAGAATGGGATTTGCAGGAGTTTAAGCAGAAAAAG 1807 ||||| ||||| |||||||||||||| || ||||| |||||||||| |||||||| ||| Sbjct 1690 AAAGAGGACCCCTGGCTCTGGGACCTGGAGTGGGACGTGCAGGAGTTCAAGCAGAAGAAG 1749 Query 1808 GCAAAG-AAGGTGAAGA--AGCCAG-C--CT-CAGCCAGCAAGTTGCCCATCGAGGGAGC 1860 || ||| |||| ||||| || || | || |||||||||||||||| ||||||| || Sbjct 1750 GCGAAGAAAGG-GAAGAGGAGGGAGCCGGCTGCAGCCAGCAAGTTGCCTGTCGAGGGGGC 1808 Query 1861 TG-GGCCCTTTGGGGATCCCATGGATCAGGAAGATCCTGGCCCGCCCAGCGAGGAGGAGG 1919 || |||| |||||| |||| |||||||||||| || ||||| ||||| |||||||||| Sbjct 1809 TGACGCCC-CTGGGGACCCCAGGGATCAGGAAGACCCCGGCCCCCCCAGTGAGGAGGAGG 1867 Query 1920 AGCTT-CAGCGAAG-TGTAACAGCCCACAACC-GGTTACAGCAGCTGAGGAGCACCACGG 1976 || || ||||| || || ||||||| | ||| | || ||||||||||| | ||||| | Sbjct 1868 AG-TTCCAGCG-AGATGCCACAGCCCGC-ACCTGCTTGGAGCAGCTGAGGGGGACCACAG 1924 Query 1977 ACCTCCTGCCTAAGCGACCCCAGCACCTTCCAGGACACCCTGGGTGGTACCGGAAGCTCT 2036 | |||||||| ||||| |||||||||||||| |||||||| |||||||| |||||||| | Sbjct 1925 AGCTCCTGCCCAAGCGGCCCCAGCACCTTCCTGGACACCCAGGGTGGTATCGGAAGCTGT 1984 Query 2037 G-CCCTCGACTAGATGACCCTGCCTGGGCTCCC-GGCCCCAGCCTCCTCAGCCTGCAAAT 2094 | ||| || || |||||||||| ||| | ||| |||||||| ||||||||||| || || Sbjct 1985 GTCCC-CGGCTCGATGACCCTGAGTGGAC-CCCTGGCCCCAGTCTCCTCAGCCTCCAGAT 2042 Query 2095 GCGGGTCACTCCTAAGCTCATGGCACTGACCTGGGATGGTTTTCCTCTACACTACTCAGA 2154 ||||||||| |||||||||||||| ||||||||||| || || ||||| |||||||| || Sbjct 2043 GCGGGTCACACCTAAGCTCATGGCGCTGACCTGGGACGGCTTCCCTCTGCACTACTCGGA 2102 Query 2155 CTC-TCATGGTTGGGGCTACCTAGTGCCTGGGCGTCGGGATAATCTGAC-CGAGCCGCCA 2212 | ||||| ||||||||||| ||||| ||||| ||||| || ||| | | || | | Sbjct 2103 -GCAGCATGGCTGGGGCTACCTGGTGCCCGGGCGGCGGGACAACCTGGCTC-AGGTGTCG 2160 Query 2213 G-TGAGCCCCACTGTAGA-ATCCGCTGCAGTAACCTGCCCCTACAGAGCCATCGAGTCCT 2270 | | || ||| | || |||| | |||||||| ||| ||||||||||||| Sbjct 2161 GCCG-GCAGTACT-CCCACGTCGGCTGGGGCGGCCTGCCCCCACACAGCCATCGAGTCCC 2218 Query 2271 TATACAGGAAGCACTGCCTTGAACAGGGGAAGCAGCAATTGGAGC-CCCAGGAGGTAGAC 2329 | |||||||||||||| |||||||||||||||||||| |||||| ||| ||| |||| Sbjct 2219 TGTACAGGAAGCACTGTCTTGAACAGGGGAAGCAGCAGCTGGAGCTGCCA-CAGGCAGAC 2277 Query 2330 CTGGCTGAGGAGTTCTTACTCACTGACAGTAGTGCCATGTGGCAAACGGTAGAAGAACTG 2389 || | ||||||||| | || | ||||| ||||||||||||| ||||| |||||| || Sbjct 2278 CTTTCCGAGGAGTTCCTGCTGTCCGACAGCGGTGCCATGTGGCAGACGGTGGAAGAATTG 2337 Query 2390 GGCTGCTTAGACGTAGAGGCTGAGGCCAAGATGGAGAA-TT-C-AG-GGC--T--GA-GC 2440 |||||||| || || ||||| ||||| ||||||||||| || | || ||| | | | Sbjct 2338 GGCTGCTTGGAAGTGGAGGCCGAGGCAAAGATGGAGAACTTGCAAGAGGCAGTCCCAGGT 2397 Query 2441 CAACCTCTAGTTCTGCCTGCTGCTTGTGCCCCCAAATCCAGCCAGCCCA-CGTATCACCA 2499 ||||| |||| || | |||||||| ||| ||||||| |||||||| ||| | |||||||| Sbjct 2398 CAACCGCTAGCTCCGACTGCTGCTGGTGGCCCCAAAGCCAGCCAG-CCAGCTTATCACCA 2456 Query 2500 TGGCAACGGACCTTATAATGATGTGAATATCCCTGGTTGCTGGTTTTTCAAGCTGCCTCA 2559 |||||||||||| || || || ||| |||||||||| |||||||| |||||||||||||| Sbjct 2457 TGGCAACGGACCCTACAACGACGTGGATATCCCTGGCTGCTGGTTCTTCAAGCTGCCTCA 2516 Query 2560 CAAGGACGGTAACAACTACAATGTGGGCAGTCCCTTTGCCAAAGATTTCCTGCCCAAGAT 2619 |||||| || |||| || |||||||||||| ||||| |||||||| |||||||||||||| Sbjct 2517 CAAGGATGGCAACAGCTGCAATGTGGGCAGCCCCTTCGCCAAAGACTTCCTGCCCAAGAT 2576 Query 2620 GGAGGATGGCACCCTGCAGGCTGGCCCAGGAGGTGCCAGTGGGCCTCGTGCCCTGGAAAT 2679 |||||| |||| ||||||||||||||||||||| ||||| ||||| || ||| ||||||| Sbjct 2577 GGAGGACGGCAGCCTGCAGGCTGGCCCAGGAGGCGCCAGCGGGCCCCGGGCCTTGGAAAT 2636 Query 2680 AAATAAAATGATTTCTTTTTGGAGGAATGCTCATAAACGTATCAGTTCCCAGATGGTGGT 2739 ||||| ||||| || ||||||||||| || ||||| |||||||| |||||||||||||| Sbjct 2637 CAATAAGATGATCTCATTTTGGAGGAACGCCCATAAGCGTATCAGCTCCCAGATGGTGGT 2696 Query 2740 ATGGCT-CCCCAGGTCAGCTCTGCCCCGGGTTGTGACCAGGCACCCCAGCTTCGATGAGG 2798 ||||| |||| |||| || |||||||||| ||||||||||| ||| || |||||||| Sbjct 2697 GTGGCTGCCCC-GGTCTGCGCTGCCCCGGGCCGTGACCAGGCATGCCAACTACGATGAGG 2755 Query 2799 AAGGCCACTATGGGGCCATCCTACCCCAGGTGGTGACTGCTGGCACCATCACCCGTCGAG 2858 |||||| ||| ||||||||||| |||||||||||||| |||||||||||||| || || | Sbjct 2756 AAGGCCGCTACGGGGCCATCCTGCCCCAGGTGGTGACGGCTGGCACCATCACTCGACGGG 2815 Query 2859 CTGTGGAGCCCACGTGGCTCACTGCCAGTAATGCTCGGCCTGACCGGGTAGGCAGTGAGT 2918 ||||||||||||| |||||||||||||| ||||| ||||||||||| ||||||||||||| Sbjct 2816 CTGTGGAGCCCACATGGCTCACTGCCAGCAATGCCCGGCCTGACCGCGTAGGCAGTGAGT 2875 Query 2919 TGAAAGCCATGGTGCAGGCTCCACCTGGCTATGTCCTTGTGGGTGCTGATGTGGACTCAC 2978 |||| |||||||| ||||| || |||||||| ||||| |||||||| || |||||||| | Sbjct 2876 TGAAGGCCATGGTCCAGGCCCCGCCTGGCTACGTCCTCGTGGGTGCCGACGTGGACTCCC 2935 Query 2979 AGGAACTGTGGATCGCAGCTGTACTTGGAGATGCTCACTTTGCTGGGATGCATGGCTGCA 3038 |||| ||||||||||||||||| || |||||||| |||||||| || ||||||||||||| Sbjct 2936 AGGAGCTGTGGATCGCAGCTGTGCTGGGAGATGCCCACTTTGCCGGCATGCATGGCTGCA 2995 Query 3039 CGGCCTTTGGCTGGATGACTCTGCAGGGCAGGAAGAGCAGAGGCACTGATCTGCACAGCA 3098 | ||||| ||||||||||| |||||||||||||||||||| ||||||||||||||||||| Sbjct 2996 CAGCCTTCGGCTGGATGACCCTGCAGGGCAGGAAGAGCAGGGGCACTGATCTGCACAGCA 3055 Query 3099 AGACAGCTGCCACTGTGGGCATCAGCCGAGAGCATGCCAAAATCTTCAACTATGGCCGCA 3158 ||||||| ||||| |||||||||||||| ||||||||||| ||| ||||||| ||||||| Sbjct 3056 AGACAGCAGCCACCGTGGGCATCAGCCGTGAGCATGCCAAGATCATCAACTACGGCCGCA 3115 Query 3159 TCTATGGGGCTGGGCAGTCCTTTGCTGAGCGCCTACTGATGCAGTTCAACCACAGGCTCA 3218 |||||||||| |||||| |||| || |||||||| || ||||||||||||||| | |||| Sbjct 3116 TCTATGGGGCCGGGCAGCCCTTCGCCGAGCGCCTGCTCATGCAGTTCAACCACCGACTCA 3175 Query 3219 CAAGGCAGGAGGCAGCTGAGAAGGCCCAGCAGATGTATGCAGTCACAAAAGGCCTGCGCC 3278 | ||||||||||||||||||||||||||||||||||||| ||||| || ||||| |||| Sbjct 3176 CGCGGCAGGAGGCAGCTGAGAAGGCCCAGCAGATGTATGCGGTCACCAAGGGCCTCCGCC 3235 Query 3279 GGTATCGGCTGTCTGCGGATGGTGAGTGGCTGGTGAAACAGTTGAATCTTCCTGTGGACA 3338 |||| ||| |||| | || || |||||||||||||| ||||| | || |||||||| | Sbjct 3236 GGTACCGGTTGTCAGATGAGGGCGAGTGGCTGGTGAAGGAGTTGGACCTCCCTGTGGAGA 3295 Query 3339 GGACAGAGGACGGCTGGGTCTCCCTACAAG-ATCTTCG-AATGATCC-GAAGAGAAGCTT 3395 |||| |||||||||||||| ||||| ||| |||| || || ||||| || ||||||||| Sbjct 3296 GGACCGAGGACGGCTGGGTTTCCCTG-AAGGATCTGCGCAA-GATCCAGA-GAGAAGCTT 3352 Query 3396 CAAGGAAGTCACGATGGAAGAAGTGGGAGGTAGCCT-CTGAACGAGCATGGACAGGGGGC 3454 ||| ||| || |||||||||||||||||||| | | || | ||||| |||| |||||| Sbjct 3353 CAAAGAAATCGCGATGGAAGAAGTGGGAGGTGGT-TGCTCAGCGAGCCTGGATGGGGGGC 3411 Query 3455 ACAGAGTCAGAAATGTTTAATAAGCTGGAGAGTATTGCCATGTCTGATACACCACGTACC 3514 ||||||||||||||||| || ||||||||||| ||||||| ||||| | ||| |||||| Sbjct 3412 ACAGAGTCAGAAATGTTCAACAAGCTGGAGAGCATTGCCACATCTGACATACCGCGTACC 3471 Query 3515 CCAGTACTGGGCTGCTGCATCAGCAGAGCCTTGGAGCCCTCAGTTGTCCA-GGGAGAGTT 3573 || || |||||||| |||||||| | ||| |||| |||| | ||||| ||| ||||| Sbjct 3472 CCGGTGTTGGGCTGCCGCATCAGCCGGGCCCTGGAACCCTGTGCTGTCCGCGGG-GAGTT 3530 Query 3574 TATAACCAGTCGTGTGAACTGGGTGGTACAGAGCTCTGCTGTAGACTACTTACATCTCAT 3633 ||| ||||| || |||||||||||||| |||||||| || || |||||| | || ||||| Sbjct 3531 TATGACCAGCCGAGTGAACTGGGTGGTGCAGAGCTCCGCGGTGGACTACCTGCACCTCAT 3590 Query 3634 GCTTGTGGCCATGAAGTGGCTGTTTGAGGAATTTGCCATTGATGGGCGCTTCTGCATCAG 3693 |||||||||||||||||||||||| ||||| ||||||||||| ||||||||||||||||| Sbjct 3591 GCTTGTGGCCATGAAGTGGCTGTTCGAGGAGTTTGCCATTGACGGGCGCTTCTGCATCAG 3650 Query 3694 CATCCACGACGAGGTTCGCTACCTGGTGCGTGAGGAGGACCGCTACCGTGCCGCCCTGGC 3753 ||||||||| |||||||||||||||||||| ||||||||||| ||||| || ||||| || Sbjct 3651 CATCCACGATGAGGTTCGCTACCTGGTGCGGGAGGAGGACCGATACCGCGCGGCCCTCGC 3710 Query 3754 ACTGCAGATCACCAATCTCCTGACCAGGTGCATGTTTGCCTATAAGCTGGGTCTGAATGA 3813 ||||| |||||||| |||||||||||||||||||||||| | ||||||||||||||||| Sbjct 3711 CCTGCAAATCACCAACCTCCTGACCAGGTGCATGTTTGCCCACAAGCTGGGTCTGAATGA 3770 Query 3814 TCTGCCCCAGTCAGTCGCCTTTTTCAGTGCAGTAGACATTGACCAGTGCCTCAGGAAGGA 3873 |||||||||||||| || |||||||| || | || ||||||||||||||||||||||| Sbjct 3771 CCTGCCCCAGTCAGTGGCGTTTTTCAGCACAATCGATATTGACCAGTGCCTCAGGAAGGA 3830 Query 3874 AGTGACCATGGACTGTAAAACTCCTTCTAACCCAACTGGGATGGAAAGGAGATATGGGAT 3933 ||||||||||||||||||||| ||||||||||||||||||||||||||| |||| ||||| Sbjct 3831 AGTGACCATGGACTGTAAAACCCCTTCTAACCCAACTGGGATGGAAAGGCGATACGGGAT 3890 Query 3934 CCCCCAGGGTGAAGCACTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCTTGGA 3993 |||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| Sbjct 3891 TCCCCAGGGTGAAGCGCTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCCTGGA 3950 Query 3994 AAAACGAAGCCAGCCTGGAC 4013 ||| ||||||||||||||| Sbjct 3951 GAAATGAAGCCAGCCTGGAC 3970 >dbj|AK162462.1| UniGene infoGene info Mus musculus 12 days embryo embryonic body between diaphragm region and neck cDNA, RIKEN full-length enriched library, clone:9430069H22 product:polymerase (DNA directed), gamma, full insert sequence Length=2166 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 2200 bits (1191), Expect = 0.0 Identities = 1193/1194 (99%), Gaps = 0/1194 (0%) Strand=Plus/Plus Query 3403 GTCACGATGGAAGAAGTGGGAGGTAGCCTCTGAACGAGCATGGACAGGGGGCACAGAGTC 3462 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 972 GTCACGATGGAAGAAGTGGGAGGTAGCCTCTGAACGAGCATGGACAGGGGGCACAGAGTC 1031 Query 3463 AGAAATGTTTAATAAGCTGGAGAGTATTGCCATGTCTGATACACCACGTACCCCAGTACT 3522 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1032 AGAAATGTTTAATAAGCTGGAGAGTATTGCCATGTCTGATACACCACGTACCCCAGTACT 1091 Query 3523 GGGCTGCTGCATCAGCAGAGCCTTGGAGCCCTCAGTTGTCCAGGGAGAGTTTATAACCAG 3582 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1092 GGGCTGCTGCATCAGCAGAGCCTTGGAGCCCTCAGTTGTCCAGGGAGAGTTTATAACCAG 1151 Query 3583 TCGTGTGAACTGGGTGGTACAGAGCTCTGCTGTAGACTACTTACATCTCATGCTTGTGGC 3642 ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| Sbjct 1152 TCGTGTGAACTGGGTGGTACAGAGCTCTGCTGTAGCCTACTTACATCTCATGCTTGTGGC 1211 Query 3643 CATGAAGTGGCTGTTTGAGGAATTTGCCATTGATGGGCGCTTCTGCATCAGCATCCACGA 3702 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1212 CATGAAGTGGCTGTTTGAGGAATTTGCCATTGATGGGCGCTTCTGCATCAGCATCCACGA 1271 Query 3703 CGAGGTTCGCTACCTGGTGCGTGAGGAGGACCGCTACCGTGCCGCCCTGGCACTGCAGAT 3762 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1272 CGAGGTTCGCTACCTGGTGCGTGAGGAGGACCGCTACCGTGCCGCCCTGGCACTGCAGAT 1331 Query 3763 CACCAATCTCCTGACCAGGTGCATGTTTGCCTATAAGCTGGGTCTGAATGATCTGCCCCA 3822 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1332 CACCAATCTCCTGACCAGGTGCATGTTTGCCTATAAGCTGGGTCTGAATGATCTGCCCCA 1391 Query 3823 GTCAGTCGCCTTTTTCAGTGCAGTAGACATTGACCAGTGCCTCAGGAAGGAAGTGACCAT 3882 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1392 GTCAGTCGCCTTTTTCAGTGCAGTAGACATTGACCAGTGCCTCAGGAAGGAAGTGACCAT 1451 Query 3883 GGACTGTAAAACTCCTTCTAACCCAACTGGGATGGAAAGGAGATATGGGATCCCCCAGGG 3942 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1452 GGACTGTAAAACTCCTTCTAACCCAACTGGGATGGAAAGGAGATATGGGATCCCCCAGGG 1511 Query 3943 TGAAGCACTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACGAAG 4002 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1512 TGAAGCACTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACGAAG 1571 Query 4003 CCAGCCTGGACCCTAGCTCTGTCTGGAGGTTCTGTATTTGCTCCTGTGGAGCTTTATTGG 4062 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1572 CCAGCCTGGACCCTAGCTCTGTCTGGAGGTTCTGTATTTGCTCCTGTGGAGCTTTATTGG 1631 Query 4063 AGCGGTGCAGGTTCCTAAACTCAGGCTTTCAGATGTGCTTTTTTGCAAAAGGCAGCCATT 4122 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1632 AGCGGTGCAGGTTCCTAAACTCAGGCTTTCAGATGTGCTTTTTTGCAAAAGGCAGCCATT 1691 Query 4123 TTTCTGTAGCAGGACCTGCCCAGGAAAGTCCTCCTAACGGAAGGCACAATTCAGTGCGTT 4182 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1692 TTTCTGTAGCAGGACCTGCCCAGGAAAGTCCTCCTAACGGAAGGCACAATTCAGTGCGTT 1751 Query 4183 CAGAACCAGGACACCAACATCAGTGCAGGCTGTGTGACAAGGGGTACTGTTGGGCACAAA 4242 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1752 CAGAACCAGGACACCAACATCAGTGCAGGCTGTGTGACAAGGGGTACTGTTGGGCACAAA 1811 Query 4243 TGAAGCAGATGCCCCAAAGGTCACATTAACTCAGGCATTTCTTCCTCCTCTTCTTGGCTG 4302 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1812 TGAAGCAGATGCCCCAAAGGTCACATTAACTCAGGCATTTCTTCCTCCTCTTCTTGGCTG 1871 Query 4303 GTTCTCTGTCCTGCTGTGTATGTGCTGATGCAGTGCCCTAGAAGGGGAGAGTAGAAATTT 4362 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1872 GTTCTCTGTCCTGCTGTGTATGTGCTGATGCAGTGCCCTAGAAGGGGAGAGTAGAAATTT 1931 Query 4363 TGACAACCTTGTTCTAAGGTGATGGGAATAAAAACAAACACCAAACTCCTGGAACAGTTG 4422 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1932 TGACAACCTTGTTCTAAGGTGATGGGAATAAAAACAAACACCAAACTCCTGGAACAGTTG 1991 Query 4423 TGCTTTCCCGTCTGCTGCCCAGGTTGTGACTTAGAACTCCGTCCTGAGTAGATGGACGAG 4482 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1992 TGCTTTCCCGTCTGCTGCCCAGGTTGTGACTTAGAACTCCGTCCTGAGTAGATGGACGAG 2051 Query 4483 ATGCTGGGAGCCCGGAGCATCACAGCTACAGACGGCCTGGGGCACAGTGATGTACGGAAC 4542 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2052 ATGCTGGGAGCCCGGAGCATCACAGCTACAGACGGCCTGGGGCACAGTGATGTACGGAAC 2111 Query 4543 TCCGCATCAGCCGGCTAGCCAGATTATTTTATATAAATGTCTAATTTTGACTGG 4596 |||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2112 TCCGCATCAGCCGGCTAGCCAGATTATTTTATATAAATGTCTAATTTTGACTGG 2165 Score = 1249 bits (676), Expect = 0.0 Identities = 681/683 (99%), Gaps = 1/683 (0%) Strand=Plus/Plus Query 2722 CAGTTCCCAGATGGTGGTATGGCTCCCCAGGTCAGCTCTGCCCCGGGTTGTGACCAGGCA 2781 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 214 CAGTTCCCAGATGGTGGTATGGCTCCCCAGGTCAGCTCTGCCCCGGGTTGTGACCAGGCA 273 Query 2782 CCCCAGCTTCGATGAGGAAGGCCACTATGGGGCCATCCTACCCCAGGTGGTGACTGCTGG 2841 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 274 CCCCAGCTTCGATGAGGAAGGCCACTATGGGGCCATCCTACCCCAGGTGGTGACTGCTGG 333 Query 2842 CACCATCACCCGTCGAGCTGTGGAGCCCACGTGGCTCACTGCCAGTAATGCTCGGCCTGA 2901 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 334 CACCATCACCCGTCGAGCTGTGGAGCCCACGTGGCTCACTGCCAGTAATGCTCGGCCTGA 393 Query 2902 CCGGGTAGGCAGTGAGTTGAAAGCCATGGTGCAGGCTCCACCTGGCTATGTCCTTGTGGG 2961 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 394 CCGGGTAGGCAGTGAGTTGAAAGCCATGGTGCAGGCTCCACCTGGCTATGTCCTTGTGGG 453 Query 2962 TGCTGATGTGGACTCACAGGAACTGTGGATCGCAGCTGTACTTGGAGATGCTCACTTTGC 3021 ||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||| Sbjct 454 TGCTGAT-TGGACTCACAGGAACCGTGGATCGCAGCTGTACTTGGAGATGCTCACTTTGC 512 Query 3022 TGGGATGCATGGCTGCACGGCCTTTGGCTGGATGACTCTGCAGGGCAGGAAGAGCAGAGG 3081 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 513 TGGGATGCATGGCTGCACGGCCTTTGGCTGGATGACTCTGCAGGGCAGGAAGAGCAGAGG 572 Query 3082 CACTGATCTGCACAGCAAGACAGCTGCCACTGTGGGCATCAGCCGAGAGCATGCCAAAAT 3141 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 573 CACTGATCTGCACAGCAAGACAGCTGCCACTGTGGGCATCAGCCGAGAGCATGCCAAAAT 632 Query 3142 CTTCAACTATGGCCGCATCTATGGGGCTGGGCAGTCCTTTGCTGAGCGCCTACTGATGCA 3201 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 633 CTTCAACTATGGCCGCATCTATGGGGCTGGGCAGTCCTTTGCTGAGCGCCTACTGATGCA 692 Query 3202 GTTCAACCACAGGCTCACAAGGCAGGAGGCAGCTGAGAAGGCCCAGCAGATGTATGCAGT 3261 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 693 GTTCAACCACAGGCTCACAAGGCAGGAGGCAGCTGAGAAGGCCCAGCAGATGTATGCAGT 752 Query 3262 CACAAAAGGCCTGCGCCGGTATCGGCTGTCTGCGGATGGTGAGTGGCTGGTGAAACAGTT 3321 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 753 CACAAAAGGCCTGCGCCGGTATCGGCTGTCTGCGGATGGTGAGTGGCTGGTGAAACAGTT 812 Query 3322 GAATCTTCCTGTGGACAGGACAGAGGACGGCTGGGTCTCCCTACAAGATCTTCGAATGAT 3381 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 813 GAATCTTCCTGTGGACAGGACAGAGGACGGCTGGGTCTCCCTACAAGATCTTCGAATGAT 872 Query 3382 CCGAAGAGAAGCTTCAAGGAAGT 3404 ||||||||||||||||||||||| Sbjct 873 CCGAAGAGAAGCTTCAAGGAAGT 895 >ref|XM_545850.2| UniGene infoGene info PREDICTED: Canis familiaris similar to DNA polymerase gamma subunit 1 (Mitochondrial DNA polymerase catalytic subunit) (PolG-alpha) (LOC488732), mRNA Length=4432 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 2002 bits (1084), Expect = 0.0 Identities = 1645/1911 (86%), Gaps = 57/1911 (2%) Strand=Plus/Plus Query 512 GGGCAGCTGCGGCTCAA-CCCTCTGCTCATCCAGATGTTGTCGAGAGGCCTGCACGAGCA 570 ||||||||||||| ||| |||| ||| |||||||||| | |||||||| || |||||||| Sbjct 476 GGGCAGCTGCGGCACAACCCCT-TGCACATCCAGATGCTCTCGAGAGGGCTTCACGAGCA 534 Query 571 GATCTTCGGGTGCGGCGGGGAAATGCCCGACGAGGCCGCGGTGCAG-CGCAGCGTAGAGC 629 ||||||||| |||||||||| | ||||| ||||||||| |||| | |||||| | |||| Sbjct 535 AATCTTCGGGAGCGGCGGGGAGACGCCCGGCGAGGCCGCCGTGC-GCCGCAGCATCGAGC 593 Query 630 ACCTGCAGAAGCACGGGCTCTGGGGGCAGCCGGCCACGCCCTTGCCAGACGTGGAGCTGC 689 ||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct 594 ACCTGCAGAGGCACGGGCTCTGGGGGCAGCCGGCCACGCCCTTGCCGGACGTGGAGCTGC 653 Query 690 GCCTGCC-CCGGCTCTTCGGGGGCAACCTGGACCAGCACTTCCGCCTCCTGGCCCAGAAG 748 ||||||| || |||| |||||||| |||||||||||||||||||||||||||||||||| Sbjct 654 GCCTGCCGCCC-CTCTACGGGGGCAGCCTGGACCAGCACTTCCGCCTCCTGGCCCAGAAG 712 Query 749 CAGAGCCTGCCTTACTTGGAGGCGGCCGCCTCGTTATTG-GAGGCCCAATTGCCCCC-CG 806 ||||||||||| ||| ||||||||||| |||||||||| | |||||| |||||| || Sbjct 713 CAGAGCCTGCCCTACCTGGAGGCGGCCAACTCGTTATTGCG-GGCCCAGCCGCCCCCGCG 771 Query 807 AGCCCAAGAGCTGGGCCTGGGCGGAGGGCTGGACCCGGTACGGCCCCGAGGGGGAGGCCG 866 |||| |||||||||||||| |||||||||||||||||||||||||| ||||||||||| Sbjct 772 -GCCCCTGAGCTGGGCCTGGGTGGAGGGCTGGACCCGGTACGGCCCCGCGGGGGAGGCCG 830 Query 867 AACCCGTGGCCATCCCCGAGGAGCGGGCCCTGGTGTTCGACGTGGAGGTCTGCTTGGCAG 926 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 831 TACCCGTGGCCATCCCCGAGGAGCGGGCCCTGGTGTTCGACGTGGAGGTCTGCTTGGCAG 890 Query 927 AGGGAACCTGCCCCACTTTGGCGGTGGCCATATCCCCCTCGGCCTGGTATTCCTGGTGCA 986 ||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||| Sbjct 891 AGGGAACTTGCCCCACATTGGCGGTGGCCATATCCCCCTCGGCCTGGTATTCCTGGTGCA 950 Query 987 GCCGGCGGCTGGTGGAAGAGCGTTACTCTTGGACCAGCCAGCTATCGCCGGCTGACCTAA 1046 ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| | Sbjct 951 GCCGGCGGCTGGTGGAAGAGCGTTACTCTTGGACCAGCCAGCTGTCGCCGGCTGACCTCA 1010 Query 1047 TCCCTTTGGGGGGCTCCA-CTAGTGCCAG-CAGCTCCACCAAGCAG-GATGGGCAGGAAC 1103 | ||| ||| || | || | || || || | || ||||| ||| | ||| ||||||| | Sbjct 1011 TTCCTCTGGAGGTC-CCTGCCAGCGC-AGGCGGCCCCACCCAGC-GTGATTGGCAGGAGC 1067 Query 1104 AGTTAGTGGTGGGGCACAATGTTTCCTTTGACCGAGCCCATATCAGGGAACAGTATCTGA 1163 ||||||| ||||||||||| |||| |||||| ||||||||||||||||| ||||| |||| Sbjct 1068 AGTTAGTTGTGGGGCACAACGTTTGCTTTGATCGAGCCCATATCAGGGAGCAGTACCTGA 1127 Query 1164 TTCAGGACTCCCGGATGCGTTTTCTCGATACTATGAGCATGCACATGGCCATCTCGGGGC 1223 | |||| |||||| ||||| || || || || ||||||||||||||||||||||| |||| Sbjct 1128 TCCAGGGCTCCCGCATGCGCTTCCTGGACACCATGAGCATGCACATGGCCATCTCAGGGC 1187 Query 1224 TGAGCAGCTTCCAGCGCAGCCTGTGGATGGGAGCCAAGCAGGGAAAGCACAAGACCCAGC 1283 | ||| ||||||||||||| |||||||||| |||||||||||| |||| |||| ||| || Sbjct 1188 TCAGCGGCTTCCAGCGCAGTCTGTGGATGGCAGCCAAGCAGGGCAAGCGCAAGGCCC-GC 1246 Query 1284 -AGTCCACAAAGCGAGGGCAGAAGTCCCCGAGGAAAGCCAATGGTCCAGCGATCTCATCT 1342 | ||||| ||||||| |||||||||| | ||||||| ||| || | |||||| || Sbjct 1247 CACCCCACACAGCGAGGCCAGAAGTCCCAAAACAAAGCCAGTGGCCCGGTGATCTCCTCC 1306 Query 1343 TGGGACTGGATGGATATCAGCAGTGCCAATAATCTTGCAGATGTGCACAACCTTTATGTG 1402 ||||||||| ||||||||||||||| ||||||||| ||||||||||||| ||| |||||| Sbjct 1307 TGGGACTGGCTGGATATCAGCAGTGTCAATAATCTGGCAGATGTGCACAGCCTCTATGTG 1366 Query 1403 GGGGGACCTCCCTTAGAGAAGGAGCCTCGGGAGCTGTTCGTCAAAGGCAGCATGAGGGAT 1462 ||||| ||||||||||||||||||||||| || ||||||||||| || ||||||| ||| Sbjct 1367 GGGGGGCCTCCCTTAGAGAAGGAGCCTCGAGAACTGTTCGTCAAGGGTAGCATGAAGGAC 1426 Query 1463 ATCCGAGAGAACTTCCAGGATCTGATGCAGTACTGCGCCC-GTGATGTGTGGGCCACCTT 1521 ||||| ||||||||||||| ||||||||||||||| |||| | || |||||||| |||| Sbjct 1427 ATCCGTGAGAACTTCCAGGCTCTGATGCAGTACTGTGCCCAG-GACGTGTGGGCTACCTA 1485 Query 1522 TGAGGTTTTCCAGCAGCAGCTGCCACTCTTCTTGGAGAGGTGTCCCCACCCAGTGACTCT 1581 |||| |||||||||||||||| || |||||||||||||||||||||||||| |||||||| Sbjct 1486 TGAGATTTTCCAGCAGCAGCTACCGCTCTTCTTGGAGAGGTGTCCCCACCCGGTGACTCT 1545 Query 1582 GGCTGGCATGCTGGAGATGGGTGTGTCCTACCTGCCTGTCAACCAGAACTGGGAGCGTTA 1641 |||||||||| |||||||||| || |||||||||||||||||||||||||||||||| || Sbjct 1546 GGCTGGCATGTTGGAGATGGGGGTCTCCTACCTGCCTGTCAACCAGAACTGGGAGCGGTA 1605 Query 1642 CCTGACAGAGGCACAGAACACATATGAGGAGCTCCAGCGGGAGATGAAGAAGTCGCTGAT 1701 |||| |||||||||||||||| |||||||| |||||| |||||||||||||||||||||| Sbjct 1606 CCTGGCAGAGGCACAGAACACCTATGAGGAACTCCAGTGGGAGATGAAGAAGTCGCTGAT 1665 Query 1702 GGATCTGGCTAATGATGCCTGTCAGTTGCTCTCAGGAGAGAGGTACAAAGAAGACCCTTG 1761 ||| ||||| ||||||||||| ||| |||||||||| ||||||||||| || ||||| || Sbjct 1666 GGACCTGGCCAATGATGCCTGCCAGCTGCTCTCAGGGGAGAGGTACAAGGAGGACCCCTG 1725 Query 1762 GCTCTGGGACCTAGAATGGGATTTGCAGGAGTTTAAGCAGAAAAAGGCAAAGAAGGTGAA 1821 ||||||||| || || ||||| |||| |||||||||||||| ||||||||||||||||| Sbjct 1726 GCTCTGGGATCTGGAGTGGGACCTGCAAGAGTTTAAGCAGAAGAAGGCAAAGAAGGTGAA 1785 Query 1822 GA--A-G---CCAGCCT-CAGCCAGCAAGTTGCCCATCGAGGGAGCTGGGCCCTTTGGGG 1874 || | | ||| | | ||||||||||||||||||||||| || || | | |||| Sbjct 1786 GAGGAAGGAGCCAAC-TGCAGCCAGCAAGTTGCCCATCGAG--AG--GG-C--T--GGGG 1835 Query 1875 ATCCCATGGATCAGGAAGATCCTGGCCCGCCCAGCGAGGAGGAGGAGCTTCAGCGA-AGT 1933 | |||| |||||||||||| |||||||| ||||| |||||||||||| |||||||| | | Sbjct 1836 ACCCCAAGGATCAGGAAGACCCTGGCCCTCCCAGTGAGGAGGAGGAGGTTCAGCGAGA-T 1894 Query 1934 GTAACAGCCCACAACCGG-TTACAGCAGCTGA-GGAGCACCACGGACCTCCTGCCTAAGC 1991 || || |||| | || | || |||| |||| || | || | || |||||| |||| Sbjct 1895 GTCACGGCCCGCG-CCTGCTTGGAGCACCTGAAGGGG-ACTGCAGAGAGCCTGCCAAAGC 1952 Query 1992 GACCCCAGCACCTTCCAGGACACCCTGGGTGGTACCGGAAGCTCTGCCCTCGACTAGATG 2051 | |||||||||||||| |||||||||||||||||||||||||||||||| || ||||||| Sbjct 1953 GGCCCCAGCACCTTCCCGGACACCCTGGGTGGTACCGGAAGCTCTGCCCCCGGCTAGATG 2012 Query 2052 ACCCTGCCTGGGCTCCCGG-CCCCAGCCTCCTCAGCCTGCAAATGCGGGTCACTCCTAAG 2110 ||||||| ||| | ||||| |||||| |||||||||||||| |||||||||||||| || Sbjct 2013 ACCCTGCATGGAC-CCCGGGCCCCAGTCTCCTCAGCCTGCAGATGCGGGTCACTCCAAAA 2071 Query 2111 CTCATGGC-ACTGACCTGGGATGGTTTTCCTCTACACTACTCAGA-CTCTCATGGTTGGG 2168 |||||||| | ||||||||||||| || ||||| |||||||| || | ||||| |||| Sbjct 2072 CTCATGGCGA-TGACCTGGGATGGCTTCCCTCTGCACTACTCGGAGCGG-CATGGCTGGG 2129 Query 2169 GCTACCTAGTGCCTGGGCGTCGGGATAATCTGAC-CGAGCCGCCAGTG-AG-CC-CCACT 2224 | ||||| ||||| ||||| ||||| || ||| | | || | |||| | | || || | Sbjct 2130 GATACCTGGTGCCCGGGCGGCGGGACAACCTGGCTC-AGGCACCAGCGGAAACCGCCCC- 2187 Query 2225 GTAGAATCCGCTGCAGTAACCTGCCCCTACAGAGCCATCGAGTCCTTATACAGGAAGCAC 2284 || || |||| || ||||||| |||||||||||||||||| | |||||||||||| Sbjct 2188 --AGCCTCAGCTGGGGTGGCCTGCCCGTACAGAGCCATCGAGTCCCTGTACAGGAAGCAC 2245 Query 2285 TGCCTTGAACAGGGGAAGCAGCAATTGGAGCCCCAGGAGGTAGACCTGGCTGAGGAGTTC 2344 || |||||||||||||||| ||| |||||||||| ||| || |||||| ||||||||| Sbjct 2246 TGTCTTGAACAGGGGAAGCGGCAGCCGGAGCCCCAGCAGGCAGGCCTGGCGGAGGAGTTC 2305 Query 2345 TTACTCACTGACAGTAGTGCCATGTGGCAAACGGTAGAAGAACTGGGCTGC 2395 | ||||| ||| | || ||| | ||||| ||||| ||||||||||||||| Sbjct 2306 CTGCTCACCGACGGCAGCGCCGTATGGCAGACGGTGGAAGAACTGGGCTGC 2356 Score = 1958 bits (1060), Expect = 0.0 Identities = 1651/1928 (85%), Gaps = 74/1928 (3%) Strand=Plus/Plus Query 2481 GCCAGCCCA-CGTATCACCATGGCAACGGACCTTATAATGATGTGAATATCCCTGGTTGC 2539 ||||| ||| | ||||||||||||||||||||||| || |||||| | |||||||| ||| Sbjct 2466 GCCAG-CCAGCCTATCACCATGGCAACGGACCTTACAACGATGTGGACATCCCTGGCTGC 2524 Query 2540 TGGTTTTTCAAGCTGCCTCACAAGGACGGTAACAACTACAATGTGGGCAGTCCCTTT-GC 2598 ||||| |||||||||||||||||||| |||| | || |||||||||||| |||||| || Sbjct 2525 TGGTTCTTCAAGCTGCCTCACAAGGATGGTAGCGGCTGCAATGTGGGCAG-CCCTTTCGC 2583 Query 2599 CAAAGATTTCCTGCCCAAGATGGAGGATGGCACCCTGCAGGCTGGCCCAGGAGGTGCCAG 2658 ||| || ||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct 2584 CAAGGACTTCCTGCCCAAGATGGAGGATGGCACCCTGCAGGCCGGCCCAGGAGGTGCCAG 2643 Query 2659 TGGGCCTCGTGCCCTGGAAATAAATAAAATGATTTCTTTTTGGAGGAATGCTCATAAACG 2718 |||||| |||||| | || || || |||||||||||||| |||||||| || |||||||| Sbjct 2644 TGGGCCCCGTGCCTTAGAGATCAACAAAATGATTTCTTTCTGGAGGAACGCCCATAAACG 2703 Query 2719 TATCAGTTCCCAGATGGTGGTATGGCTCCCCAGGTCAGCTCTGCCCCGGGTTGTGACCAG 2778 |||||||||||||||||||||||||| |||||||| ||||||||||| | ||||||||| Sbjct 2704 AATCAGTTCCCAGATGGTGGTATGGCTTCCCAGGTCGGCTCTGCCCCGTGCTGTGACCAG 2763 Query 2779 GCACCCCAG-CTTCGATGAGGAAGGCCACTATGGGGCCATCCTACCCCAGGTGGTGACTG 2837 |||||| || || ||| |||||||||| ||||||||||||| | || ||||||||||| | Sbjct 2764 GCACCC-AGACTACGACGAGGAAGGCCGCTATGGGGCCATCTTGCCGCAGGTGGTGACCG 2822 Query 2838 CTGGCACCATCACCCGTCGAGCTGTGGAGCCCACGTGGCTCACTGCCAGTAATGCTCGGC 2897 |||||||||||||||| || ||||||||||| ||||||||||| ||||| ||||| |||| Sbjct 2823 CTGGCACCATCACCCGCCGGGCTGTGGAGCCGACGTGGCTCACCGCCAGCAATGCCCGGC 2882 Query 2898 CTGACCGGGTAGGCAGTGAGTTGAAAGCCATGGTGCAGGCTCCACCTGGCTATGTCCTT- 2956 ||||||| |||||||| |||||||| |||||||||||||| ||||||||||||||| || Sbjct 2883 CTGACCGAGTAGGCAGCGAGTTGAAGGCCATGGTGCAGGCCCCACCTGGCTATGTC-TTC 2941 Query 2957 GTGGGTGCTGATGTGGACTCACAGGAACTGTGGATCGCAGCTGTACTTGGAGATGCTCAC 3016 ||||| || || |||||||| ||||| |||||||||||||| || || |||||||| ||| Sbjct 2942 GTGGGCGCCGACGTGGACTCGCAGGAGCTGTGGATCGCAGCCGTGCTGGGAGATGCCCAC 3001 Query 3017 TTTGCTGGGATGCATGGCTGCACGGCCTTTGGCTGGATGACTCTGCAGGGCAGGAAGAGC 3076 |||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||| Sbjct 3002 TTTGCTGGCATGCATGGCTGCACGGCCTTTGGCTGGATGACCCTGCAGGGCAGGAAGAGC 3061 Query 3077 AGAGGCACTGATCTGCACAGCAAGACAGCTGCCACTGTGGGCATCAGCCGAGAGCATGCC 3136 || ||||| ||||||||||| ||||||||||| || |||||||||||||| ||||| ||| Sbjct 3062 AGGGGCACCGATCTGCACAGTAAGACAGCTGCGACCGTGGGCATCAGCCGTGAGCACGCC 3121 Query 3137 AAAATCTTCAACTATGGCCGCATCTATGGGGCTGGGCAGTCCTTT-GCTGAGCGCCTACT 3195 || ||||||||||||||||||||||| ||||| |||||| || || ||||||||||| || Sbjct 3122 AAGATCTTCAACTATGGCCGCATCTACGGGGCGGGGCAG-CCATTCGCTGAGCGCCTGCT 3180 Query 3196 GATGCAGTTCAACCA-CAGGCTCACAAGGCAGGAGGCAGCTGAGAAGGCCCAGCAGATGT 3254 ||||||||||||||| | |||||||| |||||||||| |||||||||||||||||||||| Sbjct 3181 GATGCAGTTCAACCATC-GGCTCACACGGCAGGAGGCGGCTGAGAAGGCCCAGCAGATGT 3239 Query 3255 ATGCAGTCACAAAAGGCCTGCGCCGGTATCGGCTGTCTGCGGATGGTGAGTGGCTGGTGA 3314 | || ||||| || ||||| ||||||||||||||||| | ||| |||||||||||||||| Sbjct 3240 ACGCCGTCACCAAGGGCCTTCGCCGGTATCGGCTGTCGGAGGAGGGTGAGTGGCTGGTGA 3299 Query 3315 AACAGTTGAATCTTCCTGTGGACAGGACAGAGGACGGCTGGGTCTCCCTACAAGATCTTC 3374 | ||| | || || ||||||||||| || || |||||||| ||||| || ||||| | Sbjct 3300 GGGAATTGGACCTCCCCGTGGACAGGACTGAAGATGGCTGGGTTTCCCTGCAGGATCTGC 3359 Query 3375 G-AATGATCC-GAAGAGAAGCTTCAAGGAAGTCACGATGGAAGAAGTGGGAGGTAGCCT- 3431 | || ||||| || |||||||||| ||||||||||| ||||||||||||||||| || | Sbjct 3360 GCAA-GATCCAGA-GAGAAGCTTCGAGGAAGTCACGTTGGAAGAAGTGGGAGGTGGC-TG 3416 Query 3432 CTGAACGAGCATGGACAGGGGGCACAGAGTCAGAAATGTTTAATAAGCTGGAGAGTATTG 3491 | || ||||| |||| ||||||||||| ||||||||||| |||||||||||||| |||| Sbjct 3417 CCGAGCGAGCGTGGAGGGGGGGCACAGAATCAGAAATGTTCAATAAGCTGGAGAGCATTG 3476 Query 3492 CCATGTCTGATACACCACGTACCCCAGTACTGGGCTGCTGCATCAGCAGAGCCTTGGAGC 3551 |||||||||| || ||| ||||||| || ||||||||| |||||||| | ||| |||||| Sbjct 3477 CCATGTCTGACACCCCATGTACCCCGGTGCTGGGCTGCCGCATCAGCCGCGCCCTGGAGC 3536 Query 3552 CCTCAGTTGTCCAGGGAGAGTTTATAACCAGTCGTGTGAACTGGGTGGTACAGAGCTCTG 3611 |||| | |||| |||| |||||||| ||||| ||||||||||||||||| |||||||||| Sbjct 3537 CCTCGGCTGTCAAGGGGGAGTTTATGACCAGCCGTGTGAACTGGGTGGTGCAGAGCTCTG 3596 Query 3612 CTGTAGACTACTTACATCTCATGCTTGTGGCCATGAAGTGGCTGTTTGAGGAATTTGCCA 3671 | || ||||| ||||| |||||||| |||||||||||||||||||||||||||||||||| Sbjct 3597 CCGTGGACTATTTACACCTCATGCTCGTGGCCATGAAGTGGCTGTTTGAGGAATTTGCCA 3656 Query 3672 TTGATGGGCGCTTCTGCATCAGCATCCACGACGAGGTTCGCTACCTGGTGCGTGAGGAGG 3731 |||| |||||||||||||||||||||||||| ||||| |||||||||||||| ||||||| Sbjct 3657 TTGACGGGCGCTTCTGCATCAGCATCCACGATGAGGTCCGCTACCTGGTGCGAGAGGAGG 3716 Query 3732 ACCGCTACCGTGCCGCCCTGGCACTGCAGATCACCAATCTCCTGACCAGGTGCATGTTTG 3791 |||||||||| || |||||||| |||||||||||||| |||||||||||||||||||| | Sbjct 3717 ACCGCTACCGCGCAGCCCTGGCCCTGCAGATCACCAACCTCCTGACCAGGTGCATGTTCG 3776 Query 3792 CCTATAAGCTGGGTCTGAATGATCTGCCCCAGTCAGTCGCCTTTTTCAGTGCAGTAGACA 3851 |||| ||||||||||| ||||| || |||||||| |||||||||||||| |||| || | Sbjct 3777 CCTACAAGCTGGGTCTCAATGACCTACCCCAGTCCGTCGCCTTTTTCAGCACAGTCGATA 3836 Query 3852 TTGACCAGTGCCTCAGGAAGGAAGTGACCATGGACTGTAAAACTCCTTCTAACCCAACTG 3911 |||||||||||||||||||||||||||||||||| |||||||| ||||| |||||||||| Sbjct 3837 TTGACCAGTGCCTCAGGAAGGAAGTGACCATGGATTGTAAAACCCCTTCCAACCCAACTG 3896 Query 3912 GGATGGAAAGGAGATATGGGATCCCCCAGGGTGAAGCACTGGATATTTACCAGATAATTG 3971 |||||||||||||||| ||||| |||||||||||||| |||||||||||||||||||||| Sbjct 3897 GGATGGAAAGGAGATACGGGATTCCCCAGGGTGAAGCGCTGGATATTTACCAGATAATTG 3956 Query 3972 AACTCACCAAAGGCTCCTTGGAAAAACGAAGCCAGCCTGGACCCTAGCTCTGTCTGGAGG 4031 ||||||||||||||||||||||| | ||||||||||||||||||||||||| ||||||| Sbjct 3957 AACTCACCAAAGGCTCCTTGGAACAGTGAAGCCAGCCTGGACCCTAGCTCTGCCTGGAGG 4016 Query 4032 TTC--TGTATTTGCTCCTGTGGAGCTTTATTGG-AGCGGTGCAGGTTCCTAAACTCAGGC 4088 | | |||||||||||| ||||||||| || || | ||||| || ||| | || ||||| Sbjct 4017 TGCCCTGTATTTGCTCCCGTGGAGCTTCATCGGGA-CGGTGTGGGCTCCCACACCCAGGC 4075 Query 4089 TTT-CAGATGTGCTTTT----------TTGCAAAAGG-CAGCCATTTTTCTGTAGCAGGA 4136 ||| | | ||||||| | |||| ||| ||||| | | | ||||||||| Sbjct 4076 TTTGC-GCTGTGCTTGTGCAGAAGGGCTTGCGGGAGGTCAGCCCTCCT-CGGTAGCAGGA 4133 Query 4137 CCTGCCCAGGAAAG---T-CCTCCTAACGGAAGGCACAATTCAG-TGC-G--TTCAGAAC 4188 |||||| || || | | ||||| | | |||| || | || | | | |||||| | Sbjct 4134 CCTGCCTAG-AACGGACTGCCTCCGAGTG-AAGGTGCAGTGGAGCTCCTGGGTTCAGAGC 4191 Query 4189 CAGGACACCAACAT-CAG-TGCAGGCTGT-GTGACAAGGGG-TACTG-T--T-G--GGC- 4237 || || ||| | | | | |||||||||| | ||||||||| ||||| | | | || Sbjct 4192 CAAGATGCCA-C-TGCTGGTGCAGGCTGTAG-GACAAGGGGGTACTGCTGCTTGTTGGGT 4248 Query 4238 ACAAATGAA-GCAGATGCCCCAAAGGTCACATTAACTCAGGCATTTC-TTCCT-----CC 4290 | ||| ||| ||||| ||||||||| ||||||||||||||||||||| || || || Sbjct 4249 AAAAAAGAAAGCAGAAGCCCCAAAGTTCACATTAACTCAGGCATTTCATTTCTTTTTTCC 4308 Query 4291 T---CTTCTTGGCTGGTTCTCTGTCCTGCTGTGTATGTGCT--GATGCAGTGCCCTAGAA 4345 | |||||||||||||||| ||| ||| | | ||||| ||||||||||||||| Sbjct 4309 TTTTCTTCTTGGCTGGTTCTTTGTTCTG-TCCCTC-GTGCTCTGATGCAGTGCCCTAGCG 4366 Query 4346 GGGGAGAG 4353 |||||||| Sbjct 4367 GGGGAGAG 4374 >gb|AC110909.10| Download subject sequence spanning the HSP Mus musculus chromosome 7, clone RP24-186G5, complete sequence Length=161738 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 1428 bits (773), Expect = 0.0 Identities = 773/773 (100%), Gaps = 0/773 (0%) Strand=Plus/Plus Query 203 AGGACTTGTGTGAGGAAGGCAGGCATGGTGAGACCTATTTCACTGACAGGAGCACAGAGA 262 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 51878 AGGACTTGTGTGAGGAAGGCAGGCATGGTGAGACCTATTTCACTGACAGGAGCACAGAGA 51937 Query 263 GGGGACGCGTCTCTCTCTGAGTCTTTCGGCCACTAAAAGCAGTCAAGCTGGAGCCCAAAG 322 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 51938 GGGGACGCGTCTCTCTCTGAGTCTTTCGGCCACTAAAAGCAGTCAAGCTGGAGCCCAAAG 51997 Query 323 CCCGGTGCCCCGACTCACAGCGGGGGGCTCCCTGCACCAACCATGAGCCGCCTGCTCTGG 382 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 51998 CCCGGTGCCCCGACTCACAGCGGGGGGCTCCCTGCACCAACCATGAGCCGCCTGCTCTGG 52057 Query 383 AAGAAGGTGGCTGGCGCCAAGGTCGCCTCAGGGCCAGTACCAGCAACCGCGCGCTGGGTC 442 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 52058 AAGAAGGTGGCTGGCGCCAAGGTCGCCTCAGGGCCAGTACCAGCAACCGCGCGCTGGGTC 52117 Query 443 TCCAGCTCCGTCCTCGACCCCGTCCCCAGCGACGGGCGGCCGCCGTCGCAAATGCCCTCC 502 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 52118 TCCAGCTCCGTCCTCGACCCCGTCCCCAGCGACGGGCGGCCGCCGTCGCAAATGCCCTCC 52177 Query 503 TCCGAGAATGGGCAGCTGCGGCTCAACCCTCTGCTCATCCAGATGTTGTCGAGAGGCCTG 562 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 52178 TCCGAGAATGGGCAGCTGCGGCTCAACCCTCTGCTCATCCAGATGTTGTCGAGAGGCCTG 52237 Query 563 CACGAGCAGATCTTCGGGTGCGGCGGGGAAATGCCCGACGAGGCCGCGGTGCAGCGCAGC 622 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 52238 CACGAGCAGATCTTCGGGTGCGGCGGGGAAATGCCCGACGAGGCCGCGGTGCAGCGCAGC 52297 Query 623 GTAGAGCACCTGCAGAAGCACGGGCTCTGGGGGCAGCCGGCCACGCCCTTGCCAGACGTG 682 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 52298 GTAGAGCACCTGCAGAAGCACGGGCTCTGGGGGCAGCCGGCCACGCCCTTGCCAGACGTG 52357 Query 683 GAGCTGCGCCTGCCCCGGCTCTTCGGGGGCAACCTGGACCAGCACTTCCGCCTCCTGGCC 742 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 52358 GAGCTGCGCCTGCCCCGGCTCTTCGGGGGCAACCTGGACCAGCACTTCCGCCTCCTGGCC 52417 Query 743 CAGAAGCAGAGCCTGCCTTACTTGGAGGCGGCCGCCTCGTTATTGGAGGCCCAATTGCCC 802 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 52418 CAGAAGCAGAGCCTGCCTTACTTGGAGGCGGCCGCCTCGTTATTGGAGGCCCAATTGCCC 52477 Query 803 CCCGAGCCCAAGAGCTGGGCCTGGGCGGAGGGCTGGACCCGGTACGGCCCCGAGGGGGAG 862 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 52478 CCCGAGCCCAAGAGCTGGGCCTGGGCGGAGGGCTGGACCCGGTACGGCCCCGAGGGGGAG 52537 Query 863 GCCGAACCCGTGGCCATCCCCGAGGAGCGGGCCCTGGTGTTCGACGTGGAGGTCTGCTTG 922 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 52538 GCCGAACCCGTGGCCATCCCCGAGGAGCGGGCCCTGGTGTTCGACGTGGAGGTCTGCTTG 52597 Query 923 GCAGAGGGAACCTGCCCCACTTTGGCGGTGGCCATATCCCCCTCGGCCTGGTA 975 ||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 52598 GCAGAGGGAACCTGCCCCACTTTGGCGGTGGCCATATCCCCCTCGGCCTGGTA 52650 Score = 1212 bits (656), Expect = 0.0 Identities = 656/656 (100%), Gaps = 0/656 (0%) Strand=Plus/Plus Query 3941 GGTGAAGCACTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACGA 4000 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 67213 GGTGAAGCACTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACGA 67272 Query 4001 AGCCAGCCTGGACCCTAGCTCTGTCTGGAGGTTCTGTATTTGCTCCTGTGGAGCTTTATT 4060 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 67273 AGCCAGCCTGGACCCTAGCTCTGTCTGGAGGTTCTGTATTTGCTCCTGTGGAGCTTTATT 67332 Query 4061 GGAGCGGTGCAGGTTCCTAAACTCAGGCTTTCAGATGTGCTTTTTTGCAAAAGGCAGCCA 4120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 67333 GGAGCGGTGCAGGTTCCTAAACTCAGGCTTTCAGATGTGCTTTTTTGCAAAAGGCAGCCA 67392 Query 4121 TTTTTCTGTAGCAGGACCTGCCCAGGAAAGTCCTCCTAACGGAAGGCACAATTCAGTGCG 4180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 67393 TTTTTCTGTAGCAGGACCTGCCCAGGAAAGTCCTCCTAACGGAAGGCACAATTCAGTGCG 67452 Query 4181 TTCAGAACCAGGACACCAACATCAGTGCAGGCTGTGTGACAAGGGGTACTGTTGGGCACA 4240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 67453 TTCAGAACCAGGACACCAACATCAGTGCAGGCTGTGTGACAAGGGGTACTGTTGGGCACA 67512 Query 4241 AATGAAGCAGATGCCCCAAAGGTCACATTAACTCAGGCATTTCTTCCTCCTCTTCTTGGC 4300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 67513 AATGAAGCAGATGCCCCAAAGGTCACATTAACTCAGGCATTTCTTCCTCCTCTTCTTGGC 67572 Query 4301 TGGTTCTCTGTCCTGCTGTGTATGTGCTGATGCAGTGCCCTAGAAGGGGAGAGTAGAAAT 4360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 67573 TGGTTCTCTGTCCTGCTGTGTATGTGCTGATGCAGTGCCCTAGAAGGGGAGAGTAGAAAT 67632 Query 4361 TTTGACAACCTTGTTCTAAGGTGATGGGAATAAAAACAAACACCAAACTCCTGGAACAGT 4420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 67633 TTTGACAACCTTGTTCTAAGGTGATGGGAATAAAAACAAACACCAAACTCCTGGAACAGT 67692 Query 4421 TGTGCTTTCCCGTCTGCTGCCCAGGTTGTGACTTAGAACTCCGTCCTGAGTAGATGGACG 4480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 67693 TGTGCTTTCCCGTCTGCTGCCCAGGTTGTGACTTAGAACTCCGTCCTGAGTAGATGGACG 67752 Query 4481 AGATGCTGGGAGCCCGGAGCATCACAGCTACAGACGGCCTGGGGCACAGTGATGTACGGA 4540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 67753 AGATGCTGGGAGCCCGGAGCATCACAGCTACAGACGGCCTGGGGCACAGTGATGTACGGA 67812 Query 4541 ACTCCGCATCAGCCGGCTAGCCAGATTATTTTATATAAATGTCTAATTTTGACTGG 4596 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 67813 ACTCCGCATCAGCCGGCTAGCCAGATTATTTTATATAAATGTCTAATTTTGACTGG 67868 Score = 462 bits (250), Expect = 5e-126 Identities = 250/250 (100%), Gaps = 0/250 (0%) Strand=Plus/Plus Query 3032 GGCTGCACGGCCTTTGGCTGGATGACTCTGCAGGGCAGGAAGAGCAGAGGCACTGATCTG 3091 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 63299 GGCTGCACGGCCTTTGGCTGGATGACTCTGCAGGGCAGGAAGAGCAGAGGCACTGATCTG 63358 Query 3092 CACAGCAAGACAGCTGCCACTGTGGGCATCAGCCGAGAGCATGCCAAAATCTTCAACTAT 3151 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 63359 CACAGCAAGACAGCTGCCACTGTGGGCATCAGCCGAGAGCATGCCAAAATCTTCAACTAT 63418 Query 3152 GGCCGCATCTATGGGGCTGGGCAGTCCTTTGCTGAGCGCCTACTGATGCAGTTCAACCAC 3211 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 63419 GGCCGCATCTATGGGGCTGGGCAGTCCTTTGCTGAGCGCCTACTGATGCAGTTCAACCAC 63478 Query 3212 AGGCTCACAAGGCAGGAGGCAGCTGAGAAGGCCCAGCAGATGTATGCAGTCACAAAAGGC 3271 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 63479 AGGCTCACAAGGCAGGAGGCAGCTGAGAAGGCCCAGCAGATGTATGCAGTCACAAAAGGC 63538 Query 3272 CTGCGCCGGT 3281 |||||||||| Sbjct 63539 CTGCGCCGGT 63548 Score = 440 bits (238), Expect = 2e-119 Identities = 238/238 (100%), Gaps = 0/238 (0%) Strand=Plus/Plus Query 2019 GGTGGTACCGGAAGCTCTGCCCTCGACTAGATGACCCTGCCTGGGCTCCCGGCCCCAGCC 2078 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 58840 GGTGGTACCGGAAGCTCTGCCCTCGACTAGATGACCCTGCCTGGGCTCCCGGCCCCAGCC 58899 Query 2079 TCCTCAGCCTGCAAATGCGGGTCACTCCTAAGCTCATGGCACTGACCTGGGATGGTTTTC 2138 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 58900 TCCTCAGCCTGCAAATGCGGGTCACTCCTAAGCTCATGGCACTGACCTGGGATGGTTTTC 58959 Query 2139 CTCTACACTACTCAGACTCTCATGGTTGGGGCTACCTAGTGCCTGGGCGTCGGGATAATC 2198 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 58960 CTCTACACTACTCAGACTCTCATGGTTGGGGCTACCTAGTGCCTGGGCGTCGGGATAATC 59019 Query 2199 TGACCGAGCCGCCAGTGAGCCCCACTGTAGAATCCGCTGCAGTAACCTGCCCCTACAG 2256 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 59020 TGACCGAGCCGCCAGTGAGCCCCACTGTAGAATCCGCTGCAGTAACCTGCCCCTACAG 59077 Score = 394 bits (213), Expect = 2e-105 Identities = 213/213 (100%), Gaps = 0/213 (0%) Strand=Plus/Plus Query 3570 AGTTTATAACCAGTCGTGTGAACTGGGTGGTACAGAGCTCTGCTGTAGACTACTTACATC 3629 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 65499 AGTTTATAACCAGTCGTGTGAACTGGGTGGTACAGAGCTCTGCTGTAGACTACTTACATC 65558 Query 3630 TCATGCTTGTGGCCATGAAGTGGCTGTTTGAGGAATTTGCCATTGATGGGCGCTTCTGCA 3689 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 65559 TCATGCTTGTGGCCATGAAGTGGCTGTTTGAGGAATTTGCCATTGATGGGCGCTTCTGCA 65618 Query 3690 TCAGCATCCACGACGAGGTTCGCTACCTGGTGCGTGAGGAGGACCGCTACCGTGCCGCCC 3749 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 65619 TCAGCATCCACGACGAGGTTCGCTACCTGGTGCGTGAGGAGGACCGCTACCGTGCCGCCC 65678 Query 3750 TGGCACTGCAGATCACCAATCTCCTGACCAGGT 3782 ||||||||||||||||||||||||||||||||| Sbjct 65679 TGGCACTGCAGATCACCAATCTCCTGACCAGGT 65711 Score = 379 bits (205), Expect = 5e-101 Identities = 205/205 (100%), Gaps = 0/205 (0%) Strand=Plus/Plus Query 1 ATTGGCGGCGCTCTTATTGGACGCTCGGGGGAGTCTCCCGCCTGCCTCTGGGTAGCCGCG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 50978 ATTGGCGGCGCTCTTATTGGACGCTCGGGGGAGTCTCCCGCCTGCCTCTGGGTAGCCGCG 51037 Query 61 GGACCCAGTTCGCGCAGACGGGAAGTTGCGGCTGCTCCCGAGACCGCACGCCACCCTGAG 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 51038 GGACCCAGTTCGCGCAGACGGGAAGTTGCGGCTGCTCCCGAGACCGCACGCCACCCTGAG 51097 Query 121 GCTGCGTGGGCCGCGCGCCGCGGACGCCGCGTCGTCGCCGGGGCTGTGGGCTGCCGCAGA 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 51098 GCTGCGTGGGCCGCGCGCCGCGGACGCCGCGTCGTCGCCGGGGCTGTGGGCTGCCGCAGA 51157 Query 181 ACGGGAAGCGCGAAGCGGACCGAGG 205 ||||||||||||||||||||||||| Sbjct 51158 ACGGGAAGCGCGAAGCGGACCGAGG 51182 Score = 366 bits (198), Expect = 4e-97 Identities = 198/198 (100%), Gaps = 0/198 (0%) Strand=Plus/Plus Query 972 GGTATTCCTGGTGCAGCCGGCGGCTGGTGGAAGAGCGTTACTCTTGGACCAGCCAGCTAT 1031 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 55357 GGTATTCCTGGTGCAGCCGGCGGCTGGTGGAAGAGCGTTACTCTTGGACCAGCCAGCTAT 55416 Query 1032 CGCCGGCTGACCTAATCCCTTTGGGGGGCTCCACTAGTGCCAGCAGCTCCACCAAGCAGG 1091 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 55417 CGCCGGCTGACCTAATCCCTTTGGGGGGCTCCACTAGTGCCAGCAGCTCCACCAAGCAGG 55476 Query 1092 ATGGGCAGGAACAGTTAGTGGTGGGGCACAATGTTTCCTTTGACCGAGCCCATATCAGGG 1151 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 55477 ATGGGCAGGAACAGTTAGTGGTGGGGCACAATGTTTCCTTTGACCGAGCCCATATCAGGG 55536 Query 1152 AACAGTATCTGATTCAGG 1169 |||||||||||||||||| Sbjct 55537 AACAGTATCTGATTCAGG 55554 Score = 348 bits (188), Expect = 1e-91 Identities = 188/188 (100%), Gaps = 0/188 (0%) Strand=Plus/Plus Query 1559 AGGTGTCCCCACCCAGTGACTCTGGCTGGCATGCTGGAGATGGGTGTGTCCTACCTGCCT 1618 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 57378 AGGTGTCCCCACCCAGTGACTCTGGCTGGCATGCTGGAGATGGGTGTGTCCTACCTGCCT 57437 Query 1619 GTCAACCAGAACTGGGAGCGTTACCTGACAGAGGCACAGAACACATATGAGGAGCTCCAG 1678 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 57438 GTCAACCAGAACTGGGAGCGTTACCTGACAGAGGCACAGAACACATATGAGGAGCTCCAG 57497 Query 1679 CGGGAGATGAAGAAGTCGCTGATGGATCTGGCTAATGATGCCTGTCAGTTGCTCTCAGGA 1738 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 57498 CGGGAGATGAAGAAGTCGCTGATGGATCTGGCTAATGATGCCTGTCAGTTGCTCTCAGGA 57557 Query 1739 GAGAGGTA 1746 |||||||| Sbjct 57558 GAGAGGTA 57565 Score = 315 bits (170), Expect = 1e-81 Identities = 170/170 (100%), Gaps = 0/170 (0%) Strand=Plus/Plus Query 1164 TTCAGGACTCCCGGATGCGTTTTCTCGATACTATGAGCATGCACATGGCCATCTCGGGGC 1223 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 56566 TTCAGGACTCCCGGATGCGTTTTCTCGATACTATGAGCATGCACATGGCCATCTCGGGGC 56625 Query 1224 TGAGCAGCTTCCAGCGCAGCCTGTGGATGGGAGCCAAGCAGGGAAAGCACAAGACCCAGC 1283 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 56626 TGAGCAGCTTCCAGCGCAGCCTGTGGATGGGAGCCAAGCAGGGAAAGCACAAGACCCAGC 56685 Query 1284 AGTCCACAAAGCGAGGGCAGAAGTCCCCGAGGAAAGCCAATGGTCCAGCG 1333 |||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 56686 AGTCCACAAAGCGAGGGCAGAAGTCCCCGAGGAAAGCCAATGGTCCAGCG 56735 Score = 313 bits (169), Expect = 5e-81 Identities = 169/169 (100%), Gaps = 0/169 (0%) Strand=Plus/Plus Query 3403 GTCACGATGGAAGAAGTGGGAGGTAGCCTCTGAACGAGCATGGACAGGGGGCACAGAGTC 3462 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 65223 GTCACGATGGAAGAAGTGGGAGGTAGCCTCTGAACGAGCATGGACAGGGGGCACAGAGTC 65282 Query 3463 AGAAATGTTTAATAAGCTGGAGAGTATTGCCATGTCTGATACACCACGTACCCCAGTACT 3522 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 65283 AGAAATGTTTAATAAGCTGGAGAGTATTGCCATGTCTGATACACCACGTACCCCAGTACT 65342 Query 3523 GGGCTGCTGCATCAGCAGAGCCTTGGAGCCCTCAGTTGTCCAGGGAGAG 3571 ||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 65343 GGGCTGCTGCATCAGCAGAGCCTTGGAGCCCTCAGTTGTCCAGGGAGAG 65391 Score = 311 bits (168), Expect = 2e-80 Identities = 173/175 (98%), Gaps = 1/175 (0%) Strand=Plus/Plus Query 3778 CAGGTGCATGTTTGCCTATAAGCTGGGTCTGAATGATCTGCCCCAGTCAGTCGCCTTTTT 3837 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 66603 CAGGTGCATGTTTGCCTATAAGCTGGGTCTGAATGATCTGCCCCAGTCAGTCGCCTTTTT 66662 Query 3838 CAGTGCAGTAGACATTGACCAGTGCCTCAGGAAGGAAGTGACCATGGACTGTAAAACTCC 3897 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 66663 CAGTGCAGTAGACATTGACCAGTGCCTCAGGAAGGAAGTGACCATGGACTGTAAAACTCC 66722 Query 3898 TTCTAACCCAACTGGGATGGAAAGGAGATATGGGATCCCCCAGGGTGAA-GCACT 3951 |||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct 66723 TTCTAACCCAACTGGGATGGAAAGGAGATATGGGATCCCCCAGGGTGAGTGCACT 66777 Score = 303 bits (164), Expect = 3e-78 Identities = 169/171 (98%), Gaps = 2/171 (1%) Strand=Plus/Plus Query 2555 CCT-CACAAGGACGGTAACAACTACAATGTGGGCAGTCCCTTTGCCAAAGATTTCCTGCC 2613 ||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 61647 CCTCCAC-AGGACGGTAACAACTACAATGTGGGCAGTCCCTTTGCCAAAGATTTCCTGCC 61705 Query 2614 CAAGATGGAGGATGGCACCCTGCAGGCTGGCCCAGGAGGTGCCAGTGGGCCTCGTGCCCT 2673 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 61706 CAAGATGGAGGATGGCACCCTGCAGGCTGGCCCAGGAGGTGCCAGTGGGCCTCGTGCCCT 61765 Query 2674 GGAAATAAATAAAATGATTTCTTTTTGGAGGAATGCTCATAAACGTATCAG 2724 ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 61766 GGAAATAAATAAAATGATTTCTTTTTGGAGGAATGCTCATAAACGTATCAG 61816 Score = 279 bits (151), Expect = 5e-71 Identities = 151/151 (100%), Gaps = 0/151 (0%) Strand=Plus/Plus Query 1742 AGGTACAAAGAAGACCCTTGGCTCTGGGACCTAGAATGGGATTTGCAGGAGTTTAAGCAG 1801 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 57664 AGGTACAAAGAAGACCCTTGGCTCTGGGACCTAGAATGGGATTTGCAGGAGTTTAAGCAG 57723 Query 1802 AAAAAGGCAAAGAAGGTGAAGAAGCCAGCCTCAGCCAGCAAGTTGCCCATCGAGGGAGCT 1861 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 57724 AAAAAGGCAAAGAAGGTGAAGAAGCCAGCCTCAGCCAGCAAGTTGCCCATCGAGGGAGCT 57783 Query 1862 GGGCCCTTTGGGGATCCCATGGATCAGGAAG 1892 ||||||||||||||||||||||||||||||| Sbjct 57784 GGGCCCTTTGGGGATCCCATGGATCAGGAAG 57814 Score = 276 bits (149), Expect = 6e-70 Identities = 149/149 (100%), Gaps = 0/149 (0%) Strand=Plus/Plus Query 1333 GATCTCATCTTGGGACTGGATGGATATCAGCAGTGCCAATAATCTTGCAGATGTGCACAA 1392 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 56841 GATCTCATCTTGGGACTGGATGGATATCAGCAGTGCCAATAATCTTGCAGATGTGCACAA 56900 Query 1393 CCTTTATGTGGGGGGACCTCCCTTAGAGAAGGAGCCTCGGGAGCTGTTCGTCAAAGGCAG 1452 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 56901 CCTTTATGTGGGGGGACCTCCCTTAGAGAAGGAGCCTCGGGAGCTGTTCGTCAAAGGCAG 56960 Query 1453 CATGAGGGATATCCGAGAGAACTTCCAGG 1481 ||||||||||||||||||||||||||||| Sbjct 56961 CATGAGGGATATCCGAGAGAACTTCCAGG 56989 Score = 255 bits (138), Expect = 8e-64 Identities = 138/138 (100%), Gaps = 0/138 (0%) Strand=Plus/Plus Query 2896 GCCTGACCGGGTAGGCAGTGAGTTGAAAGCCATGGTGCAGGCTCCACCTGGCTATGTCCT 2955 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 63076 GCCTGACCGGGTAGGCAGTGAGTTGAAAGCCATGGTGCAGGCTCCACCTGGCTATGTCCT 63135 Query 2956 TGTGGGTGCTGATGTGGACTCACAGGAACTGTGGATCGCAGCTGTACTTGGAGATGCTCA 3015 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 63136 TGTGGGTGCTGATGTGGACTCACAGGAACTGTGGATCGCAGCTGTACTTGGAGATGCTCA 63195 Query 3016 CTTTGCTGGGATGCATGG 3033 |||||||||||||||||| Sbjct 63196 CTTTGCTGGGATGCATGG 63213 Score = 243 bits (131), Expect = 7e-60 Identities = 131/131 (100%), Gaps = 0/131 (0%) Strand=Plus/Plus Query 1891 AGATCCTGGCCCGCCCAGCGAGGAGGAGGAGCTTCAGCGAAGTGTAACAGCCCACAACCG 1950 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 57949 AGATCCTGGCCCGCCCAGCGAGGAGGAGGAGCTTCAGCGAAGTGTAACAGCCCACAACCG 58008 Query 1951 GTTACAGCAGCTGAGGAGCACCACGGACCTCCTGCCTAAGCGACCCCAGCACCTTCCAGG 2010 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 58009 GTTACAGCAGCTGAGGAGCACCACGGACCTCCTGCCTAAGCGACCCCAGCACCTTCCAGG 58068 Query 2011 ACACCCTGGGT 2021 ||||||||||| Sbjct 58069 ACACCCTGGGT 58079 Score = 235 bits (127), Expect = 1e-57 Identities = 127/127 (100%), Gaps = 0/127 (0%) Strand=Plus/Plus Query 2253 ACAGAGCCATCGAGTCCTTATACAGGAAGCACTGCCTTGAACAGGGGAAGCAGCAATTGG 2312 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 60419 ACAGAGCCATCGAGTCCTTATACAGGAAGCACTGCCTTGAACAGGGGAAGCAGCAATTGG 60478 Query 2313 AGCCCCAGGAGGTAGACCTGGCTGAGGAGTTCTTACTCACTGACAGTAGTGCCATGTGGC 2372 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 60479 AGCCCCAGGAGGTAGACCTGGCTGAGGAGTTCTTACTCACTGACAGTAGTGCCATGTGGC 60538 Query 2373 AAACGGT 2379 ||||||| Sbjct 60539 AAACGGT 60545 Score = 233 bits (126), Expect = 4e-57 Identities = 126/126 (100%), Gaps = 0/126 (0%) Strand=Plus/Plus Query 3279 GGTATCGGCTGTCTGCGGATGGTGAGTGGCTGGTGAAACAGTTGAATCTTCCTGTGGACA 3338 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 65021 GGTATCGGCTGTCTGCGGATGGTGAGTGGCTGGTGAAACAGTTGAATCTTCCTGTGGACA 65080 Query 3339 GGACAGAGGACGGCTGGGTCTCCCTACAAGATCTTCGAATGATCCGAAGAGAAGCTTCAA 3398 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 65081 GGACAGAGGACGGCTGGGTCTCCCTACAAGATCTTCGAATGATCCGAAGAGAAGCTTCAA 65140 Query 3399 GGAAGT 3404 |||||| Sbjct 65141 GGAAGT 65146 Score = 226 bits (122), Expect = 7e-55 Identities = 122/122 (100%), Gaps = 0/122 (0%) Strand=Plus/Plus Query 2775 CCAGGCACCCCAGCTTCGATGAGGAAGGCCACTATGGGGCCATCCTACCCCAGGTGGTGA 2834 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 62536 CCAGGCACCCCAGCTTCGATGAGGAAGGCCACTATGGGGCCATCCTACCCCAGGTGGTGA 62595 Query 2835 CTGCTGGCACCATCACCCGTCGAGCTGTGGAGCCCACGTGGCTCACTGCCAGTAATGCTC 2894 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 62596 CTGCTGGCACCATCACCCGTCGAGCTGTGGAGCCCACGTGGCTCACTGCCAGTAATGCTC 62655 Query 2895 GG 2896 || Sbjct 62656 GG 62657 Score = 204 bits (110), Expect = 3e-48 Identities = 110/110 (100%), Gaps = 0/110 (0%) Strand=Plus/Plus Query 2455 GCCTGCTGCTTGTGCCCCCAAATCCAGCCAGCCCACGTATCACCATGGCAACGGACCTTA 2514 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 61102 GCCTGCTGCTTGTGCCCCCAAATCCAGCCAGCCCACGTATCACCATGGCAACGGACCTTA 61161 Query 2515 TAATGATGTGAATATCCCTGGTTGCTGGTTTTTCAAGCTGCCTCACAAGG 2564 |||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 61162 TAATGATGTGAATATCCCTGGTTGCTGGTTTTTCAAGCTGCCTCACAAGG 61211 Score = 158 bits (85), Expect = 2e-34 Identities = 85/85 (100%), Gaps = 0/85 (0%) Strand=Plus/Plus Query 1479 AGGATCTGATGCAGTACTGCGCCCGTGATGTGTGGGCCACCTTTGAGGTTTTCCAGCAGC 1538 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 57112 AGGATCTGATGCAGTACTGCGCCCGTGATGTGTGGGCCACCTTTGAGGTTTTCCAGCAGC 57171 Query 1539 AGCTGCCACTCTTCTTGGAGAGGTG 1563 ||||||||||||||||||||||||| Sbjct 57172 AGCTGCCACTCTTCTTGGAGAGGTG 57196 Score = 147 bits (79), Expect = 5e-31 Identities = 79/79 (100%), Gaps = 0/79 (0%) Strand=Plus/Plus Query 2377 GGTAGAAGAACTGGGCTGCTTAGACGTAGAGGCTGAGGCCAAGATGGAGAATTCAGGGCT 2436 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 60738 GGTAGAAGAACTGGGCTGCTTAGACGTAGAGGCTGAGGCCAAGATGGAGAATTCAGGGCT 60797 Query 2437 GAGCCAACCTCTAGTTCTG 2455 ||||||||||||||||||| Sbjct 60798 GAGCCAACCTCTAGTTCTG 60816 Score = 108 bits (58), Expect = 2e-19 Identities = 58/58 (100%), Gaps = 0/58 (0%) Strand=Plus/Plus Query 2722 CAGTTCCCAGATGGTGGTATGGCTCCCCAGGTCAGCTCTGCCCCGGGTTGTGACCAGG 2779 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 62384 CAGTTCCCAGATGGTGGTATGGCTCCCCAGGTCAGCTCTGCCCCGGGTTGTGACCAGG 62441 >gb|AF268970.1|AF268970S1 Gene info Mus musculus mitochondrial DNA polymerase gamma (Polg) gene, exons 1 and 2 and 5'UTR; nuclear gene for mitochondrial product Length=2915 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 1417 bits (767), Expect = 0.0 Identities = 771/773 (99%), Gaps = 0/773 (0%) Strand=Plus/Plus Query 203 AGGACTTGTGTGAGGAAGGCAGGCATGGTGAGACCTATTTCACTGACAGGAGCACAGAGA 262 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1865 AGGACTTGTGTGAGGAAGGCAGGCATGGTGAGACCTATTTCACTGACAGGAGCACAGAGA 1924 Query 263 GGGGACGCGTCTCTCTCTGAGTCTTTCGGCCACTAAAAGCAGTCAAGCTGGAGCCCAAAG 322 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1925 GGGGACGCGTCTCTCTCTGAGTCTTTCGGCCACTAAAAGCAGTCAAGCTGGAGCCCAAAG 1984 Query 323 CCCGGTGCCCCGACTCACAGCGGGGGGCTCCCTGCACCAACCATGAGCCGCCTGCTCTGG 382 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1985 CCCGGTGCCCCGACTCACAGCGGGGGGCTCCCTGCACCAACCATGAGCCGCCTGCTCTGG 2044 Query 383 AAGAAGGTGGCTGGCGCCAAGGTCGCCTCAGGGCCAGTACCAGCAACCGCGCGCTGGGTC 442 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2045 AAGAAGGTGGCTGGCGCCAAGGTCGCCTCAGGGCCAGTACCAGCAACCGCGCGCTGGGTC 2104 Query 443 TCCAGCTCCGTCCTCGACCCCGTCCCCAGCGACGGGCGGCCGCCGTCGCAAATGCCCTCC 502 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2105 GCCAGCTCCGTCCTCGACCCCGTCCCCAGCGACGGGCGGCCGCCGTCGCAAATGCCCTCC 2164 Query 503 TCCGAGAATGGGCAGCTGCGGCTCAACCCTCTGCTCATCCAGATGTTGTCGAGAGGCCTG 562 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2165 TCCGAGAATGGGCAGCTGCGGCTCAACCCTCTGCTCATCCAGATGTTGTCGAGAGGCCTG 2224 Query 563 CACGAGCAGATCTTCGGGTGCGGCGGGGAAATGCCCGACGAGGCCGCGGTGCAGCGCAGC 622 ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| Sbjct 2225 CACGAGCAGATCTTCGGGTGCGGAGGGGAAATGCCCGACGAGGCCGCGGTGCAGCGCAGC 2284 Query 623 GTAGAGCACCTGCAGAAGCACGGGCTCTGGGGGCAGCCGGCCACGCCCTTGCCAGACGTG 682 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2285 GTAGAGCACCTGCAGAAGCACGGGCTCTGGGGGCAGCCGGCCACGCCCTTGCCAGACGTG 2344 Query 683 GAGCTGCGCCTGCCCCGGCTCTTCGGGGGCAACCTGGACCAGCACTTCCGCCTCCTGGCC 742 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2345 GAGCTGCGCCTGCCCCGGCTCTTCGGGGGCAACCTGGACCAGCACTTCCGCCTCCTGGCC 2404 Query 743 CAGAAGCAGAGCCTGCCTTACTTGGAGGCGGCCGCCTCGTTATTGGAGGCCCAATTGCCC 802 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2405 CAGAAGCAGAGCCTGCCTTACTTGGAGGCGGCCGCCTCGTTATTGGAGGCCCAATTGCCC 2464 Query 803 CCCGAGCCCAAGAGCTGGGCCTGGGCGGAGGGCTGGACCCGGTACGGCCCCGAGGGGGAG 862 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2465 CCCGAGCCCAAGAGCTGGGCCTGGGCGGAGGGCTGGACCCGGTACGGCCCCGAGGGGGAG 2524 Query 863 GCCGAACCCGTGGCCATCCCCGAGGAGCGGGCCCTGGTGTTCGACGTGGAGGTCTGCTTG 922 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2525 GCCGAACCCGTGGCCATCCCCGAGGAGCGGGCCCTGGTGTTCGACGTGGAGGTCTGCTTG 2584 Query 923 GCAGAGGGAACCTGCCCCACTTTGGCGGTGGCCATATCCCCCTCGGCCTGGTA 975 ||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2585 GCAGAGGGAACCTGCCCCACTTTGGCGGTGGCCATATCCCCCTCGGCCTGGTA 2637 Score = 366 bits (198), Expect = 4e-97 Identities = 203/205 (99%), Gaps = 1/205 (0%) Strand=Plus/Plus Query 1 ATTGGCGGCGCTCTTATTGGACGCTCGGGGGAGTCTCCCGCCTGCCTCTGGGTAGCCGCG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 957 ATTGGCGGCGCTCTTATTGGACGCTCGGGGGAGTCTCCCGCCTGCCTCTGGGTAGCCGCG 1016 Query 61 GGACCCAGTTCGCGCAGACGGGAAGTTGCGGCTGCTCCCGAGACCGCACGCCACCCTGAG 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1017 GGACCCAGTTCGCGCAGACGGGAAGTTGCGGCTGCTCCCGAGACCGCACGCCACCCTGAG 1076 Query 121 GCTGCGTGGGCCGCGCGCCGCGGACGCCGCGTCGTCGCCGGGGCTGTGGGCTGCCGCAGA 180 |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct 1077 GCTGCGTGGGCCGCGCGCCGCG-ACGCCGCGTCGTCGCCGGGGCTGTGGGCTGCCGCAGA 1135 Query 181 ACGGGAAGCGCGAAGCGGACCGAGG 205 |||||||||||| |||||||||||| Sbjct 1136 ACGGGAAGCGCGGAGCGGACCGAGG 1160 >dbj|AK135341.1| UniGene infoGene info Mus musculus 12 days embryo female mullerian duct includes surrounding region cDNA, RIKEN full-length enriched library, clone:6820401J03 product:polymerase (DNA directed), gamma, full insert sequence Length=2282 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 1352 bits (732), Expect = 0.0 Identities = 758/771 (98%), Gaps = 0/771 (0%) Strand=Plus/Plus Query 205 GACTTGTGTGAGGAAGGCAGGCATGGTGAGACCTATTTCACTGACAGGAGCACAGAGAGG 264 |||||||||||||||| ||| |||||||||||||||||||||||||||| |||||||||| Sbjct 826 GACTTGTGTGAGGAAGCCAGCCATGGTGAGACCTATTTCACTGACAGGACCACAGAGAGG 885 Query 265 GGACGCGTCTCTCTCTGAGTCTTTCGGCCACTAAAAGCAGTCAAGCTGGAGCCCAAAGCC 324 |||||||||||||||||| | |||||||||||||||||||||||||||||||||||| || Sbjct 886 GGACGCGTCTCTCTCTGATTTTTTCGGCCACTAAAAGCAGTCAAGCTGGAGCCCAAACCC 945 Query 325 CGGTGCCCCGACTCACAGCGGGGGGCTCCCTGCACCAACCATGAGCCGCCTGCTCTGGAA 384 |||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||| Sbjct 946 CGGTCCCCCGACTCACAGCGGGGGGCTCCCTACACCAACCATGAGCCGCCTGCTCTGGAA 1005 Query 385 GAAGGTGGCTGGCGCCAAGGTCGCCTCAGGGCCAGTACCAGCAACCGCGCGCTGGGTCTC 444 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1006 GAAGGTGGCTGGCGCCAAGGTCGCCTCAGGGCCAGTACCAGCAACCGCGCGCTGGGTCTC 1065 Query 445 CAGCTCCGTCCTCGACCCCGTCCCCAGCGACGGGCGGCCGCCGTCGCAAATGCCCTCCTC 504 || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1066 CATCTCCGTCCTCGACCCCGTCCCCAGCGACGGGCGGCCGCCGTCGCAAATGCCCTCCTC 1125 Query 505 CGAGAATGGGCAGCTGCGGCTCAACCCTCTGCTCATCCAGATGTTGTCGAGAGGCCTGCA 564 |||||||||||| ||||||||||||||| || |||||||||||||||||||||||||||| Sbjct 1126 CGAGAATGGGCATCTGCGGCTCAACCCTGTGGTCATCCAGATGTTGTCGAGAGGCCTGCA 1185 Query 565 CGAGCAGATCTTCGGGTGCGGCGGGGAAATGCCCGACGAGGCCGCGGTGCAGCGCAGCGT 624 ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1186 CGAGCAGATGTTCGGGTGCGGCGGGGAAATGCCCGACGAGGCCGCGGTGCAGCGCAGCGT 1245 Query 625 AGAGCACCTGCAGAAGCACGGGCTCTGGGGGCAGCCGGCCACGCCCTTGCCAGACGTGGA 684 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1246 AGAGCACCTGCAGAAGCACGGGCTCTGGGGGCAGCCGGCCACGCCCTTGCCAGACGTGGA 1305 Query 685 GCTGCGCCTGCCCCGGCTCTTCGGGGGCAACCTGGACCAGCACTTCCGCCTCCTGGCCCA 744 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1306 GCTGCGCCTGCCCCGGCTCTTCGGGGGCAACCTGGACCAGCACTTCCGCCTCCTGGCCCA 1365 Query 745 GAAGCAGAGCCTGCCTTACTTGGAGGCGGCCGCCTCGTTATTGGAGGCCCAATTGCCCCC 804 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1366 GAAGCAGAGCCTGCCTTACTTGGAGGCGGCCGCCTCGTTATTGGAGGCCCAATTGCCCCC 1425 Query 805 CGAGCCCAAGAGCTGGGCCTGGGCGGAGGGCTGGACCCGGTACGGCCCCGAGGGGGAGGC 864 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1426 CGAGCCCAAGAGCTGGGCCTGGGCGGAGGGCTGGACCCGGTACGGCCCCGAGGGGGAGGC 1485 Query 865 CGAACCCGTGGCCATCCCCGAGGAGCGGGCCCTGGTGTTCGACGTGGAGGTCTGCTTGGC 924 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1486 CGAACCCGTGGCCATCCCCGAGGAGCGGGCCCTGGTGTTCGACGTGGAGGTCTGCTTGGC 1545 Query 925 AGAGGGAACCTGCCCCACTTTGGCGGTGGCCATATCCCCCTCGGCCTGGTA 975 ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1546 AGAGGGAACCTGCCCCACTTTGGCGGTGGCCATATCCCCCTCGGCCTGGTA 1596 Score = 233 bits (126), Expect = 4e-57 Identities = 126/126 (100%), Gaps = 0/126 (0%) Strand=Plus/Plus Query 80 GGGAAGTTGCGGCTGCTCCCGAGACCGCACGCCACCCTGAGGCTGCGTGGGCCGCGCGCC 139 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2 GGGAAGTTGCGGCTGCTCCCGAGACCGCACGCCACCCTGAGGCTGCGTGGGCCGCGCGCC 61 Query 140 GCGGACGCCGCGTCGTCGCCGGGGCTGTGGGCTGCCGCAGAACGGGAAGCGCGAAGCGGA 199 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 62 GCGGACGCCGCGTCGTCGCCGGGGCTGTGGGCTGCCGCAGAACGGGAAGCGCGAAGCGGA 121 Query 200 CCGAGG 205 |||||| Sbjct 122 CCGAGG 127 >dbj|AK130624.1| UniGene infoGene info Homo sapiens cDNA FLJ27114 fis, clone SPL05987, highly similar to DNA polymerase gamma (EC 2.7.7.7) Length=1324 Score = 1275 bits (690), Expect = 0.0 Identities = 1078/1256 (85%), Gaps = 63/1256 (5%) Strand=Plus/Plus Query 3143 TTCAACTATGGCCGCATCTATGGGGCTGGGCAGTCCTTTGCTGAGCGCCTACTGATGCAG 3202 |||||||| |||||||||||||| ||||||||| |||||||||||||| |||| |||||| Sbjct 1 TTCAACTACGGCCGCATCTATGGTGCTGGGCAGCCCTTTGCTGAGCGCTTACTAATGCAG 60 Query 3203 TTCAACCACAGGCTCACA-AGGCAGGAGGCAGCTGAGAAGGCCCAGCAGATGTATGCAGT 3261 || |||||| |||||||| | ||||||||||||||||||||||||||||||||| || | Sbjct 61 TTTAACCACCGGCTCACACA-GCAGGAGGCAGCTGAGAAGGCCCAGCAGATGTACGCTGC 119 Query 3262 CACAAAAGGCCTGCGCCGGTATCGGCTGTCTGCGGATGGTGAGTGGCTGGTGAAACAGTT 3321 ||| || ||||| ||| ||||||||||||| | || || ||||||||||||| |||| Sbjct 120 CACCAAGGGCCTCCGCTGGTATCGGCTGTCGGATGAGGGCGAGTGGCTGGTGAGGGAGTT 179 Query 3322 GAATCTTCCTGTGGACAGGACAGAGGACGGCTGGGTCTCCCTACAAGATCTTCG-AATGA 3380 ||| || || ||||||||||| |||| |||||| | ||||| || ||||| || || | Sbjct 180 GAACCTCCCAGTGGACAGGACTGAGGGTGGCTGGATTTCCCTGCAGGATCTGCGCAAGG- 238 Query 3381 TCC-GA-AGAGAAGCTTCAAGGAAGTCAC-GATGGAAGAAGTGGGAGGTAGCCT-CTGAA 3436 ||| || ||| || || |||||||||||| | ||||||||||||||||| | | ||||| Sbjct 239 TCCAGACAGA-AA-CTGCAAGGAAGTCACAG-TGGAAGAAGTGGGAGGTGGT-TGCTGAA 294 Query 3437 CGAGCATGGACAGGGGG-CACAGAGTCAGAAATGTTTAATAAGCTGGAGAGTATTGCCAT 3495 || ||||||| |||||| |||||||||||||||||| |||||||| ||||| ||||| | Sbjct 295 CGGGCATGGA-AGGGGGGCACAGAGTCAGAAATGTTCAATAAGCTTGAGAGCATTGCTAC 353 Query 3496 GTCTGATACACCACGTACCCCAGTACTGGGCTGCTGCATCAGCAGAGCCTTGGAGCCCTC 3555 |||||| | |||||||||||| || |||||||||||||||||| ||||| |||||||||| Sbjct 354 GTCTGACATACCACGTACCCCGGTGCTGGGCTGCTGCATCAGCCGAGCCCTGGAGCCCTC 413 Query 3556 AGTTGTCCAGGGAGAGTTTATAACCAGTCGTGTGAACTGGGTGGTACAGAGCTCTGCTGT 3615 | |||||||| ||||||||| ||||| |||||||| ||||||||||||||||||||||| Sbjct 414 GGCTGTCCAGGAAGAGTTTATGACCAGCCGTGTGAATTGGGTGGTACAGAGCTCTGCTGT 473 Query 3616 AGACTACTTACATCTCATGCTTGTGGCCATGAAGTGGCTGTTTGAGGAATTTGCCATTGA 3675 ||||||||||| |||||||||||||||||||||||||||||||| || |||||||| || Sbjct 474 TGACTACTTACACCTCATGCTTGTGGCCATGAAGTGGCTGTTTGAAGAGTTTGCCATAGA 533 Query 3676 TGGGCGCTTCTGCATCAGCATCCACGACGAGGTTCGCTACCTGGTGCGTGAGGAGGACCG 3735 |||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| Sbjct 534 TGGGCGCTTCTGCATCAGCATCCATGACGAGGTTCGCTACCTGGTGCGGGAGGAGGACCG 593 Query 3736 CTACCGTGCCGCCCTGGCACT-GCAGATCACCAATCTCCTGACCAGGTGCATGTTTGCCT 3794 |||||| || |||||||| || |||||||||||| ||| ||||||||||||||||||||| Sbjct 594 CTACCGCGCTGCCCTGGC-CTTGCAGATCACCAACCTCTTGACCAGGTGCATGTTTGCCT 652 Query 3795 ATAAGCTGGGTCTGAATGATCT-GCCCCAGTCAGTCGCCTTTTTCAGTGCAGTAGACATT 3853 | ||||||||||||||||| || |||||||||||||||||||||||||||||| || ||| Sbjct 653 ACAAGCTGGGTCTGAATGA-CTTGCCCCAGTCAGTCGCCTTTTTCAGTGCAGTCGATATT 711 Query 3854 GACCAGTGCCTCAGGAAGGAAGTGACCATGGACTGTAAAACTCCTTCTAACCCAACTGGG 3913 |||| ||||||||||||||||||||||||||| |||||||| ||||| |||||||||||| Sbjct 712 GACCGGTGCCTCAGGAAGGAAGTGACCATGGATTGTAAAACCCCTTCCAACCCAACTGGG 771 Query 3914 ATGGAAAGGAGATATGGGATCCCCCAGGGTGAAGCACTGGATATTTACCAGATAATTGAA 3973 |||||||||||||| ||||| |||||||||||||| |||||||||||||||||||||||| Sbjct 772 ATGGAAAGGAGATACGGGATTCCCCAGGGTGAAGCGCTGGATATTTACCAGATAATTGAA 831 Query 3974 CTCACCAAAGGCTCCTTGGAAAAACGAAGCCAGCCTGGACCCTAGCTCTGTCTGGAGGTT 4033 ||||||||||||||||||||||||||||||||||||||||| |||| ||| ||||||| | Sbjct 832 CTCACCAAAGGCTCCTTGGAAAAACGAAGCCAGCCTGGACCATAGCACTGCCTGGAGGCT 891 Query 4034 CTGTATTTGCTCCTGTGGAGCTTTATTGGAGCGGTGCAGGTTCCTAAACTCAGGCTTTCA 4093 ||||||||||||| ||||||||| || || | |||||||| ||| ||||||||||||||| Sbjct 892 CTGTATTTGCTCCCGTGGAGCTTCATCGGGGTGGTGCAGGCTCCCAAACTCAGGCTTTCA 951 Query 4094 GATGTGCTTTTTTGCAAAAGG-C------A-G-CCA----TTTTTCTGTAGCAGGACCTG 4140 | |||||||||| |||||||| | | | ||| |||||| ||||||||||||| Sbjct 952 GCTGTGCTTTTT-GCAAAAGGGCTTGCCTAAGGCCAGCCATTTTTCAGTAGCAGGACCTG 1010 Query 4141 CCCAGGAA-AGTCCTCCTAACGGAAGG--CAC---AATTCAGTGCGTTCAGAACCAGGAC 4194 || || || | |||| ||||| ||||| || ||||||||| ||||||||||| || Sbjct 1011 CCAAG-AAGATTCCTTCTAACTGAAGGTGCAGTTGAATTCAGTGGGTTCAGAACCAAGAT 1069 Query 4195 ACCAACATCAGTGCAGG-CTGT-GTGACAAGGGGTA------CT-GTTGGGCACAAATGA 4245 |||||||| ||| || || | ||||||||| | || |||||| | |||||| Sbjct 1070 GCCAACATCGGTGT-GGACTACAG-GACAAGGGGCATTGTTGCTTGTTGGGTAAAAATGA 1127 Query 4246 AGCAGATGCCCCAAAGGTCACATTAACTCAGGCATTTC-TTCCT-----CCT---CTTCT 4296 |||||| ||||||||| ||||||||||||||||||||| || | ||| ||||| Sbjct 1128 AGCAGAAGCCCCAAAGTTCACATTAACTCAGGCATTTCATTTATTTTTTCCTTTTCTTCT 1187 Query 4297 TGGCTGGTTCTCTGTCCTG-CTGTGTATG-TGCTGATGCAGTGCCCTAGAAGGGGA 4350 ||||||||||| ||| ||| | ||| | |||||||||||||||||||||||| Sbjct 1188 TGGCTGGTTCTTTGTTCTGTCCCCC-ATGCT-CTGATGCAGTGCCCTAGAAGGGGA 1241 >gb|AF268975.1|AF268970S6 Gene info Mus musculus mitochondrial DNA polymerase gamma (Polg) gene, exons 19 through 23 and complete cds; nuclear gene for mitochondrial product Length=3427 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 1190 bits (644), Expect = 0.0 Identities = 653/657 (99%), Gaps = 1/657 (0%) Strand=Plus/Plus Query 3941 GGTGAAGCACTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAAC-G 3999 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | Sbjct 2215 GGTGAAGCACTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACGG 2274 Query 4000 AAGCCAGCCTGGACCCTAGCTCTGTCTGGAGGTTCTGTATTTGCTCCTGTGGAGCTTTAT 4059 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || Sbjct 2275 AAGCCAGCCTGGACCCTAGCTCTGTCTGGAGGTTCTGTATTTGCTCCTGTGGAGCTTCAT 2334 Query 4060 TGGAGCGGTGCAGGTTCCTAAACTCAGGCTTTCAGATGTGCTTTTTTGCAAAAGGCAGCC 4119 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2335 TGGAGCGGTGCAGGTTCCTAAACTCAGGCTTTCAGATGTGCTTTTTTGCAAAAGGCAGCC 2394 Query 4120 ATTTTTCTGTAGCAGGACCTGCCCAGGAAAGTCCTCCTAACGGAAGGCACAATTCAGTGC 4179 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2395 ATTTTTCTGTAGCAGGACCTGCCCAGGAAAGTCCTCCTAACGGAAGGCACAATTCAGTGC 2454 Query 4180 GTTCAGAACCAGGACACCAACATCAGTGCAGGCTGTGTGACAAGGGGTACTGTTGGGCAC 4239 ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct 2455 GTTCAGAACCAGGACACCAACGTCAGTGCAGGCTGTGTGACAAGGGGTACTGTTGGGCAC 2514 Query 4240 AAATGAAGCAGATGCCCCAAAGGTCACATTAACTCAGGCATTTCTTCCTCCTCTTCTTGG 4299 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2515 AAATGAAGCAGATGCCCCAAAGGTCACATTAACTCAGGCATTTCTTCCTCCTCTTCTTGG 2574 Query 4300 CTGGTTCTCTGTCCTGCTGTGTATGTGCTGATGCAGTGCCCTAGAAGGGGAGAGTAGAAA 4359 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2575 CTGGTTCTCTGTCCTGCTGTGTATGTGCTGATGCAGTGCCCTAGAAGGGGAGAGTAGAAA 2634 Query 4360 TTTTGACAACCTTGTTCTAAGGTGATGGGAATAAAAACAAACACCAAACTCCTGGAACAG 4419 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2635 TTTTGACAACCTTGTTCTAAGGTGATGGGAATAAAAACAAACACCAAACTCCTGGAACAG 2694 Query 4420 TTGTGCTTTCCCGTCTGCTGCCCAGGTTGTGACTTAGAACTCCGTCCTGAGTAGATGGAC 4479 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2695 TTGTGCTTTCCCGTCTGCTGCCCAGGTTGTGACTTAGAACTCCGTCCTGAGTAGATGGAC 2754 Query 4480 GAGATGCTGGGAGCCCGGAGCATCACAGCTACAGACGGCCTGGGGCACAGTGATGTACGG 4539 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2755 GAGATGCTGGGAGCCCGGAGCATCACAGCTACAGACGGCCTGGGGCACAGTGATGTACGG 2814 Query 4540 AACTCCGCATCAGCCGGCTAGCCAGATTATTTTATATAAATGTCTAATTTTGACTGG 4596 ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| Sbjct 2815 AACTCCGCATCAGCCAGCTAGCCAGATTATTTTATATAAATGTCTAATTTTGACTGG 2871 Score = 394 bits (213), Expect = 2e-105 Identities = 213/213 (100%), Gaps = 0/213 (0%) Strand=Plus/Plus Query 3570 AGTTTATAACCAGTCGTGTGAACTGGGTGGTACAGAGCTCTGCTGTAGACTACTTACATC 3629 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 496 AGTTTATAACCAGTCGTGTGAACTGGGTGGTACAGAGCTCTGCTGTAGACTACTTACATC 555 Query 3630 TCATGCTTGTGGCCATGAAGTGGCTGTTTGAGGAATTTGCCATTGATGGGCGCTTCTGCA 3689 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 556 TCATGCTTGTGGCCATGAAGTGGCTGTTTGAGGAATTTGCCATTGATGGGCGCTTCTGCA 615 Query 3690 TCAGCATCCACGACGAGGTTCGCTACCTGGTGCGTGAGGAGGACCGCTACCGTGCCGCCC 3749 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 616 TCAGCATCCACGACGAGGTTCGCTACCTGGTGCGTGAGGAGGACCGCTACCGTGCCGCCC 675 Query 3750 TGGCACTGCAGATCACCAATCTCCTGACCAGGT 3782 ||||||||||||||||||||||||||||||||| Sbjct 676 TGGCACTGCAGATCACCAATCTCCTGACCAGGT 708 Score = 311 bits (168), Expect = 2e-80 Identities = 173/175 (98%), Gaps = 1/175 (0%) Strand=Plus/Plus Query 3778 CAGGTGCATGTTTGCCTATAAGCTGGGTCTGAATGATCTGCCCCAGTCAGTCGCCTTTTT 3837 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1603 CAGGTGCATGTTTGCCTATAAGCTGGGTCTGAATGATCTGCCCCAGTCAGTCGCCTTTTT 1662 Query 3838 CAGTGCAGTAGACATTGACCAGTGCCTCAGGAAGGAAGTGACCATGGACTGTAAAACTCC 3897 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1663 CAGTGCAGTAGACATTGACCAGTGCCTCAGGAAGGAAGTGACCATGGACTGTAAAACTCC 1722 Query 3898 TTCTAACCCAACTGGGATGGAAAGGAGATATGGGATCCCCCAGGGTGAA-GCACT 3951 |||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct 1723 TTCTAACCCAACTGGGATGGAAAGGAGATATGGGATCCCCCAGGGTGAGTGCACT 1777 Score = 302 bits (163), Expect = 1e-77 Identities = 167/169 (98%), Gaps = 0/169 (0%) Strand=Plus/Plus Query 3403 GTCACGATGGAAGAAGTGGGAGGTAGCCTCTGAACGAGCATGGACAGGGGGCACAGAGTC 3462 |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| Sbjct 220 GTCACGATGGAAGAAGTGGGAGGTAGCCGCTGAACGAGCATGGACAGGGGGCACAGAGTC 279 Query 3463 AGAAATGTTTAATAAGCTGGAGAGTATTGCCATGTCTGATACACCACGTACCCCAGTACT 3522 ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| Sbjct 280 AGAAATGTTTAATAAGCTGGAGAGTATTGCCATGTCTGACACACCACGTACCCCAGTACT 339 Query 3523 GGGCTGCTGCATCAGCAGAGCCTTGGAGCCCTCAGTTGTCCAGGGAGAG 3571 ||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 340 GGGCTGCTGCATCAGCAGAGCCTTGGAGCCCTCAGTTGTCCAGGGAGAG 388 Score = 233 bits (126), Expect = 4e-57 Identities = 126/126 (100%), Gaps = 0/126 (0%) Strand=Plus/Plus Query 3279 GGTATCGGCTGTCTGCGGATGGTGAGTGGCTGGTGAAACAGTTGAATCTTCCTGTGGACA 3338 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 18 GGTATCGGCTGTCTGCGGATGGTGAGTGGCTGGTGAAACAGTTGAATCTTCCTGTGGACA 77 Query 3339 GGACAGAGGACGGCTGGGTCTCCCTACAAGATCTTCGAATGATCCGAAGAGAAGCTTCAA 3398 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 78 GGACAGAGGACGGCTGGGTCTCCCTACAAGATCTTCGAATGATCCGAAGAGAAGCTTCAA 137 Query 3399 GGAAGT 3404 |||||| Sbjct 138 GGAAGT 143 >gb|U60297.1|GGU60297 UniGene infoGene info Gallus gallus DNA polymerase gamma mRNA, nuclear gene encoding mitochondrial protein, partial cds Length=2206 Score = 977 bits (529), Expect = 0.0 Identities = 1225/1552 (78%), Gaps = 83/1552 (5%) Strand=Plus/Plus Query 2479 CAGCCAGCCCACGTAT-CACCATGGCAACGGACCTTATAATGATGTGAATATCCCTGGTT 2537 |||||||||| ||| | ||||| ||||| || || || || || || || |||||||| | Sbjct 417 CAGCCAGCCCTCGT-TCCACCACGGCAATGGCCCCTACAACGACGTCAACATCCCTGGAT 475 Query 2538 GCTGGTTTTTCAAGCTGCCTCACAAGGACGGTAACAACTACAATGTGGGCAGTCCCTTTG 2597 ||||||| ||||||||||| ||||||||||| || | |||| ||||| || ||||||| Sbjct 476 GCTGGTTCTTCAAGCTGCCCCACAAGGACGGCAATGAGAACAACGTGGGGAGCCCCTTTG 535 Query 2598 CCAAAGATTTCCTGCCCAAG-ATGGAGGATGGCACCCTGCAGGCTGGCC-CAGG-AGGTG 2654 |||| || ||||||||| | |||||||||||||| |||| ||| ||| || | Sbjct 536 CCAAGGACTTCCTGCCC-CGCATGGAGGATGGCACGCTGCGGGC-CGCCGTGGGCCGCAC 593 Query 2655 CCAGTGGG-CCTCGTGCCCTGGAAATAAATAAAATGATTTCTTTTTGGAGGAATGCTCAT 2713 ||| |||| || | |||||||| || || || ||| | || || |||||||| ||||| Sbjct 594 CCA-TGGGACC-AGAGCCCTGGAGATCAACAAGATGGTGTCCTTCTGGAGGAACGCTCAC 651 Query 2714 AAACGTATCAGTTCCCAGATGGTGGTATGGCT-CCCCA-GGTCAGCTCTGCCCCGGGTTG 2771 || || ||||||||||| |||| || ||||| | || || |||||||| | | Sbjct 652 AAGCGGGTCAGTTCCCAGGTGGTTGTGTGGCTGAAGAAGGGGGAG--CTGCCCCGTGCGG 709 Query 2772 TGACCAGGCACCCCAG-CT---TCGATGAGGAAGGCCACTATGGGGCCATCCTACCCCAG 2827 |||||||||| ||| | || ||| |||| ||| |||| ||||||||||| || ||| Sbjct 710 TGACCAGGCA-CCCGGCCTACAGCGAGGAGG-AGG--ACTACGGGGCCATCCTGCCGCAG 765 Query 2828 GTGGTGACTGCTGGCACCATCACCCGTCGAGCTGTGGAGCCCACGTGGCTCACTGCCAGT 2887 ||||||||||| || |||||||||||||| || ||||||||||||||||| || ||||| Sbjct 766 GTGGTGACTGCGGGTACCATCACCCGTCGGGCCGTGGAGCCCACGTGGCTGACAGCCAGC 825 Query 2888 AATGCTCGGCCTGACCGGGTAGGCAGTGAGTTGAAAGCCATGGTGCAGGCT-CCACCTGG 2946 ||||| ||| ||||||| || ||||| ||| |||| |||||||| |||| | || || || Sbjct 826 AATGCCCGGGCTGACCGTGTGGGCAGCGAGCTGAAGGCCATGGTCCAGG-TGCCGCCCGG 884 Query 2947 CTATGTC-CTTGTGGGTGCTGATGTGGACTCACAGGAACTGTGGATCGCAGCTGTACTTG 3005 ||| || || |||||||| ||||||||||| ||||| |||||||| || || || || | Sbjct 885 CTA-CTCTCTAGTGGGTGCAGATGTGGACTCCCAGGAGCTGTGGATAGCGGCGGTCCTGG 943 Query 3006 GAGATGCTCACTTTGCTGGGATGCATGGCTGCACGGCCTTTGGCTGGATGACTCTGC-AG 3064 | || |||||||||||||| ||||| || ||||||||||| ||||||||||| |||| || Sbjct 944 GCGAGGCTCACTTTGCTGGCATGCACGGGTGCACGGCCTTCGGCTGGATGACCCTGCAAG 1003 Query 3065 GGCAGGAAGAGCAGA-GGCACTGATCTGCACAGCAAGACAGCTGCCACTGTGGGCATCAG 3123 || | ||||||| || || || || ||||| |||||||| || ||||| ||||||||||| Sbjct 1004 GG-AAGAAGAGC-GACGGGACCGACCTGCATAGCAAGACGGCCGCCACGGTGGGCATCAG 1061 Query 3124 CCGAGAGCATGCCAAAATCTTCAACTATGGCCGCATCTATGGGGCTGGGCAGTCCTTTGC 3183 ||| ||||| ||||| |||||||||| || |||||||| |||||||||||| ||||||| Sbjct 1062 CCGGGAGCACGCCAAGGTCTTCAACTACGGGCGCATCTACGGGGCTGGGCAGCCCTTTGC 1121 Query 3184 TGAGCGCCTACTGATGCAGTTCAACCACAGGCTCACA-AGGCAGGAGGCAGC-TGAGAAG 3241 ||||| || |||||||||||||||||| |||| ||| | |||| ||||| | ||||||| Sbjct 1122 CGAGCGGCTGCTGATGCAGTTCAACCACCGGCTGACACA-GCAGCAGGCA-CGTGAGAAG 1179 Query 3242 GCCCAGCAGATGTATGCAGTCACAAAAGGCCTGCGCCGGTATCGGCTGTCTGC--GGATG 3299 || ||||||||||||||||||||||| ||| | || ||| || | || || ||| | Sbjct 1180 GCACAGCAGATGTATGCAGTCACAAAGGGCATCCGGAGGTTTC--ATCTCAGCGAGGAGG 1237 Query 3300 GTGAGTGGCTGGTGAAACAGTTGAATCTTCCTGTGGAC-AGGACAGAGGACGGCT--GG- 3355 | |||||||||||||| | || | || |||||||| | | |||| || || | || Sbjct 1238 GCGAGTGGCTGGTGAAGGAACTGGAGCTGGCTGTGGACAAAG-CAGAAGATGG-TACGGT 1295 Query 3356 GTCTCCCTACAAGATCTTC-GAATGATCCGA-AGAGAAG-CTTCAAGGAAGTCACG-ATG 3411 ||| || || ||| | | ||| ||||| | ||||||| | | || ||||| || | | Sbjct 1296 GTCGGCC--CAGGATGTGCAGAA-GATCC-AGAGAGAAGCCAT-GAGAAAGTCCCGAAGG 1350 Query 3412 --GAAGAAGTGGGAGGTAGCCTCTGAACGAGCATGGACAGGGGGCACAGAGTCAGAAATG 3469 |||||||||||| || | || | ||| ||| | || ||||| ||||| |||||| Sbjct 1351 AAGAAGAAGTGGGACGTGGTGGCTCACCGAATGTGGGCTGGAGGCACCGAGTCCGAAATG 1410 Query 3470 TTTAATAAGCTGGAGAGTATTGCCATGTCTG-ATACACCAC-GTACCCCAGTACTGGGCT 3527 || || ||||||||||| || ||| |||| | | | |||| | ||||| || ||||||| Sbjct 1411 TTCAACAAGCTGGAGAGCATCGCCCTGTCCGCCT-CGCCACAG-ACCCCGGTGCTGGGCT 1468 Query 3528 GCTGC--ATCAGCAGAGCCT-TGGAGCCCT-CAGTTGTCC--AGGGAGAGTTTATAACCA 3581 | | | |||||||| | || ||||| ||| ||| || || |||| |||||| |||||| Sbjct 1469 G-T-CATATCAGCAG-GGCTCTGGAG-CCTGCAG-TGGCCAAAGGG-GAGTTTCTAACCA 1522 Query 3582 GTC-GTGTGAACTGGGTGGTACAGAGCTCTGCTGTAGACTACTTACATCTCATGCTTGTG 3640 | | | |||||||||||||| |||||||| ||||| |||||| | || |||||||| || Sbjct 1523 G-CAGAGTGAACTGGGTGGTGCAGAGCTCGGCTGTTGACTACCTGCACCTCATGCTGGTC 1581 Query 3641 GCCATGAAGTGGCTGTTTGAGGAATTTGCCATTGATGGGCGCTTCTGCATCAGCATCCAC 3700 ||||||||||||| |||||||| | | ||| | |||||||||||||||||||||||| Sbjct 1582 TCCATGAAGTGGCTCTTTGAGGAGTACGACATAAACGGGCGCTTCTGCATCAGCATCCAC 1641 Query 3701 GACGAGGTTCGCTACCTGGTGC-GTGAGGAGGACCGCTACCGTGCCGCCCTGGCACTGCA 3759 |||||||| ||||||||||||| | ||| ||||||||||||| || || ||||| ||||| Sbjct 1642 GACGAGGTGCGCTACCTGGTGCAG-GAGCAGGACCGCTACCGGGCAGCACTGGCCCTGCA 1700 Query 3760 GATCACCAATCTCCTGAC-CAGGTGCATGTTTGCCTATAAGCTGGGTCTGAATGATCTGC 3818 ||||||||| || || || | |||||||||||||||| |||||||| || | ||||||| Sbjct 1701 GATCACCAACCTGCTCACAC-GGTGCATGTTTGCCTACAAGCTGGGCCTCCAGGATCTGC 1759 Query 3819 CCCAGTCAGTCGCCTTT-TTCAGTGCAGTAGACATTGACCAGTGCCTCAGGAAGGAAGTG 3877 | ||||| || || ||| ||||| || || |||||||||| |||| | |||||||| ||| Sbjct 1760 CGCAGTCCGTGGC-TTTCTTCAGCGCTGTGGACATTGACCGGTGCTTAAGGAAGGAGGTG 1818 Query 3878 ACCATGGACTGTAAAACTCCTTCTAACCCAACTGGGATGGA-AAGGAGATATGGGATCCC 3936 |||||| ||||| ||||| || || ||||| || ||||| ||| || || || || || Sbjct 1819 ACCATGAACTGTGCGACTCCATCAAATCCAACCGGCATGGAGAAGAAG-TACGGCATTCC 1877 Query 3937 CC-AGGGTGAAGCACTGGATATTTACCAGATAATTGAACTCACCAAAGGCTC 3987 | ||| |||||||||||||| || |||||||||||| | ||||||||||| Sbjct 1878 TCGAGGA-GAAGCACTGGATATATATCAGATAATTGAAATAACCAAAGGCTC 1928 >gb|L13786.1|CHKGH6A Gallus gallus homeobox protein (GH6) mRNA, complete cds Length=3751 Score = 913 bits (494), Expect = 0.0 Identities = 1216/1553 (78%), Gaps = 96/1553 (6%) Strand=Plus/Plus Query 2479 CAGCCAGCCCACGTATCACCATGGCAACGGACCTTATAATGATGTGAATATCCCTGGTTG 2538 |||||||||| ||| |||||| ||||| || || || | || || || ||||||| | Sbjct 438 CAGCCAGCCCTCGT-TCACCACGGCAATGGCCCCTA-CACGACGTCAA-CTCCCTGGAT- 493 Query 2539 CTGGTTTTTCAAGCTGCCTCACAAGGACGGTAACAACTACAA-TGTGGGCAGTCCCTTTG 2597 |||| || |||||||||| ||| ||||||| || | |||| || ||| || ||||||| Sbjct 494 CTGG-TTCTCAAGCTGCCCCAC-AGGACGGCAATGAGAACAACTG-GGGGAGCCCCTTTG 550 Query 2598 CCAAAGATTTCCTGCCCAAG-ATGGAGGATGGCACCCTGCAGGCTGGCC-CAGG-AGGTG 2654 |||| || ||||||||| | |||||||||||||| |||| ||| ||| || | Sbjct 551 CCAAGGACTTCCTGCCC-CGCATGGAGGATGGCACGCTGCGGGC-CGCCGTGGGCCGCAC 608 Query 2655 CCAGTGGG-CCTCGTGCCCTGGAAATAAATAAAATGATTTCTTTTTGGAGGAATGCTCAT 2713 ||| |||| || | |||||||| || || || ||| | || || |||||||| ||||| Sbjct 609 CCA-TGGGACC-AGAGCCCTGGAGATCAACAAGATGGTGTCCTTCTGGAGGAACGCTCAC 666 Query 2714 AAACGTATCAGTTCCCAGATGGTGGTATGGCT-CCCCA-GGTCAGCTCTGCCCCGGGTTG 2771 || || ||||||||||| |||| || ||||| | || || |||||||| | | Sbjct 667 AAGCGGGTCAGTTCCCAGGTGGTTGTGTGGCTGAAGAAGGGGGAG--CTGCCCCGTGCGG 724 Query 2772 TGACCAGGCACCCCAG-CT---TCGATGAGGAAGGCCACTATGGGGCCATCCTACCCCAG 2827 |||||||||| ||| | || ||| |||| ||| |||| ||||||||||| || ||| Sbjct 725 TGACCAGGCA-CCCGGCCTACAGCGAGGAGG-AGG--ACTACGGGGCCATCCTGCCGCAG 780 Query 2828 GTGGTGACTGCTGGCACCATCACCCGTCGAGCTGTGGAGCCCACGTGGCTCACTGCCAGT 2887 ||||||||||| || |||||||||||||| || ||||||||||||||||| || ||||| Sbjct 781 GTGGTGACTGCGGGTACCATCACCCGTCGGGCCGTGGAGCCCACGTGGCTGACAGCCAGC 840 Query 2888 AATGCTCGGCCTGACCGGGTAGGCAGTGAGTTGAAAGCCATGGTGCAGGCT-CCACCTGG 2946 ||||| ||| ||||||| || ||||| ||| |||| |||||||| |||| | || || || Sbjct 841 AATGCCCGGGCTGACCGTGTGGGCAGCGAGCTGAAGGCCATGGTCCAGG-TGCCGCCCGG 899 Query 2947 CTATGTCCTTGTGGGTGCTGATGTGGACTCACAGGAACTGTGGATCGCAGCTGTACTTGG 3006 ||| | || |||||||| ||||||||||| ||||| |||||||| || || || || || Sbjct 900 CTACCT-CTAGTGGGTGCAGATGTGGACTCCCAGGAGCTGTGGATAGCGGCGGTCCTGGG 958 Query 3007 AGATGCTCACTTTGCTGGGATGCATGGCTGCACGGCCTTTGGCTGGATGACTCTGCAGGG 3066 || |||||||||||||| ||||| || ||||||||||| ||||||||||| ||||| || Sbjct 959 CGAGGCTCACTTTGCTGGCATGCACGGGTGCACGGCCTTCGGCTGGATGACCCTGCAAGG 1018 Query 3067 CAGGAAGAGCAGA--GGCACTGATCTGCACAG-CAAGACAGCTGCCACTGTGGGCATCAG 3123 | ||||||| || || || || ||||| || |||||| || ||||| ||||||||||| Sbjct 1019 -AAGAAGAGC-GACTGGGACCGACCTGCATAGTCAAGACGGCCGCCACGGTGGGCATCAG 1076 Query 3124 CCGAGAGCATGCCAAAATCTTCAACTA-TGGCCGCATCTATGGGGCTGGGCAGTCCTTTG 3182 ||| ||||| ||||| |||||||||| ||| ||||||| |||||||||||| |||||| Sbjct 1077 CCGGGAGCACGCCAAGGTCTTCAACTACTGG-CGCATCT-CGGGGCTGGGCAGCCCTTTG 1134 Query 3183 CTGAGCGCCTACTGATGCAGTTCAACCACAGGCTCACA-AGGCAGGAGGCAGC-TGAGAA 3240 | ||||| || ||||||||| |||||||| |||| ||| | |||| ||||| | |||||| Sbjct 1135 CCGAGCGGCTGCTGATGCAG-TCAACCACCGGCTGACACA-GCAGCAGGCA-CGTGAGAA 1191 Query 3241 GGCCCAGCAGATGTATGCAGTCACAAAAGG-CCTGCGCCG-GTATCGGCTGTCTGC--GG 3296 ||| ||||||||||||||||||||||| || | | | | | || || | || || || Sbjct 1192 GGCACAGCAGATGTATGCAGTCACAAAGGGTCAT-C-CGGAGTTTC--ATCTCAGCGAGG 1247 Query 3297 ATGGTGAGTGGCTGGTGAAACAGTTGAATCTTCCTGTGGAC-AGGACAGAGGACGGCT-- 3353 | || |||||||||||||| | || | || |||||||| | | |||| || || | Sbjct 1248 AGGGCGAGTGGCTGGTGAAGGAACTGGAGCTGGCTGTGGACAAAG-CAGAAGATGG-TAC 1305 Query 3354 GG-GTCTCCCTACAAGATCTTC-GAATGATCCGA-AGAGAAG-CTTCAAGGAAGTCACGA 3409 || ||| || || ||| | | ||| ||||| | ||||||| | | || ||||| ||| Sbjct 1306 GGTGTCGGCC--CAGGATGTGCAGAA-GATCC-AGAGAGAAGCCAT-GAGAAAGTCCCGA 1360 Query 3410 TG--GAAGAAGTGGGAGGTAGCCTCTGAACGAGCATGGACAGGGGGCACAGAGTCAGAAA 3467 | |||||||||||| || | || | ||| ||| | || ||||| ||||| |||| Sbjct 1361 AGAAGAAGAAGTGGGACGTGGTGGCTCACCGAATGTGGGCTGGAGGCACCGAGTCCGAAA 1420 Query 3468 TGTTTAATAAGCTGGAGAGTATTGCCATGTCTG-ATACACCAC-GTACCCCAGTACTGGG 3525 |||| || ||||||||||| || ||| |||| | | | |||| | ||||| || ||||| Sbjct 1421 TGTTCAACAAGCTGGAGAGCATCGCCCTGTCCGCCT-CGCCACAG-ACCCCGGTGCTGGG 1478 Query 3526 CTGCTGCAT-CAGCAGAGCCT-TGGAGCCCT-CAGTTGTCC--AGGGAGAGTTTATAACC 3580 ||| | ||| ||||| | || ||||| ||| ||| || || |||| |||||| ||||| Sbjct 1479 CTG-T-CATATAGCAG-GGCTCTGGAG-CCTGCAG-TGGCCAAAGGG-GAGTTTCTAACC 1532 Query 3581 AGTC-GTGTGAACTGGGTGGTACAGAGCTCTGCTGTAGACTACTTACATCTCATGCTTGT 3639 || | | |||||||||||||| |||||||| ||||| |||||| | || |||||||| || Sbjct 1533 AG-CAGAGTGAACTGGGTGGTGCAGAGCTCGGCTGTTGACTACCTGCACCTCATGCTGGT 1591 Query 3640 GGCCATGAAGTGGCTGTTTGAGGAATTTGCCATTGATGGGCGCTTCTGCATCAGCATCCA 3699 ||||||||||||| |||||||| | | ||| | ||||||||||||||||||||||| Sbjct 1592 CTCCATGAAGTGGCTCTTTGAGGAGTACGACATAAACGGGCGCTTCTGCATCAGCATCCA 1651 Query 3700 CGACGAGGTTCGCTACCTGGTGC-GTGAGGAGGACCGCTACCGTGCCGCCCTGGCACTGC 3758 ||||||||| ||||||||||||| | ||| ||||||||||||| || || ||||| |||| Sbjct 1652 CGACGAGGTGCGCTACCTGGTGCAG-GAGCAGGACCGCTACCGGGCAGCACTGGC-CTGC 1709 Query 3759 AGATCACCAATCTCCTGAC-CAGGTGCATGTTTGCCTATAAGCTGGGTCTGAATGATCTG 3817 |||||||||| || || || | |||||||||||||||| |||||||| || | |||||| Sbjct 1710 AGATCACCAACCTGCTCACAC-GGTGCATGTTTGCCTACAAGCTGGGCCTCCAGGATCTG 1768 Query 3818 CCCCAGTCAGTCGCCTTT-TTCAGTGCAGTAGACATTGACCAGTGCCTCAGGAAGGAAGT 3876 || ||||| || || ||| ||||| || || |||||||||| |||| | |||||||| || Sbjct 1769 CCGCAGTCCGTGGC-TTTCTTCAGCGCTGTGGACATTGACCGGTGCTTAAGGAAGGAGGT 1827 Query 3877 GACCATGGACTGTAAAACTCCTTCTAACCCAACTGGGATGGA-AAGGAGATATGGGATCC 3935 ||||||| ||||| ||||| || || ||||| || ||||| ||| || || || || | Sbjct 1828 GACCATGAACTGTGCGACTCCATCAAATCCAACCGGCATGGAGAAGAAG-TACGGCATTC 1886 Query 3936 CCC-AGGGTGAAGCACTGGATATTTACCAGATAATTGAACTCACCAAAGGCTC 3987 | | ||| |||||||||||||| || |||||||||||| | ||||||||||| Sbjct 1887 CTCGAGGA-GAAGCACTGGATATATATCAGATAATTGAAATAACCAAAGGCTC 1938 >emb|AL110092.1|IROEST010 UniGene infoGene info Homo sapiens EST from clone 32577, 5' end Length=688 Score = 852 bits (461), Expect = 0.0 Identities = 611/686 (89%), Gaps = 6/686 (0%) Strand=Plus/Plus Query 2538 GCTGGTTTTTCAAGCTGCCTCACAAGGACGGTAACAACTACAATGTGGGCAGTCCCTTTG 2597 |||||||||| ||||||||||||||||| ||||| | || |||||||| || ||||||| Sbjct 1 GCTGGTTTTTNAAGCTGCCTCACAAGGATGGTAATAGCTGTAATGTGGGAAGCCCCTTTG 60 Query 2598 CCAAAGATTTCCTGCCCAAGATGGAGGATGGCACCCTGCAGGCTGGCCCAGGAGGTGCCA 2657 |||| || |||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 61 CCAAGGACTTCCTGCCCAAGATGGAGGATGGCACCCTGCAGGCTGGCCCAGGAGGTGCCA 120 Query 2658 GTGGGCCTCGTGCCCTGGAAATAAATAAAATGATTTCTTTTTGGAGGAATGCTCATAAAC 2717 ||||||| ||||| |||||||| || |||||||||||||| |||||||| || ||||||| Sbjct 121 GTGGGCCCCGTGCTCTGGAAATCAACAAAATGATTTCTTTCTGGAGGAACGCCCATAAAC 180 Query 2718 GTATCAGTTCCCAGATGGTGGTATGGCTCCCCAGGTCAGCTCTGCCCCGGGTTGTGACCA 2777 ||||||| |||||||||||||| ||||| |||||||||||||||||||| | ||||| || Sbjct 181 GTATCAGCTCCCAGATGGTGGTGTGGCTGCCCAGGTCAGCTCTGCCCCGTGCTGTGATCA 240 Query 2778 GGCACCCC-AGCT-TCGATGAGGAAGGCCACTATGGGGCCATCCTACCCCAGGTGGTGAC 2835 |||||||| | || | |||||||||||| ||||||||||||||| ||||| |||||||| Sbjct 241 GGCACCCCGA-CTATN-ATGAGGAAGGCCTCTATGGGGCCATCCTGCCCCAAGTGGTGAC 298 Query 2836 TGCTGGCACCATCACCCGTCGAGCTGTGGAGCCCACGTGGCTCACTGCCAGTAATGCTCG 2895 ||| ||||||||||| || || |||||||||||||| |||||||| ||||| ||||| || Sbjct 299 TGCCGGCACCATCACTCGCCGGGCTGTGGAGCCCACATGGCTCACCGCCAGCAATGCCCG 358 Query 2896 GCCTGACCGGGTAGGCAGTGAGTTGAAAGCCATGGTGCAGGCTCCACCTGGCTATGTCCT 2955 ||||||||| |||||||||||||||||||||||||||||||| ||||||||||| ||| Sbjct 359 GCCTGACCGAGTAGGCAGTGAGTTGAAAGCCATGGTGCAGGCCCCACCTGGCTACACCCT 418 Query 2956 TGTGGGTGCTGATGTGGACTCACAGGAACTGTGGATCGCAGCTGTACTTGGAGATGCTCA 3015 ||||||||||||||||||||| || || |||||||| |||||||| |||||||| || || Sbjct 419 TGTGGGTGCTGATGTGGACTCCCAAGAGCTGTGGATTGCAGCTGTGCTTGGAGACGCCCA 478 Query 3016 CTTTGCTGGGATGCATGGCTGCACG-GCCTTTGGCTGGATGACTCTGCAGGGCAGGAAGA 3074 |||||| || |||||||||||||| |||||||| |||||||| |||||||||||||||| Sbjct 479 CTTTGCCGGCATGCATGGCTGCACAAGCCTTTGGGTGGATGACACTGCAGGGCAGGAAGA 538 Query 3075 GCAGAGGCACTGATCTGCACAGCAAGACAGCTGCCACTGTGGGCATCAGCCGAGAGCATG 3134 |||| ||||||||||| ||||| |||||||| | ||||||||||||| ||| ||||||| Sbjct 539 GCAGGGGCACTGATCTACACAGTAAGACAGCCACTACTGTGGGCATCA-CCGTGAGCATG 597 Query 3135 CCAAAATCTTCAACTATGGCCGCATCTATGGGGCTGGGCAGTCCTTTGCTGAGCGCCTAC 3194 |||||||||||||||| |||||||||||| | |||||||| |||||||||| ||| ||| Sbjct 598 CCAAAATCTTCAACTACGGCCGCATCTATNGTGCTGGGCAACCCTTTGCTGAACGCTTAC 657 Query 3195 TGATGCAGTTCAACCACAGGCTCACA 3220 | |||||||| |||||| |||||||| Sbjct 658 TAATGCAGTTTAACCACCGGCTCACA 683 >dbj|AK181157.1| UniGene info Mus musculus cDNA, clone:Y0G0117C08, strand:minus, reference:ENSEMBL:Mouse-Transcript-ENST:ENSMUST00000036427, based on BLAT search Length=418 Score = 758 bits (410), Expect = 0.0 Identities = 415/418 (99%), Gaps = 0/418 (0%) Strand=Plus/Plus Query 4079 AAACTCAGGCTTTCAGATGTGCTTTTTTGCAAAAGGCAGCCATTTTTCTGTAGCAGGACC 4138 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Sbjct 1 AAACTCAGGCTTTCAAATGTGCTTTTTTGCAAAAGGCAGCCATTTTTCTGTAGCAGGACC 60 Query 4139 TGCCCAGGAAAGTCCTCCTAACGGAAGGCACAATTCAGTGCGTTCAGAACCAGGACACCA 4198 ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| Sbjct 61 TGCCCAGGAAAGTCCTCCTAACGGAAGGCACAATTCAGTGCGTTCAGAACCGGGACACCA 120 Query 4199 ACATCAGTGCAGGCTGTGTGACAAGGGGTACTGTTGGGCACAAATGAAGCAGATGCCCCA 4258 |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct 121 ACATCAGTGCAGGCTGTGTGACAAGGGGTACTGTTGGGCACAAATGAANCAGATGCCCCA 180 Query 4259 AAGGTCACATTAACTCAGGCATTTCTTCCTCCTCTTCTTGGCTGGTTCTCTGTCCTGCTG 4318 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 181 AAGGTCACATTAACTCAGGCATTTCTTCCTCCTCTTCTTGGCTGGTTCTCTGTCCTGCTG 240 Query 4319 TGTATGTGCTGATGCAGTGCCCTAGAAGGGGAGAGTAGAAATTTTGACAACCTTGTTCTA 4378 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 241 TGTATGTGCTGATGCAGTGCCCTAGAAGGGGAGAGTAGAAATTTTGACAACCTTGTTCTA 300 Query 4379 AGGTGATGGGAATAAAAACAAACACCAAACTCCTGGAACAGTTGTGCTTTCCCGTCTGCT 4438 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 301 AGGTGATGGGAATAAAAACAAACACCAAACTCCTGGAACAGTTGTGCTTTCCCGTCTGCT 360 Query 4439 GCCCAGGTTGTGACTTAGAACTCCGTCCTGAGTAGATGGACGAGATGCTGGGAGCCCG 4496 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 361 GCCCAGGTTGTGACTTAGAACTCCGTCCTGAGTAGATGGACGAGATGCTGGGAGCCCG 418 >ref|NM_145946.2| GeoGene info Mus musculus cDNA sequence BC025462 (BC025462), mRNA Length=4621 Score = 741 bits (401), Expect = 0.0 Identities = 401/401 (100%), Gaps = 0/401 (0%) Strand=Plus/Minus Query 3941 GGTGAAGCACTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACGA 4000 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4393 GGTGAAGCACTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACGA 4334 Query 4001 AGCCAGCCTGGACCCTAGCTCTGTCTGGAGGTTCTGTATTTGCTCCTGTGGAGCTTTATT 4060 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4333 AGCCAGCCTGGACCCTAGCTCTGTCTGGAGGTTCTGTATTTGCTCCTGTGGAGCTTTATT 4274 Query 4061 GGAGCGGTGCAGGTTCCTAAACTCAGGCTTTCAGATGTGCTTTTTTGCAAAAGGCAGCCA 4120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4273 GGAGCGGTGCAGGTTCCTAAACTCAGGCTTTCAGATGTGCTTTTTTGCAAAAGGCAGCCA 4214 Query 4121 TTTTTCTGTAGCAGGACCTGCCCAGGAAAGTCCTCCTAACGGAAGGCACAATTCAGTGCG 4180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4213 TTTTTCTGTAGCAGGACCTGCCCAGGAAAGTCCTCCTAACGGAAGGCACAATTCAGTGCG 4154 Query 4181 TTCAGAACCAGGACACCAACATCAGTGCAGGCTGTGTGACAAGGGGTACTGTTGGGCACA 4240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4153 TTCAGAACCAGGACACCAACATCAGTGCAGGCTGTGTGACAAGGGGTACTGTTGGGCACA 4094 Query 4241 AATGAAGCAGATGCCCCAAAGGTCACATTAACTCAGGCATTTCTTCCTCCTCTTCTTGGC 4300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4093 AATGAAGCAGATGCCCCAAAGGTCACATTAACTCAGGCATTTCTTCCTCCTCTTCTTGGC 4034 Query 4301 TGGTTCTCTGTCCTGCTGTGTATGTGCTGATGCAGTGCCCT 4341 ||||||||||||||||||||||||||||||||||||||||| Sbjct 4033 TGGTTCTCTGTCCTGCTGTGTATGTGCTGATGCAGTGCCCT 3993 >gb|BC027836.1| GeoGene info Mus musculus cDNA sequence BC025462, mRNA (cDNA clone MGC:38195 IMAGE:5322726), complete cds Length=4524 Score = 741 bits (401), Expect = 0.0 Identities = 401/401 (100%), Gaps = 0/401 (0%) Strand=Plus/Minus Query 3941 GGTGAAGCACTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACGA 4000 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4277 GGTGAAGCACTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACGA 4218 Query 4001 AGCCAGCCTGGACCCTAGCTCTGTCTGGAGGTTCTGTATTTGCTCCTGTGGAGCTTTATT 4060 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4217 AGCCAGCCTGGACCCTAGCTCTGTCTGGAGGTTCTGTATTTGCTCCTGTGGAGCTTTATT 4158 Query 4061 GGAGCGGTGCAGGTTCCTAAACTCAGGCTTTCAGATGTGCTTTTTTGCAAAAGGCAGCCA 4120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4157 GGAGCGGTGCAGGTTCCTAAACTCAGGCTTTCAGATGTGCTTTTTTGCAAAAGGCAGCCA 4098 Query 4121 TTTTTCTGTAGCAGGACCTGCCCAGGAAAGTCCTCCTAACGGAAGGCACAATTCAGTGCG 4180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4097 TTTTTCTGTAGCAGGACCTGCCCAGGAAAGTCCTCCTAACGGAAGGCACAATTCAGTGCG 4038 Query 4181 TTCAGAACCAGGACACCAACATCAGTGCAGGCTGTGTGACAAGGGGTACTGTTGGGCACA 4240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4037 TTCAGAACCAGGACACCAACATCAGTGCAGGCTGTGTGACAAGGGGTACTGTTGGGCACA 3978 Query 4241 AATGAAGCAGATGCCCCAAAGGTCACATTAACTCAGGCATTTCTTCCTCCTCTTCTTGGC 4300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3977 AATGAAGCAGATGCCCCAAAGGTCACATTAACTCAGGCATTTCTTCCTCCTCTTCTTGGC 3918 Query 4301 TGGTTCTCTGTCCTGCTGTGTATGTGCTGATGCAGTGCCCT 4341 ||||||||||||||||||||||||||||||||||||||||| Sbjct 3917 TGGTTCTCTGTCCTGCTGTGTATGTGCTGATGCAGTGCCCT 3877 >dbj|AK219254.1| UniGene infoGene info Mus musculus cDNA, clone:Y2G0147O06, strand:minus, reference:ENSEMBL:Mouse-Transcript-ENST:ENSMUST00000036427, based on BLAT search Length=400 Score = 725 bits (392), Expect = 0.0 Identities = 396/398 (99%), Gaps = 0/398 (0%) Strand=Plus/Plus Query 1283 CAGTCCACAAAGCGAGGGCAGAAGTCCCCGAGGAAAGCCAATGGTCCAGCGATCTCATCT 1342 |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| Sbjct 3 CAGTCCACAAAGCGAGGGCAGAAGTCTCCGAGGAAAGCCAATGGTCCAGCGATCTCATCT 62 Query 1343 TGGGACTGGATGGATATCAGCAGTGCCAATAATCTTGCAGATGTGCACAACCTTTATGTG 1402 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 63 TGGGACTGGATGGATATCAGCAGTGCCAATAATCTTGCAGATGTGCACAACCTTTATGTG 122 Query 1403 GGGGGACCTCCCTTAGAGAAGGAGCCTCGGGAGCTGTTCGTCAAAGGCAGCATGAGGGAT 1462 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 123 GGGGGACCTCCCTTAGAGAAGGAGCCTCGGGAGCTGTTCGTCAAAGGCAGCATGAGGGAT 182 Query 1463 ATCCGAGAGAACTTCCAGGATCTGATGCAGTACTGCGCCCGTGATGTGTGGGCCACCTTT 1522 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 183 ATCCGAGAGAACTTCCAGGATCTGATGCAGTACTGCGCCCGTGATGTGTGGGCCACCTTT 242 Query 1523 GAGGTTTTCCAGCAGCAGCTGCCACTCTTCTTGGAGAGGTGTCCCCACCCAGTGACTCTG 1582 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 243 GAGGTTTTCCAGCAGCAGCTGCCACTCTTCTTGGAGAGGTGTCCCCACCCAGTGACTCTG 302 Query 1583 GCTGGCATGCTGGAGATGGGTGTGTCCTACCTGCCTGTCAACCAGAACTGGGAGCGTTAC 1642 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 303 GCTGGCATGCTGGAGATGGGTGTGTCCTACCTGCCTGTCAACCAGAACTGGGAGCGTTAC 362 Query 1643 CTGACAGAGGCACAGAACACATATGAGGAGCTCCAGCG 1680 |||||||||| ||||||||||||||||||||||||||| Sbjct 363 CTGACAGAGGTACAGAACACATATGAGGAGCTCCAGCG 400 >dbj|AK215702.1| UniGene infoGene info Mus musculus cDNA, clone:Y2G0135O10, strand:plus, reference:ENSEMBL:Mouse-Transcript-ENST:ENSMUST00000036427, based on BLAT search Length=356 Score = 647 bits (350), Expect = 0.0 Identities = 354/356 (99%), Gaps = 0/356 (0%) Strand=Plus/Plus Query 3155 CGCATCTATGGGGCTGGGCAGTCCTTTGCTGAGCGCCTACTGATGCAGTTCAACCACAGG 3214 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1 CGCATCTATGGGGCTGGGCAGTCCTTTGCTGAGCGCCTACTGATGCAGTTCAACCACAGG 60 Query 3215 CTCACAAGGCAGGAGGCAGCTGAGAAGGCCCAGCAGATGTATGCAGTCACAAAAGGCCTG 3274 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 61 CTCACAAGGCAGGAGGCAGCTGAGAAGGCCCAGCAGATGTATGCAGTCACAAAAGGCCTG 120 Query 3275 CGCCGGTATCGGCTGTCTGCGGATGGTGAGTGGCTGGTGAAACAGTTGAATCTTCCTGTG 3334 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 121 CGCCGGTATCGGCTGTCTGCGGATGGTGAGTGGCTGGTGAAACAGTTGAATCTTCCTGTG 180 Query 3335 GACAGGACAGAGGACGGCTGGGTCTCCCTACAAGATCTTCGAATGATCCGAAGAGAAGCT 3394 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 181 GACAGGACAGAGGACGGCTGGGTCTCCCTACAAGATCTTCGAATGATCCGAAGAGAAGCT 240 Query 3395 TCAAGGAAGTCACGATGGAAGAAGTGGGAGGTAGCCTCTGAACGAGCATGGACAGGGGGC 3454 ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| Sbjct 241 TCAAGGAAGTCACGATGGAAGAAGTGGGAGGTACCCTCTGAACGAGCATGGACAGGGGGC 300 Query 3455 ACAGAGTCAGAAATGTTTAATAAGCTGGAGAGTATTGCCATGTCTGATACACCACG 3510 ||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Sbjct 301 ACAGAGTCAGAAAGGTTTAATAAGCTGGAGAGTATTGCCATGTCTGATACACCACG 356 >gb|AC124068.6| Download subject sequence spanning the HSP Homo sapiens chromosome 15, clone RP11-217B1, complete sequence Length=172505 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 601 bits (325), Expect = 9e-168 Identities = 438/492 (89%), Gaps = 10/492 (2%) Strand=Plus/Minus Query 489 CGCAAATGCCCTCCTCCGAGAATGGGCAGCTGCGGCTCAACCC-TCTGCTCATCCAGATG 547 ||||| ||| ||||| ||| ||||||||||||| |||||| | || |||||||||| Sbjct 167158 CGCAAGTGCTATCCTCGGAGGGCGGGCAGCTGCGGCACAACCCAT-TGGACATCCAGATG 167100 Query 548 TTGTCGAGAGGCCTGCACGAGCAGATCTTCGGGTGCGGCGGGGAAATGCCCGACGAGGCC 607 | |||||||| ||||||||||| ||||||||| || ||||| ||||| | ||||||| Sbjct 167099 CTCTCGAGAGGGCTGCACGAGCAAATCTTCGGGCAAGGAGGGGAGATGCCTGGCGAGGCC 167040 Query 608 GCGGTGCAG-CGCAGCGTAGAGCACCTGCAGAAGCACGGGCTCTGGGGGCAGCCGGCCAC 666 ||||||| | |||||||| ||||||||||||||||||||||||||||||||||| ||| Sbjct 167039 GCGGTGC-GCCGCAGCGTCGAGCACCTGCAGAAGCACGGGCTCTGGGGGCAGCCAGCCGT 166981 Query 667 GCCCTTGCCAGACGTGGAGCTGCGCCTGCC-CCGGCTCTTCGGGGGCAACCTGGACCAGC 725 ||||||||| |||||||||||||||||||| || |||| ||||| |||||||||||||| Sbjct 166980 GCCCTTGCCCGACGTGGAGCTGCGCCTGCCGCC-CCTCTACGGGGACAACCTGGACCAGC 166922 Query 726 ACTTCCGCCTCCTGGCCCAGAAGCAGAGCCTGCCTTACTTGGAGGCGGCCGCCTCGTTAT 785 |||||||||||||||||||||||||||||||||| ||| ||||||||||| || | | | Sbjct 166921 ACTTCCGCCTCCTGGCCCAGAAGCAGAGCCTGCCCTACCTGGAGGCGGCCAACTTGCTGT 166862 Query 786 TGGAGGCCCAATTGCCCCCCG-AGCCCAAGAGC-TGGGCCTGGGCGGAGGGCTGGACCCG 843 || ||||||| || |||||| ||||| | || |||||||||||||||||||||||||| Sbjct 166861 TGCAGGCCCAGCTG-CCCCCGAAGCCCCCG-GCTTGGGCCTGGGCGGAGGGCTGGACCCG 166804 Query 844 GTACGGCCCCGAGGGGGAGGCCGAACCCGTGGCCATCCCCGAGGAGCGGGCCCTGGTGTT 903 ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| Sbjct 166803 GTACGGCCCCGAGGGGGAGGCCGTACCCGTGGCCATCCCCGAGGAGCGGGCCCTGGTGTT 166744 Query 904 CGACGTGGAGGTCTGCTTGGCAGAGGGAACCTGCCCCACTTTGGCGGTGGCCATATCCCC 963 |||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| Sbjct 166743 CGACGTGGAGGTCTGCTTGGCAGAGGGAACTTGCCCCACATTGGCGGTGGCCATATCCCC 166684 Query 964 CTCGGCCTGGTA 975 |||||||||||| Sbjct 166683 CTCGGCCTGGTA 166672 Score = 318 bits (172), Expect = 1e-82 Identities = 225/251 (89%), Gaps = 2/251 (0%) Strand=Plus/Minus Query 3032 GGCTGCACGGCCTTTGGCTGGATGACTCTGCAGGGCAGGAAGAGCAGAGGCACTGATCTG 3091 |||||||| |||||||| |||||||| |||||||||||||||||||| ||||||||||| Sbjct 154592 GGCTGCACAGCCTTTGGGTGGATGACACTGCAGGGCAGGAAGAGCAGGGGCACTGATCTA 154533 Query 3092 CACAGCAAGACAGCTGCCACTGTGGGCATCAGCCGAGAGCATGCCAAAATCTTCAACTAT 3151 ||||| |||||||| | ||||||||||||||||| ||||||||||||||||||||||| Sbjct 154532 CACAGTAAGACAGCCACTACTGTGGGCATCAGCCGTGAGCATGCCAAAATCTTCAACTAC 154473 Query 3152 GGCCGCATCTATGGGGCTGGGCAGTCCTTTGCTGAGCGCCTACTGATGCAGTTCAACCAC 3211 |||||||||||||| ||||||||| |||||||||||||| |||| |||||||| |||||| Sbjct 154472 GGCCGCATCTATGGTGCTGGGCAGCCCTTTGCTGAGCGCTTACTAATGCAGTTTAACCAC 154413 Query 3212 AGGCTCACA-AGGCAGGAGGCAGCTGAGAAGGCCCAGCAGATGTATGCAGTCACAAAAGG 3270 |||||||| | ||||||||||||||||||||||||||||||||| || | ||| || || Sbjct 154412 CGGCTCACACA-GCAGGAGGCAGCTGAGAAGGCCCAGCAGATGTACGCTGCCACCAAGGG 154354 Query 3271 CCTGCGCCGGT 3281 ||| ||| ||| Sbjct 154353 CCTCCGCTGGT 154343 Score = 316 bits (171), Expect = 4e-82 Identities = 364/449 (81%), Gaps = 45/449 (10%) Strand=Plus/Minus Query 3941 GGTGAAGCACTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACGA 4000 |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 150407 GGTGAAGCGCTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACGA 150348 Query 4001 AGCCAGCCTGGACCCTAGCTCTGTCTGGAGGTTCTGTATTTGCTCCTGTGGAGCTTTATT 4060 |||||||||||||| |||| ||| ||||||| |||||||||||||| ||||||||| || Sbjct 150347 AGCCAGCCTGGACCATAGCACTGCCTGGAGGCTCTGTATTTGCTCCCGTGGAGCTTCATC 150288 Query 4061 GGAGCGGTGCAGGTTCCTAAACTCAGGCTTTCAGATGTGCTTTTTTGCAAAAGG-C---- 4115 || | |||||||| ||| |||||||||||||||| |||||||||| |||||||| | Sbjct 150287 GGGGTGGTGCAGGCTCCCAAACTCAGGCTTTCAGCTGTGCTTTTT-GCAAAAGGGCTTGC 150229 Query 4116 --A-G-CCA----TTTTTCTGTAGCAGGACCTGCCCAGGAA-AGTCCTCCTAACGGAAGG 4166 | | ||| |||||| ||||||||||||||| || || | |||| ||||| ||||| Sbjct 150228 CTAAGGCCAGCCATTTTTCAGTAGCAGGACCTGCCAAG-AAGATTCCTTCTAACTGAAGG 150170 Query 4167 --CAC---AATTCAGTGCGTTCAGAACCAGGACACCAACATCAGTGCAGG-CTGT-GTGA 4219 || ||||||||| ||||||||||| || |||||||| ||| || || | || Sbjct 150169 TGCAGTTGAATTCAGTGGGTTCAGAACCAAGATGCCAACATCGGTGT-GGACTACAG-GA 150112 Query 4220 CAAGGGGTA------CT-GTTGGGCACAAATGAAGCAGATGCCCCAAAGGTCACATTAAC 4272 ||||||| | || |||||| | |||||||||||| ||||||||| |||||||||| Sbjct 150111 CAAGGGGCATTGTTGCTTGTTGGGTAAAAATGAAGCAGAAGCCCCAAAGTTCACATTAAC 150052 Query 4273 TCAGGCATTTC-TTCCT-----CCT---CTTCTTGGCTGGTTCTCTGTCCTG-CTGTGTA 4322 ||||||||||| || | ||| |||||||||||||||| ||| ||| | | Sbjct 150051 TCAGGCATTTCATTTATTTTTTCCTTTTCTTCTTGGCTGGTTCTTTGTTCTGTCCCCC-A 149993 Query 4323 TG-TGCTGATGCAGTGCCCTAGAAGGGGA 4350 || | |||||||||||||||||||||||| Sbjct 149992 TGCT-CTGATGCAGTGCCCTAGAAGGGGA 149965 Score = 305 bits (165), Expect = 8e-79 Identities = 198/214 (92%), Gaps = 2/214 (0%) Strand=Plus/Minus Query 3570 AGTTTATAACCAGTCGTGTGAACTGGGTGGTACAGAGCTCTGCTGTAGACTACTTACATC 3629 ||||||| ||||| |||||||| ||||||||||||||||||||||| ||||||||||| | Sbjct 152330 AGTTTATGACCAGCCGTGTGAATTGGGTGGTACAGAGCTCTGCTGTTGACTACTTACACC 152271 Query 3630 TCATGCTTGTGGCCATGAAGTGGCTGTTTGAGGAATTTGCCATTGATGGGCGCTTCTGCA 3689 ||||||||||||||||||||||||||||||| || |||||||| |||||||||||||||| Sbjct 152270 TCATGCTTGTGGCCATGAAGTGGCTGTTTGAAGAGTTTGCCATAGATGGGCGCTTCTGCA 152211 Query 3690 TCAGCATCCACGACGAGGTTCGCTACCTGGTGCGTGAGGAGGACCGCTACCGTGCCGCCC 3749 |||||||||| ||||||||||||||||||||||| ||||||||||||||||| || |||| Sbjct 152210 TCAGCATCCATGACGAGGTTCGCTACCTGGTGCGGGAGGAGGACCGCTACCGCGCTGCCC 152151 Query 3750 TGGCACT-GCAGATCACCAATCTCCTGACCAGGT 3782 |||| || |||||||||||| ||| ||||||||| Sbjct 152150 TGGC-CTTGCAGATCACCAACCTCTTGACCAGGT 152118 Score = 292 bits (158), Expect = 6e-75 Identities = 178/188 (94%), Gaps = 0/188 (0%) Strand=Plus/Minus Query 1559 AGGTGTCCCCACCCAGTGACTCTGGCTGGCATGCTGGAGATGGGTGTGTCCTACCTGCCT 1618 |||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||| Sbjct 160930 AGGTGTCCCCACCCAGTGACTCTGGCCGGCATGCTGGAGATGGGTGTCTCCTACCTGCCT 160871 Query 1619 GTCAACCAGAACTGGGAGCGTTACCTGACAGAGGCACAGAACACATATGAGGAGCTCCAG 1678 ||||||||||||||||||||||||||| ||||||||||| ||| ||||||||||||||| Sbjct 160870 GTCAACCAGAACTGGGAGCGTTACCTGGCAGAGGCACAGGGCACTTATGAGGAGCTCCAG 160811 Query 1679 CGGGAGATGAAGAAGTCGCTGATGGATCTGGCTAATGATGCCTGTCAGTTGCTCTCAGGA 1738 |||||||||||||||||| ||||||||||||| ||||||||||| ||| ||||||||||| Sbjct 160810 CGGGAGATGAAGAAGTCGTTGATGGATCTGGCCAATGATGCCTGCCAGCTGCTCTCAGGA 160751 Query 1739 GAGAGGTA 1746 |||||||| Sbjct 160750 GAGAGGTA 160743 Score = 261 bits (141), Expect = 2e-65 Identities = 238/283 (84%), Gaps = 13/283 (4%) Strand=Plus/Minus Query 203 AGGACTTGTGTGAGGAAGGCAGGCATGGTGAGACCTATTTCACTGACAGGAGCA-CAGAG 261 |||| ||| | | |||||||||||||||| | ||| |||||||||||||||| | ||||| Sbjct 167494 AGGATTTG-GGGTGGAAGGCAGGCATGGTCAAACCCATTTCACTGACAGGAG-AGCAGAG 167437 Query 262 AGGGGACGCGTCTCTCTCTGA-GTCTTTCGGCCACTAAAAGCAGTCAAGCTGGAGCCCAA 320 | ||||| ||||||||| | ||||| | |||| |||||| || ||||||||||||||| Sbjct 167436 ACAGGACGTGTCTCTCTC-CACGTCTTCCAGCCAGTAAAAGAAGCCAAGCTGGAGCCCAA 167378 Query 321 AGCCCGGTGCCCCGACTCACAGCG-GGGGGCTCCCTGCACCAACCATGAGCCGCCTGCTC 379 |||| |||| | ||||| ||||| ||||| ||||||||||||||||||||||||||||| Sbjct 167377 AGCCAGGTGTTCTGACTCCCAGCGTGGGGG-TCCCTGCACCAACCATGAGCCGCCTGCTC 167319 Query 380 TGGAAGAAGGTGGCTGGCGCCAAGGTCGC-CTCAGGGCCAGTACCAGCAACCGCG-CGCT 437 |||| ||||||||| ||||||| |||| | ||||||| || ||||| ||| | |||| Sbjct 167318 TGGAGGAAGGTGGCCGGCGCCACCGTCGGGC-CAGGGCCGGTTCCAGCT-CCGGGGCGCT 167261 Query 438 GGGTCTCCAGCTCCGTCCTCGACC-CCGTCCCCAGCGACGGGC 479 |||||||||||||||||| || | ||| |||||||||||||| Sbjct 167260 GGGTCTCCAGCTCCGTCCCCG-CGTCCGACCCCAGCGACGGGC 167219 Score = 252 bits (136), Expect = 1e-62 Identities = 162/174 (93%), Gaps = 3/174 (1%) Strand=Plus/Minus Query 3778 CAGGTGCATGTTTGCCTATAAGCTGGGTCTGAATGATC-TGCCCCAGTCAGTCGCCTTTT 3836 |||||||||||||||||| ||||||||||||||||| | ||||||||||||||||||||| Sbjct 151118 CAGGTGCATGTTTGCCTACAAGCTGGGTCTGAATGA-CTTGCCCCAGTCAGTCGCCTTTT 151060 Query 3837 TCAGTGCAGTAGACATTGACCAGTGCCTCAGGAAGGAAGTGACCATGGACTGTAAAACTC 3896 |||||||||| || ||||||| ||||||||||||||||||||||||||| |||||||| | Sbjct 151059 TCAGTGCAGTCGATATTGACCGGTGCCTCAGGAAGGAAGTGACCATGGATTGTAAAACCC 151000 Query 3897 CTTCTAACCCAACTGGGATGGAAAGGAGATATGGGATCCCCCAGGGTGAAGCAC 3950 |||| |||||||||||||||||||||||||| ||||| ||||||||||| |||| Sbjct 150999 CTTCCAACCCAACTGGGATGGAAAGGAGATACGGGATTCCCCAGGGTGA-GCAC 150947 Score = 250 bits (135), Expect = 4e-62 Identities = 180/201 (89%), Gaps = 6/201 (2%) Strand=Plus/Minus Query 972 GGTATTCCTGGTGCAGCCGGCGGCTGGTGGAAGAGCGTTACTCTTGGACCAGCCAGCTAT 1031 |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| | Sbjct 163856 GGTATTCCTGGTGCAGCCAGCGGCTGGTGGAAGAGCGTTACTCTTGGACCAGCCAGCTGT 163797 Query 1032 CGCCGGCTGACCTAATCCCTTTGGGGGGCTCC-ACTAGTGCCAGCAGCTCCACCAAGCAG 1090 ||||||||||||| ||||| ||| || | || ||| ||||||||||| ||||| || || Sbjct 163796 CGCCGGCTGACCTCATCCCCCTGGAGGTC-CCTACTGGTGCCAGCAGCCCCACCCAG-AG 163739 Query 1091 -GA-TGGGCAGGAACAGTTAGTGGTGGGGCACAATGTTTCCTTTGACCGAGCCCATATCA 1148 || | ||||||| |||||||||||||||||||||||||||||||||||||| ||||||| Sbjct 163738 AGACT-GGCAGGAGCAGTTAGTGGTGGGGCACAATGTTTCCTTTGACCGAGCTCATATCA 163680 Query 1149 GGGAACAGTATCTGATTCAGG 1169 |||| ||||| ||||| |||| Sbjct 163679 GGGAGCAGTACCTGATCCAGG 163659 Score = 213 bits (115), Expect = 5e-51 Identities = 147/163 (90%), Gaps = 0/163 (0%) Strand=Plus/Minus Query 2562 AGGACGGTAACAACTACAATGTGGGCAGTCCCTTTGCCAAAGATTTCCTGCCCAAGATGG 2621 |||| ||||| | || |||||||| || ||||||||||| || |||||||||||||||| Sbjct 156483 AGGATGGTAATAGCTGTAATGTGGGAAGCCCCTTTGCCAAGGACTTCCTGCCCAAGATGG 156424 Query 2622 AGGATGGCACCCTGCAGGCTGGCCCAGGAGGTGCCAGTGGGCCTCGTGCCCTGGAAATAA 2681 ||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| | Sbjct 156423 AGGATGGCACCCTGCAGGCTGGCCCAGGAGGTGCCAGTGGGCCCCGTGCTCTGGAAATCA 156364 Query 2682 ATAAAATGATTTCTTTTTGGAGGAATGCTCATAAACGTATCAG 2724 | |||||||||||||| |||||||| || |||||||||||||| Sbjct 156363 ACAAAATGATTTCTTTCTGGAGGAACGCCCATAAACGTATCAG 156321 Score = 178 bits (96), Expect = 2e-40 Identities = 124/138 (89%), Gaps = 0/138 (0%) Strand=Plus/Minus Query 2896 GCCTGACCGGGTAGGCAGTGAGTTGAAAGCCATGGTGCAGGCTCCACCTGGCTATGTCCT 2955 ||||||||| |||||||||||||||||||||||||||||||| ||||||||||| ||| Sbjct 154840 GCCTGACCGAGTAGGCAGTGAGTTGAAAGCCATGGTGCAGGCCCCACCTGGCTACACCCT 154781 Query 2956 TGTGGGTGCTGATGTGGACTCACAGGAACTGTGGATCGCAGCTGTACTTGGAGATGCTCA 3015 ||||||||||||||||||||| || || |||||||| |||||||| |||||||| || || Sbjct 154780 TGTGGGTGCTGATGTGGACTCCCAAGAGCTGTGGATTGCAGCTGTGCTTGGAGACGCCCA 154721 Query 3016 CTTTGCTGGGATGCATGG 3033 |||||| || |||||||| Sbjct 154720 CTTTGCCGGCATGCATGG 154703 Score = 106 bits (57), Expect = 9e-19 Identities = 86/100 (86%), Gaps = 2/100 (2%) Strand=Plus/Minus Query 2466 GTGCCCCCAAATCCAGCCAGCCCACG-TATCACCATGGCAACGGACCTTATAATGATGTG 2524 ||| |||||| || |||||||| | |||||||||||||| |||||||| || || ||| Sbjct 157080 GTGGCCCCAAGGACACCCAGCCCA-GCTATCACCATGGCAATGGACCTTACAACGACGTG 157022 Query 2525 AATATCCCTGGTTGCTGGTTTTTCAAGCTGCCTCACAAGG 2564 | |||||||| |||||||||||||||||||||||||||| Sbjct 157021 GACATCCCTGGCTGCTGGTTTTTCAAGCTGCCTCACAAGG 156982 >gb|AF497906.1| Download subject sequence spanning the HSP Homo sapiens polymerase (DNA directed), gamma (POLG) gene, complete cds Length=21304 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 601 bits (325), Expect = 9e-168 Identities = 438/492 (89%), Gaps = 10/492 (2%) Strand=Plus/Plus Query 489 CGCAAATGCCCTCCTCCGAGAATGGGCAGCTGCGGCTCAACCC-TCTGCTCATCCAGATG 547 ||||| ||| ||||| ||| ||||||||||||| |||||| | || |||||||||| Sbjct 2590 CGCAAGTGCTATCCTCGGAGGGCGGGCAGCTGCGGCACAACCCAT-TGGACATCCAGATG 2648 Query 548 TTGTCGAGAGGCCTGCACGAGCAGATCTTCGGGTGCGGCGGGGAAATGCCCGACGAGGCC 607 | |||||||| ||||||||||| ||||||||| || ||||| ||||| | ||||||| Sbjct 2649 CTCTCGAGAGGGCTGCACGAGCAAATCTTCGGGCAAGGAGGGGAGATGCCTGGCGAGGCC 2708 Query 608 GCGGTGCAG-CGCAGCGTAGAGCACCTGCAGAAGCACGGGCTCTGGGGGCAGCCGGCCAC 666 ||||||| | |||||||| ||||||||||||||||||||||||||||||||||| ||| Sbjct 2709 GCGGTGC-GCCGCAGCGTCGAGCACCTGCAGAAGCACGGGCTCTGGGGGCAGCCAGCCGT 2767 Query 667 GCCCTTGCCAGACGTGGAGCTGCGCCTGCC-CCGGCTCTTCGGGGGCAACCTGGACCAGC 725 ||||||||| |||||||||||||||||||| || |||| ||||| |||||||||||||| Sbjct 2768 GCCCTTGCCCGACGTGGAGCTGCGCCTGCCGCCC-CTCTACGGGGACAACCTGGACCAGC 2826 Query 726 ACTTCCGCCTCCTGGCCCAGAAGCAGAGCCTGCCTTACTTGGAGGCGGCCGCCTCGTTAT 785 |||||||||||||||||||||||||||||||||| ||| ||||||||||| || | | | Sbjct 2827 ACTTCCGCCTCCTGGCCCAGAAGCAGAGCCTGCCCTACCTGGAGGCGGCCAACTTGCTGT 2886 Query 786 TGGAGGCCCAATTGCCCCCCGA-GCCCAAGAGCT-GGGCCTGGGCGGAGGGCTGGACCCG 843 || ||||||| ||||||| || |||| | ||| ||||||||||||||||||||||||| Sbjct 2887 TGCAGGCCCAGCTGCCCCC-GAAGCCCCCG-GCTTGGGCCTGGGCGGAGGGCTGGACCCG 2944 Query 844 GTACGGCCCCGAGGGGGAGGCCGAACCCGTGGCCATCCCCGAGGAGCGGGCCCTGGTGTT 903 ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| Sbjct 2945 GTACGGCCCCGAGGGGGAGGCCGTACCCGTGGCCATCCCCGAGGAGCGGGCCCTGGTGTT 3004 Query 904 CGACGTGGAGGTCTGCTTGGCAGAGGGAACCTGCCCCACTTTGGCGGTGGCCATATCCCC 963 |||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| Sbjct 3005 CGACGTGGAGGTCTGCTTGGCAGAGGGAACTTGCCCCACATTGGCGGTGGCCATATCCCC 3064 Query 964 CTCGGCCTGGTA 975 |||||||||||| Sbjct 3065 CTCGGCCTGGTA 3076 Score = 318 bits (172), Expect = 1e-82 Identities = 225/251 (89%), Gaps = 2/251 (0%) Strand=Plus/Plus Query 3032 GGCTGCACGGCCTTTGGCTGGATGACTCTGCAGGGCAGGAAGAGCAGAGGCACTGATCTG 3091 |||||||| |||||||| |||||||| |||||||||||||||||||| ||||||||||| Sbjct 16352 GGCTGCACAGCCTTTGGGTGGATGACACTGCAGGGCAGGAAGAGCAGGGGCACTGATCTA 16411 Query 3092 CACAGCAAGACAGCTGCCACTGTGGGCATCAGCCGAGAGCATGCCAAAATCTTCAACTAT 3151 ||||| |||||||| | ||||||||||||||||| ||||||||||||||||||||||| Sbjct 16412 CACAGTAAGACAGCCACTACTGTGGGCATCAGCCGTGAGCATGCCAAAATCTTCAACTAC 16471 Query 3152 GGCCGCATCTATGGGGCTGGGCAGTCCTTTGCTGAGCGCCTACTGATGCAGTTCAACCAC 3211 |||||||||||||| ||||||||| |||||||||||||| |||| |||||||| |||||| Sbjct 16472 GGCCGCATCTATGGTGCTGGGCAGCCCTTTGCTGAGCGCTTACTAATGCAGTTTAACCAC 16531 Query 3212 AGGCTCACA-AGGCAGGAGGCAGCTGAGAAGGCCCAGCAGATGTATGCAGTCACAAAAGG 3270 |||||||| | ||||||||||||||||||||||||||||||||| || | ||| || || Sbjct 16532 CGGCTCACACA-GCAGGAGGCAGCTGAGAAGGCCCAGCAGATGTACGCTGCCACCAAGGG 16590 Query 3271 CCTGCGCCGGT 3281 ||| ||| ||| Sbjct 16591 CCTCCGCTGGT 16601 Score = 313 bits (169), Expect = 5e-81 Identities = 364/450 (80%), Gaps = 46/450 (10%) Strand=Plus/Plus Query 3941 GGTGAAGCACTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACGA 4000 |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 20539 GGTGAAGCGCTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACGA 20598 Query 4001 AGCCAGCCTGGACCCTAGCTCTGTCTGGAGGTTCTGTATTTGCTCCTGTGGAGCTTTATT 4060 |||||||||||||| |||| ||| ||||||| |||||||||||||| ||||||||| || Sbjct 20599 AGCCAGCCTGGACCATAGCACTGCCTGGAGGCTCTGTATTTGCTCCCGTGGAGCTTCATC 20658 Query 4061 GGAGCGG-TGCAGGTTCCTAAACTCAGGCTTTCAGATGTGCTTTTTTGCAAAAGG-C--- 4115 || | || |||||| ||| |||||||||||||||| |||||||||| |||||||| | Sbjct 20659 GGGGTGGGTGCAGGCTCCCAAACTCAGGCTTTCAGCTGTGCTTTTT-GCAAAAGGGCTTG 20717 Query 4116 ---A-G-CCA----TTTTTCTGTAGCAGGACCTGCCCAGGAA-AGTCCTCCTAACGGAAG 4165 | | ||| |||||| ||||||||||||||| || || | |||| ||||| |||| Sbjct 20718 CCTAAGGCCAGCCATTTTTCAGTAGCAGGACCTGCCAAG-AAGATTCCTTCTAACTGAAG 20776 Query 4166 G--CAC---AATTCAGTGCGTTCAGAACCAGGACACCAACATCAGTGCAGG-CTGT-GTG 4218 | || ||||||||| ||||||||||| || |||||||| ||| || || | | Sbjct 20777 GTGCAGTTGAATTCAGTGGGTTCAGAACCAAGATGCCAACATCGGTGT-GGACTACAG-G 20834 Query 4219 ACAAGGGGTA------CT-GTTGGGCACAAATGAAGCAGATGCCCCAAAGGTCACATTAA 4271 |||||||| | || |||||| | |||||||||||| ||||||||| ||||||||| Sbjct 20835 ACAAGGGGCATTGTTGCTTGTTGGGTAAAAATGAAGCAGAAGCCCCAAAGTTCACATTAA 20894 Query 4272 CTCAGGCATTTC-TTCCT-----CCT---CTTCTTGGCTGGTTCTCTGTCCTG-CTGTGT 4321 |||||||||||| || | ||| |||||||||||||||| ||| ||| | Sbjct 20895 CTCAGGCATTTCATTTATTTTTTCCTTTTCTTCTTGGCTGGTTCTTTGTTCTGTCCCCC- 20953 Query 4322 ATG-TGCTGATGCAGTGCCCTAGAAGGGGA 4350 ||| | |||||||||||||||||||||||| Sbjct 20954 ATGCT-CTGATGCAGTGCCCTAGAAGGGGA 20982 Score = 305 bits (165), Expect = 8e-79 Identities = 198/214 (92%), Gaps = 2/214 (0%) Strand=Plus/Plus Query 3570 AGTTTATAACCAGTCGTGTGAACTGGGTGGTACAGAGCTCTGCTGTAGACTACTTACATC 3629 ||||||| ||||| |||||||| ||||||||||||||||||||||| ||||||||||| | Sbjct 18614 AGTTTATGACCAGCCGTGTGAATTGGGTGGTACAGAGCTCTGCTGTTGACTACTTACACC 18673 Query 3630 TCATGCTTGTGGCCATGAAGTGGCTGTTTGAGGAATTTGCCATTGATGGGCGCTTCTGCA 3689 ||||||||||||||||||||||||||||||| || |||||||| |||||||||||||||| Sbjct 18674 TCATGCTTGTGGCCATGAAGTGGCTGTTTGAAGAGTTTGCCATAGATGGGCGCTTCTGCA 18733 Query 3690 TCAGCATCCACGACGAGGTTCGCTACCTGGTGCGTGAGGAGGACCGCTACCGTGCCGCCC 3749 |||||||||| ||||||||||||||||||||||| ||||||||||||||||| || |||| Sbjct 18734 TCAGCATCCATGACGAGGTTCGCTACCTGGTGCGGGAGGAGGACCGCTACCGCGCTGCCC 18793 Query 3750 TGGCACT-GCAGATCACCAATCTCCTGACCAGGT 3782 |||| || |||||||||||| ||| ||||||||| Sbjct 18794 TGGC-CTTGCAGATCACCAACCTCTTGACCAGGT 18826 Score = 292 bits (158), Expect = 6e-75 Identities = 178/188 (94%), Gaps = 0/188 (0%) Strand=Plus/Plus Query 1559 AGGTGTCCCCACCCAGTGACTCTGGCTGGCATGCTGGAGATGGGTGTGTCCTACCTGCCT 1618 |||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||| Sbjct 10156 AGGTGTCCCCACCCAGTGACTCTGGCCGGCATGCTGGAGATGGGTGTCTCCTACCTGCCT 10215 Query 1619 GTCAACCAGAACTGGGAGCGTTACCTGACAGAGGCACAGAACACATATGAGGAGCTCCAG 1678 ||||||||||||||||||||||||||| ||||||||||| ||| ||||||||||||||| Sbjct 10216 GTCAACCAGAACTGGGAGCGTTACCTGGCAGAGGCACAGGGCACTTATGAGGAGCTCCAG 10275 Query 1679 CGGGAGATGAAGAAGTCGCTGATGGATCTGGCTAATGATGCCTGTCAGTTGCTCTCAGGA 1738 |||||||||||||||||| ||||||||||||| ||||||||||| ||| ||||||||||| Sbjct 10276 CGGGAGATGAAGAAGTCGTTGATGGATCTGGCCAATGATGCCTGCCAGCTGCTCTCAGGA 10335 Query 1739 GAGAGGTA 1746 |||||||| Sbjct 10336 GAGAGGTA 10343 Score = 261 bits (141), Expect = 2e-65 Identities = 238/283 (84%), Gaps = 13/283 (4%) Strand=Plus/Plus Query 203 AGGACTTGTGTGAGGAAGGCAGGCATGGTGAGACCTATTTCACTGACAGGAGCA-CAGAG 261 |||| ||| | | |||||||||||||||| | ||| |||||||||||||||| | ||||| Sbjct 2251 AGGATTTG-GGGTGGAAGGCAGGCATGGTCAAACCCATTTCACTGACAGGAG-AGCAGAG 2308 Query 262 AGGGGACGCGTCTCTCTCTGA-GTCTTTCGGCCACTAAAAGCAGTCAAGCTGGAGCCCAA 320 | ||||| ||||||||| | ||||| | |||| |||||| || ||||||||||||||| Sbjct 2309 ACAGGACGTGTCTCTCTC-CACGTCTTCCAGCCAGTAAAAGAAGCCAAGCTGGAGCCCAA 2367 Query 321 AGCCCGGTGCCCCGACTCACAGCG-GGGGGCTCCCTGCACCAACCATGAGCCGCCTGCTC 379 |||| |||| | ||||| ||||| ||||| ||||||||||||||||||||||||||||| Sbjct 2368 AGCCAGGTGTTCTGACTCCCAGCGTGGGGG-TCCCTGCACCAACCATGAGCCGCCTGCTC 2426 Query 380 TGGAAGAAGGTGGCTGGCGCCAAGGTCGC-CTCAGGGCCAGTACCAGCAACCGCG-CGCT 437 |||| ||||||||| ||||||| |||| | ||||||| || ||||| ||| | |||| Sbjct 2427 TGGAGGAAGGTGGCCGGCGCCACCGTCGGGC-CAGGGCCGGTTCCAGCT-CCGGGGCGCT 2484 Query 438 GGGTCTCCAGCTCCGTCCTCGACC-CCGTCCCCAGCGACGGGC 479 |||||||||||||||||| || | ||| |||||||||||||| Sbjct 2485 GGGTCTCCAGCTCCGTCCCCG-CGTCCGACCCCAGCGACGGGC 2526 Score = 252 bits (136), Expect = 1e-62 Identities = 162/174 (93%), Gaps = 3/174 (1%) Strand=Plus/Plus Query 3778 CAGGTGCATGTTTGCCTATAAGCTGGGTCTGAATGATC-TGCCCCAGTCAGTCGCCTTTT 3836 |||||||||||||||||| ||||||||||||||||| | ||||||||||||||||||||| Sbjct 19828 CAGGTGCATGTTTGCCTACAAGCTGGGTCTGAATGA-CTTGCCCCAGTCAGTCGCCTTTT 19886 Query 3837 TCAGTGCAGTAGACATTGACCAGTGCCTCAGGAAGGAAGTGACCATGGACTGTAAAACTC 3896 |||||||||| || ||||||| ||||||||||||||||||||||||||| |||||||| | Sbjct 19887 TCAGTGCAGTCGATATTGACCGGTGCCTCAGGAAGGAAGTGACCATGGATTGTAAAACCC 19946 Query 3897 CTTCTAACCCAACTGGGATGGAAAGGAGATATGGGATCCCCCAGGGTGAAGCAC 3950 |||| |||||||||||||||||||||||||| ||||| ||||||||||| |||| Sbjct 19947 CTTCCAACCCAACTGGGATGGAAAGGAGATACGGGATTCCCCAGGGTGA-GCAC 19999 Score = 250 bits (135), Expect = 4e-62 Identities = 180/201 (89%), Gaps = 6/201 (2%) Strand=Plus/Plus Query 972 GGTATTCCTGGTGCAGCCGGCGGCTGGTGGAAGAGCGTTACTCTTGGACCAGCCAGCTAT 1031 |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| | Sbjct 7228 GGTATTCCTGGTGCAGCCAGCGGCTGGTGGAAGAGCGTTACTCTTGGACCAGCCAGCTGT 7287 Query 1032 CGCCGGCTGACCTAATCCCTTTGGGGGGCTCC-ACTAGTGCCAGCAGCTCCACCAAGCAG 1090 ||||||||||||| ||||| ||| || | || ||| ||||||||||| ||||| || || Sbjct 7288 CGCCGGCTGACCTCATCCCCCTGGAGGTC-CCTACTGGTGCCAGCAGCCCCACCCAG-AG 7345 Query 1091 -GA-TGGGCAGGAACAGTTAGTGGTGGGGCACAATGTTTCCTTTGACCGAGCCCATATCA 1148 || ||| ||||| |||||||||||||||||||||||||||||||||||||| ||||||| Sbjct 7346 AGACTGG-CAGGAGCAGTTAGTGGTGGGGCACAATGTTTCCTTTGACCGAGCTCATATCA 7404 Query 1149 GGGAACAGTATCTGATTCAGG 1169 |||| ||||| ||||| |||| Sbjct 7405 GGGAGCAGTACCTGATCCAGG 7425 Score = 213 bits (115), Expect = 5e-51 Identities = 147/163 (90%), Gaps = 0/163 (0%) Strand=Plus/Plus Query 2562 AGGACGGTAACAACTACAATGTGGGCAGTCCCTTTGCCAAAGATTTCCTGCCCAAGATGG 2621 |||| ||||| | || |||||||| || ||||||||||| || |||||||||||||||| Sbjct 14457 AGGATGGTAATAGCTGTAATGTGGGAAGCCCCTTTGCCAAGGACTTCCTGCCCAAGATGG 14516 Query 2622 AGGATGGCACCCTGCAGGCTGGCCCAGGAGGTGCCAGTGGGCCTCGTGCCCTGGAAATAA 2681 ||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| | Sbjct 14517 AGGATGGCACCCTGCAGGCTGGCCCAGGAGGTGCCAGTGGGCCCCGTGCTCTGGAAATCA 14576 Query 2682 ATAAAATGATTTCTTTTTGGAGGAATGCTCATAAACGTATCAG 2724 | |||||||||||||| |||||||| || |||||||||||||| Sbjct 14577 ACAAAATGATTTCTTTCTGGAGGAACGCCCATAAACGTATCAG 14619 Score = 178 bits (96), Expect = 2e-40 Identities = 124/138 (89%), Gaps = 0/138 (0%) Strand=Plus/Plus Query 2896 GCCTGACCGGGTAGGCAGTGAGTTGAAAGCCATGGTGCAGGCTCCACCTGGCTATGTCCT 2955 ||||||||| |||||||||||||||||||||||||||||||| ||||||||||| ||| Sbjct 16100 GCCTGACCGAGTAGGCAGTGAGTTGAAAGCCATGGTGCAGGCCCCACCTGGCTACACCCT 16159 Query 2956 TGTGGGTGCTGATGTGGACTCACAGGAACTGTGGATCGCAGCTGTACTTGGAGATGCTCA 3015 ||||||||||||||||||||| || || |||||||| |||||||| |||||||| || || Sbjct 16160 TGTGGGTGCTGATGTGGACTCCCAAGAGCTGTGGATTGCAGCTGTGCTTGGAGACGCCCA 16219 Query 3016 CTTTGCTGGGATGCATGG 3033 |||||| || |||||||| Sbjct 16220 CTTTGCCGGCATGCATGG 16237 Score = 106 bits (57), Expect = 9e-19 Identities = 86/100 (86%), Gaps = 2/100 (2%) Strand=Plus/Plus Query 2466 GTGCCCCCAAATCCAGCCAGCCCACG-TATCACCATGGCAACGGACCTTATAATGATGTG 2524 ||| |||||| || |||||||| | |||||||||||||| |||||||| || || ||| Sbjct 13860 GTGGCCCCAAGGACACCCAGCCCA-GCTATCACCATGGCAATGGACCTTACAACGACGTG 13918 Query 2525 AATATCCCTGGTTGCTGGTTTTTCAAGCTGCCTCACAAGG 2564 | |||||||| |||||||||||||||||||||||||||| Sbjct 13919 GACATCCCTGGCTGCTGGTTTTTCAAGCTGCCTCACAAGG 13958 >gb|AC005317.2| Download subject sequence spanning the HSP Homo sapiens chromosome 15q26.1 clone PAC pDJ457j11 containing DNA polymerase gamma (polg) gene, complete sequence Length=170612 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 601 bits (325), Expect = 9e-168 Identities = 438/492 (89%), Gaps = 10/492 (2%) Strand=Plus/Minus Query 489 CGCAAATGCCCTCCTCCGAGAATGGGCAGCTGCGGCTCAACCC-TCTGCTCATCCAGATG 547 ||||| ||| ||||| ||| ||||||||||||| |||||| | || |||||||||| Sbjct 84393 CGCAAGTGCTATCCTCGGAGGGCGGGCAGCTGCGGCACAACCCAT-TGGACATCCAGATG 84335 Query 548 TTGTCGAGAGGCCTGCACGAGCAGATCTTCGGGTGCGGCGGGGAAATGCCCGACGAGGCC 607 | |||||||| ||||||||||| ||||||||| || ||||| ||||| | ||||||| Sbjct 84334 CTCTCGAGAGGGCTGCACGAGCAAATCTTCGGGCAAGGAGGGGAGATGCCTGGCGAGGCC 84275 Query 608 GCGGTGCAG-CGCAGCGTAGAGCACCTGCAGAAGCACGGGCTCTGGGGGCAGCCGGCCAC 666 ||||||| | |||||||| ||||||||||||||||||||||||||||||||||| ||| Sbjct 84274 GCGGTGC-GCCGCAGCGTCGAGCACCTGCAGAAGCACGGGCTCTGGGGGCAGCCAGCCGT 84216 Query 667 GCCCTTGCCAGACGTGGAGCTGCGCCTGCC-CCGGCTCTTCGGGGGCAACCTGGACCAGC 725 ||||||||| |||||||||||||||||||| || |||| ||||| |||||||||||||| Sbjct 84215 GCCCTTGCCCGACGTGGAGCTGCGCCTGCCGCC-CCTCTACGGGGACAACCTGGACCAGC 84157 Query 726 ACTTCCGCCTCCTGGCCCAGAAGCAGAGCCTGCCTTACTTGGAGGCGGCCGCCTCGTTAT 785 |||||||||||||||||||||||||||||||||| ||| ||||||||||| || | | | Sbjct 84156 ACTTCCGCCTCCTGGCCCAGAAGCAGAGCCTGCCCTACCTGGAGGCGGCCAACTTGCTGT 84097 Query 786 TGGAGGCCCAATTGCCCCCCG-AGCCCAAGAGC-TGGGCCTGGGCGGAGGGCTGGACCCG 843 || ||||||| || |||||| ||||| | || |||||||||||||||||||||||||| Sbjct 84096 TGCAGGCCCAGCTG-CCCCCGAAGCCCCCG-GCTTGGGCCTGGGCGGAGGGCTGGACCCG 84039 Query 844 GTACGGCCCCGAGGGGGAGGCCGAACCCGTGGCCATCCCCGAGGAGCGGGCCCTGGTGTT 903 ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| Sbjct 84038 GTACGGCCCCGAGGGGGAGGCCGTACCCGTGGCCATCCCCGAGGAGCGGGCCCTGGTGTT 83979 Query 904 CGACGTGGAGGTCTGCTTGGCAGAGGGAACCTGCCCCACTTTGGCGGTGGCCATATCCCC 963 |||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| Sbjct 83978 CGACGTGGAGGTCTGCTTGGCAGAGGGAACTTGCCCCACATTGGCGGTGGCCATATCCCC 83919 Query 964 CTCGGCCTGGTA 975 |||||||||||| Sbjct 83918 CTCGGCCTGGTA 83907 Score = 318 bits (172), Expect = 1e-82 Identities = 225/251 (89%), Gaps = 2/251 (0%) Strand=Plus/Minus Query 3032 GGCTGCACGGCCTTTGGCTGGATGACTCTGCAGGGCAGGAAGAGCAGAGGCACTGATCTG 3091 |||||||| |||||||| |||||||| |||||||||||||||||||| ||||||||||| Sbjct 72012 GGCTGCACAGCCTTTGGGTGGATGACACTGCAGGGCAGGAAGAGCAGGGGCACTGATCTA 71953 Query 3092 CACAGCAAGACAGCTGCCACTGTGGGCATCAGCCGAGAGCATGCCAAAATCTTCAACTAT 3151 ||||| |||||||| | ||||||||||||||||| ||||||||||||||||||||||| Sbjct 71952 CACAGTAAGACAGCCACTACTGTGGGCATCAGCCGTGAGCATGCCAAAATCTTCAACTAC 71893 Query 3152 GGCCGCATCTATGGGGCTGGGCAGTCCTTTGCTGAGCGCCTACTGATGCAGTTCAACCAC 3211 |||||||||||||| ||||||||| |||||||||||||| |||| |||||||| |||||| Sbjct 71892 GGCCGCATCTATGGTGCTGGGCAGCCCTTTGCTGAGCGCTTACTAATGCAGTTTAACCAC 71833 Query 3212 AGGCTCACA-AGGCAGGAGGCAGCTGAGAAGGCCCAGCAGATGTATGCAGTCACAAAAGG 3270 |||||||| | ||||||||||||||||||||||||||||||||| || | ||| || || Sbjct 71832 CGGCTCACACA-GCAGGAGGCAGCTGAGAAGGCCCAGCAGATGTACGCTGCCACCAAGGG 71774 Query 3271 CCTGCGCCGGT 3281 ||| ||| ||| Sbjct 71773 CCTCCGCTGGT 71763 Score = 313 bits (169), Expect = 5e-81 Identities = 364/450 (80%), Gaps = 46/450 (10%) Strand=Plus/Minus Query 3941 GGTGAAGCACTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACGA 4000 |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 67826 GGTGAAGCGCTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACGA 67767 Query 4001 AGCCAGCCTGGACCCTAGCTCTGTCTGGAGGTTCTGTATTTGCTCCTGTGGAGCTTTATT 4060 |||||||||||||| |||| ||| ||||||| |||||||||||||| ||||||||| || Sbjct 67766 AGCCAGCCTGGACCATAGCACTGCCTGGAGGCTCTGTATTTGCTCCCGTGGAGCTTCATC 67707 Query 4061 GGAGCGG-TGCAGGTTCCTAAACTCAGGCTTTCAGATGTGCTTTTTTGCAAAAGG-C--- 4115 || | || |||||| ||| |||||||||||||||| |||||||||| |||||||| | Sbjct 67706 GGGGTGGGTGCAGGCTCCCAAACTCAGGCTTTCAGCTGTGCTTTTT-GCAAAAGGGCTTG 67648 Query 4116 ---A-G-CCA----TTTTTCTGTAGCAGGACCTGCCCAGGAA-AGTCCTCCTAACGGAAG 4165 | | ||| |||||| ||||||||||||||| || || | |||| ||||| |||| Sbjct 67647 CCTAAGGCCAGCCATTTTTCAGTAGCAGGACCTGCCAAG-AAGATTCCTTCTAACTGAAG 67589 Query 4166 G--CAC---AATTCAGTGCGTTCAGAACCAGGACACCAACATCAGTGCAGG-CTGT-GTG 4218 | || ||||||||| ||||||||||| || |||||||| ||| || || | | Sbjct 67588 GTGCAGTTGAATTCAGTGGGTTCAGAACCAAGATGCCAACATCGGTGT-GGACTACAG-G 67531 Query 4219 ACAAGGGGTA------CT-GTTGGGCACAAATGAAGCAGATGCCCCAAAGGTCACATTAA 4271 |||||||| | || |||||| | |||||||||||| ||||||||| ||||||||| Sbjct 67530 ACAAGGGGCATTGTTGCTTGTTGGGTAAAAATGAAGCAGAAGCCCCAAAGTTCACATTAA 67471 Query 4272 CTCAGGCATTTC-TTCCT-----CCT---CTTCTTGGCTGGTTCTCTGTCCTG-CTGTGT 4321 |||||||||||| || | ||| |||||||||||||||| ||| ||| | Sbjct 67470 CTCAGGCATTTCATTTATTTTTTCCTTTTCTTCTTGGCTGGTTCTTTGTTCTGTCCCCC- 67412 Query 4322 ATG-TGCTGATGCAGTGCCCTAGAAGGGGA 4350 ||| | |||||||||||||||||||||||| Sbjct 67411 ATGCT-CTGATGCAGTGCCCTAGAAGGGGA 67383 Score = 305 bits (165), Expect = 8e-79 Identities = 198/214 (92%), Gaps = 2/214 (0%) Strand=Plus/Minus Query 3570 AGTTTATAACCAGTCGTGTGAACTGGGTGGTACAGAGCTCTGCTGTAGACTACTTACATC 3629 ||||||| ||||| |||||||| ||||||||||||||||||||||| ||||||||||| | Sbjct 69750 AGTTTATGACCAGCCGTGTGAATTGGGTGGTACAGAGCTCTGCTGTTGACTACTTACACC 69691 Query 3630 TCATGCTTGTGGCCATGAAGTGGCTGTTTGAGGAATTTGCCATTGATGGGCGCTTCTGCA 3689 ||||||||||||||||||||||||||||||| || |||||||| |||||||||||||||| Sbjct 69690 TCATGCTTGTGGCCATGAAGTGGCTGTTTGAAGAGTTTGCCATAGATGGGCGCTTCTGCA 69631 Query 3690 TCAGCATCCACGACGAGGTTCGCTACCTGGTGCGTGAGGAGGACCGCTACCGTGCCGCCC 3749 |||||||||| ||||||||||||||||||||||| ||||||||||||||||| || |||| Sbjct 69630 TCAGCATCCATGACGAGGTTCGCTACCTGGTGCGGGAGGAGGACCGCTACCGCGCTGCCC 69571 Query 3750 TGGCACT-GCAGATCACCAATCTCCTGACCAGGT 3782 |||| || |||||||||||| ||| ||||||||| Sbjct 69570 TGGC-CTTGCAGATCACCAACCTCTTGACCAGGT 69538 Score = 292 bits (158), Expect = 6e-75 Identities = 178/188 (94%), Gaps = 0/188 (0%) Strand=Plus/Minus Query 1559 AGGTGTCCCCACCCAGTGACTCTGGCTGGCATGCTGGAGATGGGTGTGTCCTACCTGCCT 1618 |||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||| Sbjct 78167 AGGTGTCCCCACCCAGTGACTCTGGCCGGCATGCTGGAGATGGGTGTCTCCTACCTGCCT 78108 Query 1619 GTCAACCAGAACTGGGAGCGTTACCTGACAGAGGCACAGAACACATATGAGGAGCTCCAG 1678 ||||||||||||||||||||||||||| ||||||||||| ||| ||||||||||||||| Sbjct 78107 GTCAACCAGAACTGGGAGCGTTACCTGGCAGAGGCACAGGGCACTTATGAGGAGCTCCAG 78048 Query 1679 CGGGAGATGAAGAAGTCGCTGATGGATCTGGCTAATGATGCCTGTCAGTTGCTCTCAGGA 1738 |||||||||||||||||| ||||||||||||| ||||||||||| ||| ||||||||||| Sbjct 78047 CGGGAGATGAAGAAGTCGTTGATGGATCTGGCCAATGATGCCTGCCAGCTGCTCTCAGGA 77988 Query 1739 GAGAGGTA 1746 |||||||| Sbjct 77987 GAGAGGTA 77980 Score = 261 bits (141), Expect = 2e-65 Identities = 238/283 (84%), Gaps = 13/283 (4%) Strand=Plus/Minus Query 203 AGGACTTGTGTGAGGAAGGCAGGCATGGTGAGACCTATTTCACTGACAGGAGCA-CAGAG 261 |||| ||| | | |||||||||||||||| | ||| |||||||||||||||| | ||||| Sbjct 84729 AGGATTTG-GGGTGGAAGGCAGGCATGGTCAAACCCATTTCACTGACAGGAG-AGCAGAG 84672 Query 262 AGGGGACGCGTCTCTCTCTGA-GTCTTTCGGCCACTAAAAGCAGTCAAGCTGGAGCCCAA 320 | ||||| ||||||||| | ||||| | |||| |||||| || ||||||||||||||| Sbjct 84671 ACAGGACGTGTCTCTCTC-CACGTCTTCCAGCCAGTAAAAGAAGCCAAGCTGGAGCCCAA 84613 Query 321 AGCCCGGTGCCCCGACTCACAGCG-GGGGGCTCCCTGCACCAACCATGAGCCGCCTGCTC 379 |||| |||| | ||||| ||||| ||||| ||||||||||||||||||||||||||||| Sbjct 84612 AGCCAGGTGTTCTGACTCCCAGCGTGGGGG-TCCCTGCACCAACCATGAGCCGCCTGCTC 84554 Query 380 TGGAAGAAGGTGGCTGGCGCCAAGGTCGC-CTCAGGGCCAGTACCAGCAACCGCG-CGCT 437 |||| ||||||||| ||||||| |||| | ||||||| || ||||| ||| | |||| Sbjct 84553 TGGAGGAAGGTGGCCGGCGCCACCGTCGGGC-CAGGGCCGGTTCCAGCT-CCGGGGCGCT 84496 Query 438 GGGTCTCCAGCTCCGTCCTCGACC-CCGTCCCCAGCGACGGGC 479 |||||||||||||||||| || | ||| |||||||||||||| Sbjct 84495 GGGTCTCCAGCTCCGTCCCCG-CGTCCGACCCCAGCGACGGGC 84454 Score = 252 bits (136), Expect = 1e-62 Identities = 162/174 (93%), Gaps = 3/174 (1%) Strand=Plus/Minus Query 3778 CAGGTGCATGTTTGCCTATAAGCTGGGTCTGAATGATC-TGCCCCAGTCAGTCGCCTTTT 3836 |||||||||||||||||| ||||||||||||||||| | ||||||||||||||||||||| Sbjct 68537 CAGGTGCATGTTTGCCTACAAGCTGGGTCTGAATGA-CTTGCCCCAGTCAGTCGCCTTTT 68479 Query 3837 TCAGTGCAGTAGACATTGACCAGTGCCTCAGGAAGGAAGTGACCATGGACTGTAAAACTC 3896 |||||||||| || ||||||| ||||||||||||||||||||||||||| |||||||| | Sbjct 68478 TCAGTGCAGTCGATATTGACCGGTGCCTCAGGAAGGAAGTGACCATGGATTGTAAAACCC 68419 Query 3897 CTTCTAACCCAACTGGGATGGAAAGGAGATATGGGATCCCCCAGGGTGAAGCAC 3950 |||| |||||||||||||||||||||||||| ||||| ||||||||||| |||| Sbjct 68418 CTTCCAACCCAACTGGGATGGAAAGGAGATACGGGATTCCCCAGGGTGA-GCAC 68366 Score = 250 bits (135), Expect = 4e-62 Identities = 180/201 (89%), Gaps = 6/201 (2%) Strand=Plus/Minus Query 972 GGTATTCCTGGTGCAGCCGGCGGCTGGTGGAAGAGCGTTACTCTTGGACCAGCCAGCTAT 1031 |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| | Sbjct 81093 GGTATTCCTGGTGCAGCCAGCGGCTGGTGGAAGAGCGTTACTCTTGGACCAGCCAGCTGT 81034 Query 1032 CGCCGGCTGACCTAATCCCTTTGGGGGGCTCC-ACTAGTGCCAGCAGCTCCACCAAGCAG 1090 ||||||||||||| ||||| ||| || | || ||| ||||||||||| ||||| || || Sbjct 81033 CGCCGGCTGACCTCATCCCCCTGGAGGTC-CCTACTGGTGCCAGCAGCCCCACCCAG-AG 80976 Query 1091 -GA-TGGGCAGGAACAGTTAGTGGTGGGGCACAATGTTTCCTTTGACCGAGCCCATATCA 1148 || | ||||||| |||||||||||||||||||||||||||||||||||||| ||||||| Sbjct 80975 AGACT-GGCAGGAGCAGTTAGTGGTGGGGCACAATGTTTCCTTTGACCGAGCTCATATCA 80917 Query 1149 GGGAACAGTATCTGATTCAGG 1169 |||| ||||| ||||| |||| Sbjct 80916 GGGAGCAGTACCTGATCCAGG 80896 Score = 213 bits (115), Expect = 5e-51 Identities = 147/163 (90%), Gaps = 0/163 (0%) Strand=Plus/Minus Query 2562 AGGACGGTAACAACTACAATGTGGGCAGTCCCTTTGCCAAAGATTTCCTGCCCAAGATGG 2621 |||| ||||| | || |||||||| || ||||||||||| || |||||||||||||||| Sbjct 73907 AGGATGGTAATAGCTGTAATGTGGGAAGCCCCTTTGCCAAGGACTTCCTGCCCAAGATGG 73848 Query 2622 AGGATGGCACCCTGCAGGCTGGCCCAGGAGGTGCCAGTGGGCCTCGTGCCCTGGAAATAA 2681 ||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| | Sbjct 73847 AGGATGGCACCCTGCAGGCTGGCCCAGGAGGTGCCAGTGGGCCCCGTGCTCTGGAAATCA 73788 Query 2682 ATAAAATGATTTCTTTTTGGAGGAATGCTCATAAACGTATCAG 2724 | |||||||||||||| |||||||| || |||||||||||||| Sbjct 73787 ACAAAATGATTTCTTTCTGGAGGAACGCCCATAAACGTATCAG 73745 Score = 178 bits (96), Expect = 2e-40 Identities = 124/138 (89%), Gaps = 0/138 (0%) Strand=Plus/Minus Query 2896 GCCTGACCGGGTAGGCAGTGAGTTGAAAGCCATGGTGCAGGCTCCACCTGGCTATGTCCT 2955 ||||||||| |||||||||||||||||||||||||||||||| ||||||||||| ||| Sbjct 72264 GCCTGACCGAGTAGGCAGTGAGTTGAAAGCCATGGTGCAGGCCCCACCTGGCTACACCCT 72205 Query 2956 TGTGGGTGCTGATGTGGACTCACAGGAACTGTGGATCGCAGCTGTACTTGGAGATGCTCA 3015 ||||||||||||||||||||| || || |||||||| |||||||| |||||||| || || Sbjct 72204 TGTGGGTGCTGATGTGGACTCCCAAGAGCTGTGGATTGCAGCTGTGCTTGGAGACGCCCA 72145 Query 3016 CTTTGCTGGGATGCATGG 3033 |||||| || |||||||| Sbjct 72144 CTTTGCCGGCATGCATGG 72127 Score = 106 bits (57), Expect = 9e-19 Identities = 86/100 (86%), Gaps = 2/100 (2%) Strand=Plus/Minus Query 2466 GTGCCCCCAAATCCAGCCAGCCCACG-TATCACCATGGCAACGGACCTTATAATGATGTG 2524 ||| |||||| || |||||||| | |||||||||||||| |||||||| || || ||| Sbjct 74504 GTGGCCCCAAGGACACCCAGCCCA-GCTATCACCATGGCAATGGACCTTACAACGACGTG 74446 Query 2525 AATATCCCTGGTTGCTGGTTTTTCAAGCTGCCTCACAAGG 2564 | |||||||| |||||||||||||||||||||||||||| Sbjct 74445 GACATCCCTGGCTGCTGGTTTTTCAAGCTGCCTCACAAGG 74406 >gb|AC005316.1|AC005316 Download subject sequence spanning the HSP Human Chromosome 15q26.1 PAC clone pDJ10k5 containing human DNA polymerase gamma (polg) gene, complete sequence Length=117270 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 601 bits (325), Expect = 9e-168 Identities = 438/492 (89%), Gaps = 10/492 (2%) Strand=Plus/Minus Query 489 CGCAAATGCCCTCCTCCGAGAATGGGCAGCTGCGGCTCAACCC-TCTGCTCATCCAGATG 547 ||||| ||| ||||| ||| ||||||||||||| |||||| | || |||||||||| Sbjct 27620 CGCAAGTGCTATCCTCGGAGGGCGGGCAGCTGCGGCACAACCCAT-TGGACATCCAGATG 27562 Query 548 TTGTCGAGAGGCCTGCACGAGCAGATCTTCGGGTGCGGCGGGGAAATGCCCGACGAGGCC 607 | |||||||| ||||||||||| ||||||||| || ||||| ||||| | ||||||| Sbjct 27561 CTCTCGAGAGGGCTGCACGAGCAAATCTTCGGGCAAGGAGGGGAGATGCCTGGCGAGGCC 27502 Query 608 GCGGTGCAG-CGCAGCGTAGAGCACCTGCAGAAGCACGGGCTCTGGGGGCAGCCGGCCAC 666 ||||||| | |||||||| ||||||||||||||||||||||||||||||||||| ||| Sbjct 27501 GCGGTGC-GCCGCAGCGTCGAGCACCTGCAGAAGCACGGGCTCTGGGGGCAGCCAGCCGT 27443 Query 667 GCCCTTGCCAGACGTGGAGCTGCGCCTGCC-CCGGCTCTTCGGGGGCAACCTGGACCAGC 725 ||||||||| |||||||||||||||||||| || |||| ||||| |||||||||||||| Sbjct 27442 GCCCTTGCCCGACGTGGAGCTGCGCCTGCCGCC-CCTCTACGGGGACAACCTGGACCAGC 27384 Query 726 ACTTCCGCCTCCTGGCCCAGAAGCAGAGCCTGCCTTACTTGGAGGCGGCCGCCTCGTTAT 785 |||||||||||||||||||||||||||||||||| ||| ||||||||||| || | | | Sbjct 27383 ACTTCCGCCTCCTGGCCCAGAAGCAGAGCCTGCCCTACCTGGAGGCGGCCAACTTGCTGT 27324 Query 786 TGGAGGCCCAATTGCCCCCCG-AGCCCAAGAGC-TGGGCCTGGGCGGAGGGCTGGACCCG 843 || ||||||| || |||||| ||||| | || |||||||||||||||||||||||||| Sbjct 27323 TGCAGGCCCAGCTG-CCCCCGAAGCCCCCG-GCTTGGGCCTGGGCGGAGGGCTGGACCCG 27266 Query 844 GTACGGCCCCGAGGGGGAGGCCGAACCCGTGGCCATCCCCGAGGAGCGGGCCCTGGTGTT 903 ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| Sbjct 27265 GTACGGCCCCGAGGGGGAGGCCGTACCCGTGGCCATCCCCGAGGAGCGGGCCCTGGTGTT 27206 Query 904 CGACGTGGAGGTCTGCTTGGCAGAGGGAACCTGCCCCACTTTGGCGGTGGCCATATCCCC 963 |||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| Sbjct 27205 CGACGTGGAGGTCTGCTTGGCAGAGGGAACTTGCCCCACATTGGCGGTGGCCATATCCCC 27146 Query 964 CTCGGCCTGGTA 975 |||||||||||| Sbjct 27145 CTCGGCCTGGTA 27134 Score = 318 bits (172), Expect = 1e-82 Identities = 225/251 (89%), Gaps = 2/251 (0%) Strand=Plus/Minus Query 3032 GGCTGCACGGCCTTTGGCTGGATGACTCTGCAGGGCAGGAAGAGCAGAGGCACTGATCTG 3091 |||||||| |||||||| |||||||| |||||||||||||||||||| ||||||||||| Sbjct 15239 GGCTGCACAGCCTTTGGGTGGATGACACTGCAGGGCAGGAAGAGCAGGGGCACTGATCTA 15180 Query 3092 CACAGCAAGACAGCTGCCACTGTGGGCATCAGCCGAGAGCATGCCAAAATCTTCAACTAT 3151 ||||| |||||||| | ||||||||||||||||| ||||||||||||||||||||||| Sbjct 15179 CACAGTAAGACAGCCACTACTGTGGGCATCAGCCGTGAGCATGCCAAAATCTTCAACTAC 15120 Query 3152 GGCCGCATCTATGGGGCTGGGCAGTCCTTTGCTGAGCGCCTACTGATGCAGTTCAACCAC 3211 |||||||||||||| ||||||||| |||||||||||||| |||| |||||||| |||||| Sbjct 15119 GGCCGCATCTATGGTGCTGGGCAGCCCTTTGCTGAGCGCTTACTAATGCAGTTTAACCAC 15060 Query 3212 AGGCTCACA-AGGCAGGAGGCAGCTGAGAAGGCCCAGCAGATGTATGCAGTCACAAAAGG 3270 |||||||| | ||||||||||||||||||||||||||||||||| || | ||| || || Sbjct 15059 CGGCTCACACA-GCAGGAGGCAGCTGAGAAGGCCCAGCAGATGTACGCTGCCACCAAGGG 15001 Query 3271 CCTGCGCCGGT 3281 ||| ||| ||| Sbjct 15000 CCTCCGCTGGT 14990 Score = 313 bits (169), Expect = 5e-81 Identities = 364/450 (80%), Gaps = 46/450 (10%) Strand=Plus/Minus Query 3941 GGTGAAGCACTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACGA 4000 |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 11053 GGTGAAGCGCTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACGA 10994 Query 4001 AGCCAGCCTGGACCCTAGCTCTGTCTGGAGGTTCTGTATTTGCTCCTGTGGAGCTTTATT 4060 |||||||||||||| |||| ||| ||||||| |||||||||||||| ||||||||| || Sbjct 10993 AGCCAGCCTGGACCATAGCACTGCCTGGAGGCTCTGTATTTGCTCCCGTGGAGCTTCATC 10934 Query 4061 GGAGCGG-TGCAGGTTCCTAAACTCAGGCTTTCAGATGTGCTTTTTTGCAAAAGG-C--- 4115 || | || |||||| ||| |||||||||||||||| |||||||||| |||||||| | Sbjct 10933 GGGGTGGGTGCAGGCTCCCAAACTCAGGCTTTCAGCTGTGCTTTTT-GCAAAAGGGCTTG 10875 Query 4116 ---A-G-CCA----TTTTTCTGTAGCAGGACCTGCCCAGGAA-AGTCCTCCTAACGGAAG 4165 | | ||| |||||| ||||||||||||||| || || | |||| ||||| |||| Sbjct 10874 CCTAAGGCCAGCCATTTTTCAGTAGCAGGACCTGCCAAG-AAGATTCCTTCTAACTGAAG 10816 Query 4166 G--CAC---AATTCAGTGCGTTCAGAACCAGGACACCAACATCAGTGCAGG-CTGT-GTG 4218 | || ||||||||| ||||||||||| || |||||||| ||| || || | | Sbjct 10815 GTGCAGTTGAATTCAGTGGGTTCAGAACCAAGATGCCAACATCGGTGT-GGACTACAG-G 10758 Query 4219 ACAAGGGGTA------CT-GTTGGGCACAAATGAAGCAGATGCCCCAAAGGTCACATTAA 4271 |||||||| | || |||||| | |||||||||||| ||||||||| ||||||||| Sbjct 10757 ACAAGGGGCATTGTTGCTTGTTGGGTAAAAATGAAGCAGAAGCCCCAAAGTTCACATTAA 10698 Query 4272 CTCAGGCATTTC-TTCCT-----CCT---CTTCTTGGCTGGTTCTCTGTCCTG-CTGTGT 4321 |||||||||||| || | ||| |||||||||||||||| ||| ||| | Sbjct 10697 CTCAGGCATTTCATTTATTTTTTCCTTTTCTTCTTGGCTGGTTCTTTGTTCTGTCCCCC- 10639 Query 4322 ATG-TGCTGATGCAGTGCCCTAGAAGGGGA 4350 ||| | |||||||||||||||||||||||| Sbjct 10638 ATGCT-CTGATGCAGTGCCCTAGAAGGGGA 10610 Score = 305 bits (165), Expect = 8e-79 Identities = 198/214 (92%), Gaps = 2/214 (0%) Strand=Plus/Minus Query 3570 AGTTTATAACCAGTCGTGTGAACTGGGTGGTACAGAGCTCTGCTGTAGACTACTTACATC 3629 ||||||| ||||| |||||||| ||||||||||||||||||||||| ||||||||||| | Sbjct 12977 AGTTTATGACCAGCCGTGTGAATTGGGTGGTACAGAGCTCTGCTGTTGACTACTTACACC 12918 Query 3630 TCATGCTTGTGGCCATGAAGTGGCTGTTTGAGGAATTTGCCATTGATGGGCGCTTCTGCA 3689 ||||||||||||||||||||||||||||||| || |||||||| |||||||||||||||| Sbjct 12917 TCATGCTTGTGGCCATGAAGTGGCTGTTTGAAGAGTTTGCCATAGATGGGCGCTTCTGCA 12858 Query 3690 TCAGCATCCACGACGAGGTTCGCTACCTGGTGCGTGAGGAGGACCGCTACCGTGCCGCCC 3749 |||||||||| ||||||||||||||||||||||| ||||||||||||||||| || |||| Sbjct 12857 TCAGCATCCATGACGAGGTTCGCTACCTGGTGCGGGAGGAGGACCGCTACCGCGCTGCCC 12798 Query 3750 TGGCACT-GCAGATCACCAATCTCCTGACCAGGT 3782 |||| || |||||||||||| ||| ||||||||| Sbjct 12797 TGGC-CTTGCAGATCACCAACCTCTTGACCAGGT 12765 Score = 292 bits (158), Expect = 6e-75 Identities = 178/188 (94%), Gaps = 0/188 (0%) Strand=Plus/Minus Query 1559 AGGTGTCCCCACCCAGTGACTCTGGCTGGCATGCTGGAGATGGGTGTGTCCTACCTGCCT 1618 |||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||| Sbjct 21394 AGGTGTCCCCACCCAGTGACTCTGGCCGGCATGCTGGAGATGGGTGTCTCCTACCTGCCT 21335 Query 1619 GTCAACCAGAACTGGGAGCGTTACCTGACAGAGGCACAGAACACATATGAGGAGCTCCAG 1678 ||||||||||||||||||||||||||| ||||||||||| ||| ||||||||||||||| Sbjct 21334 GTCAACCAGAACTGGGAGCGTTACCTGGCAGAGGCACAGGGCACTTATGAGGAGCTCCAG 21275 Query 1679 CGGGAGATGAAGAAGTCGCTGATGGATCTGGCTAATGATGCCTGTCAGTTGCTCTCAGGA 1738 |||||||||||||||||| ||||||||||||| ||||||||||| ||| ||||||||||| Sbjct 21274 CGGGAGATGAAGAAGTCGTTGATGGATCTGGCCAATGATGCCTGCCAGCTGCTCTCAGGA 21215 Query 1739 GAGAGGTA 1746 |||||||| Sbjct 21214 GAGAGGTA 21207 Score = 261 bits (141), Expect = 2e-65 Identities = 238/283 (84%), Gaps = 13/283 (4%) Strand=Plus/Minus Query 203 AGGACTTGTGTGAGGAAGGCAGGCATGGTGAGACCTATTTCACTGACAGGAGCA-CAGAG 261 |||| ||| | | |||||||||||||||| | ||| |||||||||||||||| | ||||| Sbjct 27962 AGGATTTG-GGGTGGAAGGCAGGCATGGTCAAACCCATTTCACTGACAGGAG-AGCAGAG 27905 Query 262 AGGGGACGCGTCTCTCTCTGA-GTCTTTCGGCCACTAAAAGCAGTCAAGCTGGAGCCCAA 320 | ||||| ||||||||| | ||||| | |||| |||||| || ||||||||||||||| Sbjct 27904 ACAGGACGTGTCTCTCTC-CACGTCTTCCAGCCAGTAAAAGAAGCCAAGCTGGAGCCCAA 27846 Query 321 AGCCCGGTGCCCCGACTCACAGCG-GGGGGCTCCCTGCACCAACCATGAGCCGCCTGCTC 379 |||| |||| | ||||| ||||| ||||| ||||||||||||||||||||||||||||| Sbjct 27845 AGCCAGGTGTTCTGACTCCCAGCGTGGGGG-TCCCTGCACCAACCATGAGCCGCCTGCTC 27787 Query 380 TGGAAGAAGGTGGCTGGCGCCAAGGTCGC-CTCAGGGCCAGTACCAGCAACCGCG-CGCT 437 |||| ||||||||| ||||||| |||| | ||||||| || ||||| ||| | |||| Sbjct 27786 TGGAGGAAGGTGGCCGGCGCCACCGTCGGGC-CAGGGCCGGTTCCAGCT-CCGGGGCGCT 27729 Query 438 GGGTCTCCAGCTCCGTCCTCGACC-CCGTCCCCAGCGACGGGC 479 |||||||||||||||||| || | ||| |||||||||||||| Sbjct 27728 GGGTCTCCAGCTCCGTCCCCG-CGTCCGACCCCAGCGACGGGC 27687 Score = 252 bits (136), Expect = 1e-62 Identities = 162/174 (93%), Gaps = 3/174 (1%) Strand=Plus/Minus Query 3778 CAGGTGCATGTTTGCCTATAAGCTGGGTCTGAATGATC-TGCCCCAGTCAGTCGCCTTTT 3836 |||||||||||||||||| ||||||||||||||||| | ||||||||||||||||||||| Sbjct 11764 CAGGTGCATGTTTGCCTACAAGCTGGGTCTGAATGA-CTTGCCCCAGTCAGTCGCCTTTT 11706 Query 3837 TCAGTGCAGTAGACATTGACCAGTGCCTCAGGAAGGAAGTGACCATGGACTGTAAAACTC 3896 |||||||||| || ||||||| ||||||||||||||||||||||||||| |||||||| | Sbjct 11705 TCAGTGCAGTCGATATTGACCGGTGCCTCAGGAAGGAAGTGACCATGGATTGTAAAACCC 11646 Query 3897 CTTCTAACCCAACTGGGATGGAAAGGAGATATGGGATCCCCCAGGGTGAAGCAC 3950 |||| |||||||||||||||||||||||||| ||||| ||||||||||| |||| Sbjct 11645 CTTCCAACCCAACTGGGATGGAAAGGAGATACGGGATTCCCCAGGGTGA-GCAC 11593 Score = 250 bits (135), Expect = 4e-62 Identities = 180/201 (89%), Gaps = 6/201 (2%) Strand=Plus/Minus Query 972 GGTATTCCTGGTGCAGCCGGCGGCTGGTGGAAGAGCGTTACTCTTGGACCAGCCAGCTAT 1031 |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| | Sbjct 24320 GGTATTCCTGGTGCAGCCAGCGGCTGGTGGAAGAGCGTTACTCTTGGACCAGCCAGCTGT 24261 Query 1032 CGCCGGCTGACCTAATCCCTTTGGGGGGCTCC-ACTAGTGCCAGCAGCTCCACCAAGCAG 1090 ||||||||||||| ||||| ||| || | || ||| ||||||||||| ||||| || || Sbjct 24260 CGCCGGCTGACCTCATCCCCCTGGAGGTC-CCTACTGGTGCCAGCAGCCCCACCCAG-AG 24203 Query 1091 -GA-TGGGCAGGAACAGTTAGTGGTGGGGCACAATGTTTCCTTTGACCGAGCCCATATCA 1148 || | ||||||| |||||||||||||||||||||||||||||||||||||| ||||||| Sbjct 24202 AGACT-GGCAGGAGCAGTTAGTGGTGGGGCACAATGTTTCCTTTGACCGAGCTCATATCA 24144 Query 1149 GGGAACAGTATCTGATTCAGG 1169 |||| ||||| ||||| |||| Sbjct 24143 GGGAGCAGTACCTGATCCAGG 24123 Score = 213 bits (115), Expect = 5e-51 Identities = 147/163 (90%), Gaps = 0/163 (0%) Strand=Plus/Minus Query 2562 AGGACGGTAACAACTACAATGTGGGCAGTCCCTTTGCCAAAGATTTCCTGCCCAAGATGG 2621 |||| ||||| | || |||||||| || ||||||||||| || |||||||||||||||| Sbjct 17134 AGGATGGTAATAGCTGTAATGTGGGAAGCCCCTTTGCCAAGGACTTCCTGCCCAAGATGG 17075 Query 2622 AGGATGGCACCCTGCAGGCTGGCCCAGGAGGTGCCAGTGGGCCTCGTGCCCTGGAAATAA 2681 ||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| | Sbjct 17074 AGGATGGCACCCTGCAGGCTGGCCCAGGAGGTGCCAGTGGGCCCCGTGCTCTGGAAATCA 17015 Query 2682 ATAAAATGATTTCTTTTTGGAGGAATGCTCATAAACGTATCAG 2724 | |||||||||||||| |||||||| || |||||||||||||| Sbjct 17014 ACAAAATGATTTCTTTCTGGAGGAACGCCCATAAACGTATCAG 16972 Score = 178 bits (96), Expect = 2e-40 Identities = 124/138 (89%), Gaps = 0/138 (0%) Strand=Plus/Minus Query 2896 GCCTGACCGGGTAGGCAGTGAGTTGAAAGCCATGGTGCAGGCTCCACCTGGCTATGTCCT 2955 ||||||||| |||||||||||||||||||||||||||||||| ||||||||||| ||| Sbjct 15491 GCCTGACCGAGTAGGCAGTGAGTTGAAAGCCATGGTGCAGGCCCCACCTGGCTACACCCT 15432 Query 2956 TGTGGGTGCTGATGTGGACTCACAGGAACTGTGGATCGCAGCTGTACTTGGAGATGCTCA 3015 ||||||||||||||||||||| || || |||||||| |||||||| |||||||| || || Sbjct 15431 TGTGGGTGCTGATGTGGACTCCCAAGAGCTGTGGATTGCAGCTGTGCTTGGAGACGCCCA 15372 Query 3016 CTTTGCTGGGATGCATGG 3033 |||||| || |||||||| Sbjct 15371 CTTTGCCGGCATGCATGG 15354 Score = 106 bits (57), Expect = 9e-19 Identities = 86/100 (86%), Gaps = 2/100 (2%) Strand=Plus/Minus Query 2466 GTGCCCCCAAATCCAGCCAGCCCACG-TATCACCATGGCAACGGACCTTATAATGATGTG 2524 ||| |||||| || |||||||| | |||||||||||||| |||||||| || || ||| Sbjct 17731 GTGGCCCCAAGGACACCCAGCCCA-GCTATCACCATGGCAATGGACCTTACAACGACGTG 17673 Query 2525 AATATCCCTGGTTGCTGGTTTTTCAAGCTGCCTCACAAGG 2564 | |||||||| |||||||||||||||||||||||||||| Sbjct 17672 GACATCCCTGGCTGCTGGTTTTTCAAGCTGCCTCACAAGG 17633 >ref|XM_001234310.1| UniGene infoGene info PREDICTED: Gallus gallus similar to DNA polymerase gamma (LOC770992), mRNA Length=954 Score = 593 bits (321), Expect = 2e-165 Identities = 757/960 (78%), Gaps = 59/960 (6%) Strand=Plus/Plus Query 3059 CTGC-AGGGCAGGAAGAGCAGA-GGCACTGATCTGCACAGCAAGACAGCTGCCACTGTGG 3116 |||| |||| | ||||||| || || || || ||||| ||||| || || ||||| |||| Sbjct 7 CTGCAAGGG-AAGAAGAGC-GACGGGACCGACCTGCATAGCAAAACGGCCGCCACGGTGG 64 Query 3117 GCATCAGCCGAGAGCATGCCAAAATCTTCAACTATGGCCGCATCTATGGGGCTGGGCAGT 3176 |||||||||| ||||| ||||| |||||||||| || |||||||| |||||||||||| Sbjct 65 GCATCAGCCGGGAGCACGCCAAGGTCTTCAACTACGGGCGCATCTACGGGGCTGGGCAGC 124 Query 3177 CCTTTGCTGAGCGCCTACTGATGCAGTTCAACCACAGGCTCACA-AGGCAGGAGGCAGC- 3234 ||||||| ||||| || |||||||||||||| ||| |||| ||| | |||| ||||| | Sbjct 125 CCTTTGCCGAGCGGCTGCTGATGCAGTTCAATCACCGGCTGACACA-GCAGCAGGCA-CG 182 Query 3235 TGAGAAGGCCCAGCAGATGTATGCAGTCACAAAAGGCCTGCGCCGGTATCGGCTGTCTGC 3294 ||||||||| ||||||||||||||||||||||| ||| | || ||| || | || || Sbjct 183 TGAGAAGGCACAGCAGATGTATGCAGTCACAAAGGGCATCCGGAGGTTTC--ATCTCAGC 240 Query 3295 --GGATGGTGAGTGGCTGGTGAAACAGTTGAATCTTCCTGTGGAC-AGGACAGAGGACGG 3351 ||| || |||||||||||||| | || | || |||||||| | | |||| || || Sbjct 241 GAGGAGGGCGAGTGGCTGGTGAAGGAACTGGAGCTGGCTGTGGACAAAG-CAGAAGATGG 299 Query 3352 CT--GG-GTCTCCCTACAAGATCTTC-GAATGATCCGA-AGAGAAG-CTTCAAGGAAGTC 3405 | || ||| || || ||| | | ||| ||||| | ||||||| | | || ||||| Sbjct 300 -TACGGTGTCGGCC--CAGGATGTGCAGAA-GATCC-AGAGAGAAGCCAT-GAGAAAGTC 353 Query 3406 ACG-ATG--GAAGAAGTGGGAGGTAGCCTCTGAACGAGCATGGACAGGGGGCACAGAGTC 3462 || | | |||||||||||| || | || | ||| ||| | || ||||| ||||| Sbjct 354 CCGAAGGAAGAAGAAGTGGGACGTGGTGGCTCACCGAATGTGGGCTGGAGGCACCGAGTC 413 Query 3463 AGAAATGTTTAATAAGCTGGAGAGTATTGC-CATGTCTG-ATACACCAC-GTACCCCAGT 3519 |||||||| || ||||||||||| || || | |||| | | | |||| | ||||| || Sbjct 414 CGAAATGTTCAACAAGCTGGAGAGCATCGCTC-TGTCCGCCT-CGCCACAG-ACCCCGGT 470 Query 3520 ACTGGGCTGCTGC--ATCAGCAGAGCCT-TGGAGCCCT-CAGTTGTCC--AGGGAGAGTT 3573 |||||||| | | |||||||| | || ||||| ||| ||| || || |||| ||||| Sbjct 471 GCTGGGCTG-T-CATATCAGCAG-GGCTCTGGAG-CCTGCAG-TGGCCAAAGGG-GAGTT 524 Query 3574 TATAACCAGTC-GTGTGAACTGGGTGGTACAGAGCTCTGCTGTAGACTACTTACATCTCA 3632 | ||||||| | | |||||||||||||| |||||||| ||||| |||||| | || |||| Sbjct 525 TCTAACCAG-CAGAGTGAACTGGGTGGTGCAGAGCTCAGCTGTTGACTACCTGCACCTCA 583 Query 3633 TGCTTGTGGCCATGAAGTGGCTGTTTGAGGAATTTGCCATTGATGGGCGCTTCTGCATCA 3692 |||| || ||||||||||||| |||||||| | || ||| |||| ||||||||||||| Sbjct 584 TGCTGGTCTCCATGAAGTGGCTCTTTGAGGAGTATGACATAAATGGTCGCTTCTGCATCA 643 Query 3693 GCATCCACGACGAGGTTCGCTACCTGGTGC-GTGAGGAGGACCGCTACCGTGCCGCCCTG 3751 |||||||||||||||| ||||||||||||| | ||| ||||||||||||| || || ||| Sbjct 644 GCATCCACGACGAGGTGCGCTACCTGGTGCAG-GAGCAGGACCGCTACCGGGCAGCACTG 702 Query 3752 GCACTGCAGATCACCAATCTCCTGAC-CAGGTGCATGTTTGCCTATAAGCTGGGTCTGAA 3810 || |||||||||||||| || || || | |||||||||||||||| |||||||| || | Sbjct 703 GCCCTGCAGATCACCAACCTGCTCACAC-GGTGCATGTTTGCCTACAAGCTGGGCCTCCA 761 Query 3811 TGATCTGCCCCAGTCAGTCGCCTTT-TTCAGTGCAGTAGACATTGACCAGTGCCTCAGGA 3869 |||||||| ||||| || || ||| ||||| || || |||||||||| |||| | |||| Sbjct 762 GGATCTGCCGCAGTCCGTGGC-TTTCTTCAGCGCTGTGGACATTGACCGGTGCTTAAGGA 820 Query 3870 AGGAAGTGACCATGGACTGTAAAACTCCTTCTAACCCAACTGGGATGGA-AAGGAGATAT 3928 |||| ||||||||| ||||| ||||| || || ||||| || ||||| ||| || || Sbjct 821 AGGAGGTGACCATGAACTGTGCGACTCCATCAAATCCAACCGGCATGGAGAAGAAG-TAC 879 Query 3929 GGGATCCCCC-AGGGTGAAGCACTGGATATTTACCAGATAATTGAACTCACCAAAGGCTC 3987 || || || | ||| |||||||||||||| || |||||||||||| | ||||||||||| Sbjct 880 GGCATTCCTCGAGGA-GAAGCACTGGATATATATCAGATAATTGAAATAACCAAAGGCTC 938 >dbj|AK207449.1| UniGene info Mus musculus cDNA, clone:Y2G0108A16, strand:plus, reference:ENSEMBL:Mouse-Transcript-ENST:ENSMUST00000036427, based on BLAT search Length=304 Score = 545 bits (295), Expect = 4e-151 Identities = 301/304 (99%), Gaps = 0/304 (0%) Strand=Plus/Plus Query 3948 CACTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACGAAGCCAGC 4007 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1 CACTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACGAAGCCAGC 60 Query 4008 CTGGACCCTAGCTCTGTCTGGAGGTTCTGTATTTGCTCCTGTGGAGCTTTATTGGAGCGG 4067 |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 61 CTGGACGCTAGCTCTGTCTGGAGGTTCTGTATTTGCTCCTGTGGAGCTTTATTGGAGCGG 120 Query 4068 TGCAGGTTCCTAAACTCAGGCTTTCAGATGTGCTTTTTTGCAAAAGGCAGCCATTTTTCT 4127 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 121 TGCAGGTTCCTAAACTCAGGCTTTCAGATGTGCTTTTTTGCAAAAGGCAGCCATTTTTCT 180 Query 4128 GTAGCAGGACCTGCCCAGGAAAGTCCTCCTAACGGAAGGCACAATTCAGTGCGTTCAGAA 4187 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 181 GTAGCAGGACCTGCCCAGGAAAGTCCTCCTAACGGAAGGCACAATTCAGTGCGTTCAGAA 240 Query 4188 CCAGGACACCAACATCAGTGCAGGCTGTGTGACAAGGGGTACTGTTGGGCACAAATGAAG 4247 |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| Sbjct 241 CCAGGACACCAACATCAGTGCAGGCTGTGTGACAAGGGGTACTGTTGGGCCCAAATGAAC 300 Query 4248 CAGA 4251 |||| Sbjct 301 CAGA 304 >gb|U74651.1|HSU74651 Gene info Human DNA polymerase gamma (polg) gene, promoter region and partial cds Length=8699 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 503 bits (272), Expect = 3e-138 Identities = 381/433 (87%), Gaps = 10/433 (2%) Strand=Plus/Plus Query 489 CGCAAATGCCCTCCTCCGAGAATGGGCAGCTGCGGCTCAACCC-TCTGCTCATCCAGATG 547 ||||| ||| ||||| ||| ||||||||||||| |||||| | || |||||||||| Sbjct 5483 CGCAAGTGCTATCCTCGGAGGGCGGGCAGCTGCGGCACAACCCAT-TGGACATCCAGATG 5541 Query 548 TTGTCGAGAGGCCTGCACGAGCAGATCTTCGGGTGCGGCGGGGAAATGCCCGACGAGGCC 607 | |||||||| ||||||||||| ||||||||| || ||||| ||||| | ||||||| Sbjct 5542 CTCTCGAGAGGGCTGCACGAGCAAATCTTCGGGCAAGGAGGGGAGATGCCTGGCGAGGCC 5601 Query 608 GCGGTGCAG-CGCAGCGTAGAGCACCTGCAGAAGCACGGGCTCTGGGGGCAGCCGGCCAC 666 ||||||| | |||||||| ||||||||||||||||||||||||||||||||||| ||| Sbjct 5602 GCGGTGC-GCCGCAGCGTCGAGCACCTGCAGAAGCACGGGCTCTGGGGGCAGCCAGCCGT 5660 Query 667 GCCCTTGCCAGACGTGGAGCTGCGCCTGCC-CCGGCTCTTCGGGGGCAACCTGGACCAGC 725 ||||||||| |||||||||||||||||||| || |||| ||||| |||||||||||||| Sbjct 5661 GCCCTTGCCCGACGTGGAGCTGCGCCTGCCGCCC-CTCTACGGGGACAACCTGGACCAGC 5719 Query 726 ACTTCCGCCTCCTGGCCCAGAAGCAGAGCCTGCCTTACTTGGAGGCGGCCGCCTCGTTAT 785 |||||||||||||||||||||||||||||||||| ||| ||||||||||| || | | | Sbjct 5720 ACTTCCGCCTCCTGGCCCAGAAGCAGAGCCTGCCCTACCTGGAGGCGGCCAACTTGCTGT 5779 Query 786 TGGAGGCCCAATTGCCCCCCGA-GCCCAAGAGCT-GGGCCTGGGCGGAGGGCTGGACCCG 843 || ||||||| ||||||| || |||| | ||| ||||||||||||||||||||||||| Sbjct 5780 TGCAGGCCCAGCTGCCCCC-GAAGCCCCCG-GCTTGGGCCTGGGCGGAGGGCTGGACCCG 5837 Query 844 GTACGGCCCCGAGGGGGAGGCCGAACCCGTGGCCATCCCCGAGGAGCGGGCCCTGGTGTT 903 ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| Sbjct 5838 GTACGGCCCCGAGGGGGAGGCCGTACCCGTGGCCATCCCCGAGGAGCGGGCCCTGGTGTT 5897 Query 904 CGACGTGGAGGTC 916 ||||||||||||| Sbjct 5898 CGACGTGGAGGTC 5910 Score = 261 bits (141), Expect = 2e-65 Identities = 238/283 (84%), Gaps = 13/283 (4%) Strand=Plus/Plus Query 203 AGGACTTGTGTGAGGAAGGCAGGCATGGTGAGACCTATTTCACTGACAGGAGCA-CAGAG 261 |||| ||| | | |||||||||||||||| | ||| |||||||||||||||| | ||||| Sbjct 5147 AGGATTTG-GGGTGGAAGGCAGGCATGGTCAAACCCATTTCACTGACAGGAG-AGCAGAG 5204 Query 262 AGGGGACGCGTCTCTCTCTGA-GTCTTTCGGCCACTAAAAGCAGTCAAGCTGGAGCCCAA 320 | ||||| ||||||||| | ||||| | |||| |||||| || ||||||||||||||| Sbjct 5205 ACAGGACGTGTCTCTCTC-CACGTCTTCCAGCCAGTAAAAGAAGCCAAGCTGGAGCCCAA 5263 Query 321 AGCCCGGTGCCCCGACTCACAGCG-GGGGGCTCCCTGCACCAACCATGAGCCGCCTGCTC 379 |||| |||| | ||||| ||||| ||||| ||||||||||||||||||||||||||||| Sbjct 5264 AGCCAGGTGTTCTGACTCCCAGCGTGGGGG-TCCCTGCACCAACCATGAGCCGCCTGCTC 5322 Query 380 TGGAAGAAGGTGGCTGGCGCCAAGGTCGC-CTCAGGGCCAGTACCAGCAACCGCG-CGCT 437 |||| ||||||||| ||||||| |||| | ||||||| || ||||| ||| | |||| Sbjct 5323 TGGAGGAAGGTGGCCGGCGCCACCGTCGGGC-CAGGGCCGGTTCCAGCT-CCGGGGCGCT 5380 Query 438 GGGTCTCCAGCTCCGTCCTCGACC-CCGTCCCCAGCGACGGGC 479 |||||||||||||||||| || | ||| |||||||||||||| Sbjct 5381 GGGTCTCCAGCTCCGTCCCCG-CGTCCGACCCCAGCGACGGGC 5422 Score = 99.0 bits (53), Expect = 1e-16 Identities = 57/59 (96%), Gaps = 0/59 (0%) Strand=Plus/Plus Query 917 TGCTTGGCAGAGGGAACCTGCCCCACTTTGGCGGTGGCCATATCCCCCTCGGCCTGGTA 975 ||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||| Sbjct 6051 TGCTTGGCAGAGGGAACTTGCCCCACATTGGCGGTGGCCATATCCCCCTCGGCCTGGTA 6109 >gb|AF268974.1|AF268970S5 GeoGene info Mus musculus mitochondrial DNA polymerase gamma (Polg) gene, exons 16, 17, and 18; nuclear gene for mitochondrial product Length=1509 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 462 bits (250), Expect = 5e-126 Identities = 250/250 (100%), Gaps = 0/250 (0%) Strand=Plus/Plus Query 3032 GGCTGCACGGCCTTTGGCTGGATGACTCTGCAGGGCAGGAAGAGCAGAGGCACTGATCTG 3091 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 838 GGCTGCACGGCCTTTGGCTGGATGACTCTGCAGGGCAGGAAGAGCAGAGGCACTGATCTG 897 Query 3092 CACAGCAAGACAGCTGCCACTGTGGGCATCAGCCGAGAGCATGCCAAAATCTTCAACTAT 3151 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 898 CACAGCAAGACAGCTGCCACTGTGGGCATCAGCCGAGAGCATGCCAAAATCTTCAACTAT 957 Query 3152 GGCCGCATCTATGGGGCTGGGCAGTCCTTTGCTGAGCGCCTACTGATGCAGTTCAACCAC 3211 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 958 GGCCGCATCTATGGGGCTGGGCAGTCCTTTGCTGAGCGCCTACTGATGCAGTTCAACCAC 1017 Query 3212 AGGCTCACAAGGCAGGAGGCAGCTGAGAAGGCCCAGCAGATGTATGCAGTCACAAAAGGC 3271 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1018 AGGCTCACAAGGCAGGAGGCAGCTGAGAAGGCCCAGCAGATGTATGCAGTCACAAAAGGC 1077 Query 3272 CTGCGCCGGT 3281 |||||||||| Sbjct 1078 CTGCGCCGGT 1087 Score = 255 bits (138), Expect = 8e-64 Identities = 138/138 (100%), Gaps = 0/138 (0%) Strand=Plus/Plus Query 2896 GCCTGACCGGGTAGGCAGTGAGTTGAAAGCCATGGTGCAGGCTCCACCTGGCTATGTCCT 2955 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 615 GCCTGACCGGGTAGGCAGTGAGTTGAAAGCCATGGTGCAGGCTCCACCTGGCTATGTCCT 674 Query 2956 TGTGGGTGCTGATGTGGACTCACAGGAACTGTGGATCGCAGCTGTACTTGGAGATGCTCA 3015 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 675 TGTGGGTGCTGATGTGGACTCACAGGAACTGTGGATCGCAGCTGTACTTGGAGATGCTCA 734 Query 3016 CTTTGCTGGGATGCATGG 3033 |||||||||||||||||| Sbjct 735 CTTTGCTGGGATGCATGG 752 Score = 209 bits (113), Expect = 7e-50 Identities = 121/124 (97%), Gaps = 3/124 (2%) Strand=Plus/Plus Query 2775 CCA-GGCACCCCAGC-TTCGATGAGGAAGGCCACTATGGGGCCATCCTACCCCAGGTGGT 2832 ||| |||| |||||| |||||||||||||||||||||||||||||||||||||||||||| Sbjct 74 CCAGGGCA-CCCAGCTTTCGATGAGGAAGGCCACTATGGGGCCATCCTACCCCAGGTGGT 132 Query 2833 GACTGCTGGCACCATCACCCGTCGAGCTGTGGAGCCCACGTGGCTCACTGCCAGTAATGC 2892 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 133 GACTGCTGGCACCATCACCCGTCGAGCTGTGGAGCCCACGTGGCTCACTGCCAGTAATGC 192 Query 2893 TCGG 2896 |||| Sbjct 193 TCGG 196 >gb|AF268972.1|AF268970S3 Gene info Mus musculus mitochondrial DNA polymerase gamma (Polg) gene, exons 4 through 10; nuclear gene for mitochondrial product Length=3209 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 435 bits (235), Expect = 1e-117 Identities = 237/238 (99%), Gaps = 0/238 (0%) Strand=Plus/Plus Query 2019 GGTGGTACCGGAAGCTCTGCCCTCGACTAGATGACCCTGCCTGGGCTCCCGGCCCCAGCC 2078 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2573 GGTGGTACCGGCAGCTCTGCCCTCGACTAGATGACCCTGCCTGGGCTCCCGGCCCCAGCC 2632 Query 2079 TCCTCAGCCTGCAAATGCGGGTCACTCCTAAGCTCATGGCACTGACCTGGGATGGTTTTC 2138 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2633 TCCTCAGCCTGCAAATGCGGGTCACTCCTAAGCTCATGGCACTGACCTGGGATGGTTTTC 2692 Query 2139 CTCTACACTACTCAGACTCTCATGGTTGGGGCTACCTAGTGCCTGGGCGTCGGGATAATC 2198 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2693 CTCTACACTACTCAGACTCTCATGGTTGGGGCTACCTAGTGCCTGGGCGTCGGGATAATC 2752 Query 2199 TGACCGAGCCGCCAGTGAGCCCCACTGTAGAATCCGCTGCAGTAACCTGCCCCTACAG 2256 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2753 TGACCGAGCCGCCAGTGAGCCCCACTGTAGAATCCGCTGCAGTAACCTGCCCCTACAG 2810 Score = 342 bits (185), Expect = 6e-90 Identities = 187/188 (99%), Gaps = 0/188 (0%) Strand=Plus/Plus Query 1559 AGGTGTCCCCACCCAGTGACTCTGGCTGGCATGCTGGAGATGGGTGTGTCCTACCTGCCT 1618 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1112 AGGTGTCCCCACCCAGTGACTCTGGCTGGCATGCTGGAGATGGGTGTGTCCTACCTGCCT 1171 Query 1619 GTCAACCAGAACTGGGAGCGTTACCTGACAGAGGCACAGAACACATATGAGGAGCTCCAG 1678 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1172 GTCAACCAGAACTGGGAGCGTTACCTGACAGAGGCACAGAACACATATGAGGAGCTCCAG 1231 Query 1679 CGGGAGATGAAGAAGTCGCTGATGGATCTGGCTAATGATGCCTGTCAGTTGCTCTCAGGA 1738 |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| Sbjct 1232 CGGGAGATGAAGAAGTCGTTGATGGATCTGGCTAATGATGCCTGTCAGTTGCTCTCAGGA 1291 Query 1739 GAGAGGTA 1746 |||||||| Sbjct 1292 GAGAGGTA 1299 Score = 300 bits (162), Expect = 4e-77 Identities = 167/169 (98%), Gaps = 1/169 (0%) Strand=Plus/Plus Query 1166 CAGGACTCCCGGATGCGTTTTCTCGATACTATGAGCATGCACATGGCCATCTCGGGGCTG 1225 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 247 CAGGACTCCCGGATGCGTTTTCTCGATACTATGAGCATGCACATGGCCATCTCGGGGCTG 306 Query 1226 AGCAGCTTCCAGCGCAGCCTGTGGATGGGAGCCAAGCAGGGAAAGCACAAGA-CCCAGCA 1284 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| Sbjct 307 AGCAGCTTCCAGCGCAGCCTGTGGATGGGAGCCAAGCAGGGAAAGCACAAGAACCCAGCA 366 Query 1285 GTCCACAAAGCGAGGGCAGAAGTCCCCGAGGAAAGCCAATGGTCCAGCG 1333 | ||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 367 GCCCACAAAGCGAGGGCAGAAGTCCCCGAGGAAAGCCAATGGTCCAGCG 415 Score = 279 bits (151), Expect = 5e-71 Identities = 151/151 (100%), Gaps = 0/151 (0%) Strand=Plus/Plus Query 1742 AGGTACAAAGAAGACCCTTGGCTCTGGGACCTAGAATGGGATTTGCAGGAGTTTAAGCAG 1801 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1398 AGGTACAAAGAAGACCCTTGGCTCTGGGACCTAGAATGGGATTTGCAGGAGTTTAAGCAG 1457 Query 1802 AAAAAGGCAAAGAAGGTGAAGAAGCCAGCCTCAGCCAGCAAGTTGCCCATCGAGGGAGCT 1861 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1458 AAAAAGGCAAAGAAGGTGAAGAAGCCAGCCTCAGCCAGCAAGTTGCCCATCGAGGGAGCT 1517 Query 1862 GGGCCCTTTGGGGATCCCATGGATCAGGAAG 1892 ||||||||||||||||||||||||||||||| Sbjct 1518 GGGCCCTTTGGGGATCCCATGGATCAGGAAG 1548 Score = 270 bits (146), Expect = 3e-68 Identities = 146/146 (100%), Gaps = 0/146 (0%) Strand=Plus/Plus Query 1336 CTCATCTTGGGACTGGATGGATATCAGCAGTGCCAATAATCTTGCAGATGTGCACAACCT 1395 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 576 CTCATCTTGGGACTGGATGGATATCAGCAGTGCCAATAATCTTGCAGATGTGCACAACCT 635 Query 1396 TTATGTGGGGGGACCTCCCTTAGAGAAGGAGCCTCGGGAGCTGTTCGTCAAAGGCAGCAT 1455 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 636 TTATGTGGGGGGACCTCCCTTAGAGAAGGAGCCTCGGGAGCTGTTCGTCAAAGGCAGCAT 695 Query 1456 GAGGGATATCCGAGAGAACTTCCAGG 1481 |||||||||||||||||||||||||| Sbjct 696 GAGGGATATCCGAGAGAACTTCCAGG 721 Score = 243 bits (131), Expect = 7e-60 Identities = 131/131 (100%), Gaps = 0/131 (0%) Strand=Plus/Plus Query 1891 AGATCCTGGCCCGCCCAGCGAGGAGGAGGAGCTTCAGCGAAGTGTAACAGCCCACAACCG 1950 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1683 AGATCCTGGCCCGCCCAGCGAGGAGGAGGAGCTTCAGCGAAGTGTAACAGCCCACAACCG 1742 Query 1951 GTTACAGCAGCTGAGGAGCACCACGGACCTCCTGCCTAAGCGACCCCAGCACCTTCCAGG 2010 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1743 GTTACAGCAGCTGAGGAGCACCACGGACCTCCTGCCTAAGCGACCCCAGCACCTTCCAGG 1802 Query 2011 ACACCCTGGGT 2021 ||||||||||| Sbjct 1803 ACACCCTGGGT 1813 Score = 158 bits (85), Expect = 2e-34 Identities = 85/85 (100%), Gaps = 0/85 (0%) Strand=Plus/Plus Query 1479 AGGATCTGATGCAGTACTGCGCCCGTGATGTGTGGGCCACCTTTGAGGTTTTCCAGCAGC 1538 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 846 AGGATCTGATGCAGTACTGCGCCCGTGATGTGTGGGCCACCTTTGAGGTTTTCCAGCAGC 905 Query 1539 AGCTGCCACTCTTCTTGGAGAGGTG 1563 ||||||||||||||||||||||||| Sbjct 906 AGCTGCCACTCTTCTTGGAGAGGTG 930 >dbj|AK199644.1| UniGene infoGene info Mus musculus cDNA, clone:Y1G0131O21, strand:minus, reference:ENSEMBL:Mouse-Transcript-ENST:ENSMUST00000036427, based on BLAT search Length=231 Score = 409 bits (221), Expect = 6e-110 Identities = 228/231 (98%), Gaps = 2/231 (0%) Strand=Plus/Plus Query 2490 CGTATCACCATGGCAACGGACCTTATAATGATGTGAATA-TCCCTGGTTGCTGGTTTTTC 2548 ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| Sbjct 1 CGTATCACCATGGCAACGGACCTTATAATGATGTGAATAGCCCCTGGTTGCTGGTTTTTC 60 Query 2549 AAGCTGCCTCACAAGGACGGTAACAACTACAATGTGGGCAGTCCCTTTGCCAAAGATTTC 2608 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 61 AAGCTGCCTCACAAGGACGGTAACAACTACAATGTGGGCAGTCCCTTTGCCAAAGATTTC 120 Query 2609 CTGCCCAAGATGGAGGATGGCA-CCCTGCAGGCTGGCCCAGGAGGTGCCAGTGGGCCTCG 2667 |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct 121 CTGCCCAAGATGGAGGATGGCAGCCCTGCAGGCTGGCCCAGGAGGTGCCAGTGGGCCTCG 180 Query 2668 TGCCCTGGAAATAAATAAAATGATTTCTTTTTGGAGGAATGCTCATAAACG 2718 ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 181 TGCCCTGGAAATAAATAAAATGATTTCTTTTTGGAGGAATGCTCATAAACG 231 >gb|AF268971.1|AF268970S2 Gene info Mus musculus mitochondrial DNA polymerase gamma (Polg) gene, exon 3; nuclear gene for mitochondrial product Length=1460 Score = 366 bits (198), Expect = 4e-97 Identities = 198/198 (100%), Gaps = 0/198 (0%) Strand=Plus/Plus Query 972 GGTATTCCTGGTGCAGCCGGCGGCTGGTGGAAGAGCGTTACTCTTGGACCAGCCAGCTAT 1031 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 847 GGTATTCCTGGTGCAGCCGGCGGCTGGTGGAAGAGCGTTACTCTTGGACCAGCCAGCTAT 906 Query 1032 CGCCGGCTGACCTAATCCCTTTGGGGGGCTCCACTAGTGCCAGCAGCTCCACCAAGCAGG 1091 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 907 CGCCGGCTGACCTAATCCCTTTGGGGGGCTCCACTAGTGCCAGCAGCTCCACCAAGCAGG 966 Query 1092 ATGGGCAGGAACAGTTAGTGGTGGGGCACAATGTTTCCTTTGACCGAGCCCATATCAGGG 1151 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 967 ATGGGCAGGAACAGTTAGTGGTGGGGCACAATGTTTCCTTTGACCGAGCCCATATCAGGG 1026 Query 1152 AACAGTATCTGATTCAGG 1169 |||||||||||||||||| Sbjct 1027 AACAGTATCTGATTCAGG 1044 >ref|XM_001092826.1| UniGene infoGene info PREDICTED: Macaca mulatta similar to CG13745-PA, transcript variant 2 (LOC699878), mRNA Length=4802 Score = 311 bits (168), Expect = 2e-80 Identities = 355/438 (81%), Gaps = 41/438 (9%) Strand=Plus/Minus Query 3941 GGTGAAGCACTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACGA 4000 |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4374 GGTGAAGCGCTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACGA 4315 Query 4001 AGCCAGCCTGGACCCTAGCTCTGTCTGGAGGTTCTGTATTTGCTCCTGTGGAGCTTTATT 4060 |||||||||||||| |||| ||| ||||||| |||||||||||||| |||||||| || Sbjct 4314 AGCCAGCCTGGACCATAGCACTGCCTGGAGGCTCTGTATTTGCTCCCATGGAGCTTCATC 4255 Query 4061 GGAGCGGTGCAGGTTCCTAAACTCAGGCTTTCAGATGTGCTTTTTTGCAAAAGG-C---- 4115 || |||||||||| ||| |||||||||||||||| |||||||||| |||||||| | Sbjct 4254 GGGGCGGTGCAGGCTCCCAAACTCAGGCTTTCAGCTGTGCTTTTT-GCAAAAGGGCTTGC 4196 Query 4116 --A-G-CCA----TTTTTCTGTAGCAGGACCTGCCCAGGAA-AGTCCTCCTAACGGAAGG 4166 | | ||| |||||| ||||||||||||||| || || | |||| ||||| ||||| Sbjct 4195 CTAAGGCCAGCCATTTTTCAGTAGCAGGACCTGCCAAG-AAGATTCCTTCTAACTGAAGG 4137 Query 4167 --CAC---AATTCAGTGCGTTCAGAACCAGGACACCAACATCAGTGCAGGCTGT-GTGAC 4220 || ||||||||| ||||||||| | || |||||||| ||| |||||| | ||| Sbjct 4136 TGCAGTTGAATTCAGTGGGTTCAGAACTAAGATGCCAACATCGGTGTGGGCTGTAG-GAC 4078 Query 4221 AAGGGGTA------CT-GTTGGGCACAAATGAAGCAGATGCCCCAAAGGTCACATTAACT 4273 |||||| | || |||||| | ||| |||||||| ||||||||| ||||||||||| Sbjct 4077 AAGGGGCATTGTTGCTTGTTGGGTAAAAACGAAGCAGAAGCCCCAAAGTTCACATTAACT 4018 Query 4274 CAGGCATTTC-TTCCT-----CCT---CTTCTTGGCTGGTTCTCTGTCCTGCTGTGTATG 4324 |||||||||| || | ||| |||||||||||||||| ||| ||| | ||| Sbjct 4017 CAGGCATTTCATTTATTTTTTCCTTTTCTTCTTGGCTGGTTCTTTGTTCTGTTCACCATG 3958 Query 4325 -TGCTGATGCAGTGCCCT 4341 | ||||||||||||||| Sbjct 3957 CT-CTGATGCAGTGCCCT 3941 >ref|XM_001093053.1| UniGene infoGene info PREDICTED: Macaca mulatta similar to CG13745-PA, transcript variant 3 (LOC699878), mRNA Length=4715 Score = 311 bits (168), Expect = 2e-80 Identities = 355/438 (81%), Gaps = 41/438 (9%) Strand=Plus/Minus Query 3941 GGTGAAGCACTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACGA 4000 |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4287 GGTGAAGCGCTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACGA 4228 Query 4001 AGCCAGCCTGGACCCTAGCTCTGTCTGGAGGTTCTGTATTTGCTCCTGTGGAGCTTTATT 4060 |||||||||||||| |||| ||| ||||||| |||||||||||||| |||||||| || Sbjct 4227 AGCCAGCCTGGACCATAGCACTGCCTGGAGGCTCTGTATTTGCTCCCATGGAGCTTCATC 4168 Query 4061 GGAGCGGTGCAGGTTCCTAAACTCAGGCTTTCAGATGTGCTTTTTTGCAAAAGG-C---- 4115 || |||||||||| ||| |||||||||||||||| |||||||||| |||||||| | Sbjct 4167 GGGGCGGTGCAGGCTCCCAAACTCAGGCTTTCAGCTGTGCTTTTT-GCAAAAGGGCTTGC 4109 Query 4116 --A-G-CCA----TTTTTCTGTAGCAGGACCTGCCCAGGAA-AGTCCTCCTAACGGAAGG 4166 | | ||| |||||| ||||||||||||||| || || | |||| ||||| ||||| Sbjct 4108 CTAAGGCCAGCCATTTTTCAGTAGCAGGACCTGCCAAG-AAGATTCCTTCTAACTGAAGG 4050 Query 4167 --CAC---AATTCAGTGCGTTCAGAACCAGGACACCAACATCAGTGCAGGCTGT-GTGAC 4220 || ||||||||| ||||||||| | || |||||||| ||| |||||| | ||| Sbjct 4049 TGCAGTTGAATTCAGTGGGTTCAGAACTAAGATGCCAACATCGGTGTGGGCTGTAG-GAC 3991 Query 4221 AAGGGGTA------CT-GTTGGGCACAAATGAAGCAGATGCCCCAAAGGTCACATTAACT 4273 |||||| | || |||||| | ||| |||||||| ||||||||| ||||||||||| Sbjct 3990 AAGGGGCATTGTTGCTTGTTGGGTAAAAACGAAGCAGAAGCCCCAAAGTTCACATTAACT 3931 Query 4274 CAGGCATTTC-TTCCT-----CCT---CTTCTTGGCTGGTTCTCTGTCCTGCTGTGTATG 4324 |||||||||| || | ||| |||||||||||||||| ||| ||| | ||| Sbjct 3930 CAGGCATTTCATTTATTTTTTCCTTTTCTTCTTGGCTGGTTCTTTGTTCTGTTCACCATG 3871 Query 4325 -TGCTGATGCAGTGCCCT 4341 | ||||||||||||||| Sbjct 3870 CT-CTGATGCAGTGCCCT 3854 >ref|XM_001092590.1| UniGene infoGene info PREDICTED: Macaca mulatta similar to CG13745-PA, transcript variant 1 (LOC699878), mRNA Length=4693 Score = 311 bits (168), Expect = 2e-80 Identities = 355/438 (81%), Gaps = 41/438 (9%) Strand=Plus/Minus Query 3941 GGTGAAGCACTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACGA 4000 |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4265 GGTGAAGCGCTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACGA 4206 Query 4001 AGCCAGCCTGGACCCTAGCTCTGTCTGGAGGTTCTGTATTTGCTCCTGTGGAGCTTTATT 4060 |||||||||||||| |||| ||| ||||||| |||||||||||||| |||||||| || Sbjct 4205 AGCCAGCCTGGACCATAGCACTGCCTGGAGGCTCTGTATTTGCTCCCATGGAGCTTCATC 4146 Query 4061 GGAGCGGTGCAGGTTCCTAAACTCAGGCTTTCAGATGTGCTTTTTTGCAAAAGG-C---- 4115 || |||||||||| ||| |||||||||||||||| |||||||||| |||||||| | Sbjct 4145 GGGGCGGTGCAGGCTCCCAAACTCAGGCTTTCAGCTGTGCTTTTT-GCAAAAGGGCTTGC 4087 Query 4116 --A-G-CCA----TTTTTCTGTAGCAGGACCTGCCCAGGAA-AGTCCTCCTAACGGAAGG 4166 | | ||| |||||| ||||||||||||||| || || | |||| ||||| ||||| Sbjct 4086 CTAAGGCCAGCCATTTTTCAGTAGCAGGACCTGCCAAG-AAGATTCCTTCTAACTGAAGG 4028 Query 4167 --CAC---AATTCAGTGCGTTCAGAACCAGGACACCAACATCAGTGCAGGCTGT-GTGAC 4220 || ||||||||| ||||||||| | || |||||||| ||| |||||| | ||| Sbjct 4027 TGCAGTTGAATTCAGTGGGTTCAGAACTAAGATGCCAACATCGGTGTGGGCTGTAG-GAC 3969 Query 4221 AAGGGGTA------CT-GTTGGGCACAAATGAAGCAGATGCCCCAAAGGTCACATTAACT 4273 |||||| | || |||||| | ||| |||||||| ||||||||| ||||||||||| Sbjct 3968 AAGGGGCATTGTTGCTTGTTGGGTAAAAACGAAGCAGAAGCCCCAAAGTTCACATTAACT 3909 Query 4274 CAGGCATTTC-TTCCT-----CCT---CTTCTTGGCTGGTTCTCTGTCCTGCTGTGTATG 4324 |||||||||| || | ||| |||||||||||||||| ||| ||| | ||| Sbjct 3908 CAGGCATTTCATTTATTTTTTCCTTTTCTTCTTGGCTGGTTCTTTGTTCTGTTCACCATG 3849 Query 4325 -TGCTGATGCAGTGCCCT 4341 | ||||||||||||||| Sbjct 3848 CT-CTGATGCAGTGCCCT 3832 >ref|XM_425079.2| UniGene infoGene info PREDICTED: Gallus gallus polymerase (DNA directed), gamma (POLG), mRNA Length=1923 Score = 303 bits (164), Expect = 3e-78 Identities = 452/586 (77%), Gaps = 39/586 (6%) Strand=Plus/Plus Query 1167 AGGACTCCCGGATGCGTTTTCTCGATACTATGAGCATGCACATGGCCATCTCGGGGCTGA 1226 ||| ||||||| |||| || || || || ||||||||||||||||||||||||||||| | Sbjct 8 AGGGCTCCCGGGTGCGCTTCCTGGACACCATGAGCATGCACATGGCCATCTCGGGGCTCA 67 Query 1227 GCAG-CTTCCAGCGCAGCCTGTGGATGGGAGCCAAGCAGGGAAAGCAC-AAGAC-C--CA 1281 | | ||||||||||||||| ||||||| |||||||| || ||| | ||| | || Sbjct 68 -CGGGCTTCCAGCGCAGCCTCTGGATGGCCGCCAAGCACGGCAAG-AGGAAGGGGCTGCA 125 Query 1282 GCAG-TCCACAAAGCG-AGGGCAGAAGTCCC-CGAGGAAAGCCAATGGTCCAGCGATCTC 1338 |||| || | ||| | | ||||| | | | || |||||| | || || ||| |||| Sbjct 126 GCAGGTC-AGGCAGCACATGA-AGAAGACACGC-AGCAAAGCCGAGGGGCCGGCGGTCTC 182 Query 1339 ATCTTGGGACTGGATGGATATCAGCAGTGCCAATAATCTTGCAGATGTGCA--CAACCTT 1396 || ||||||||| || | ||||||| ||| || || ||||||||||| || | | Sbjct 183 TTCATGGGACTGGGTGCACGTCAGCAGCATCAACAACCTGGCAGATGTGCATGCA-C-TG 240 Query 1397 TATGTGGG-GGG-ACCTCCCTTAGAGAAGGAGCCTCGGGAGCTGTTCGTCAAAGGCAGCA 1454 || ||||| ||| | | | || |||||||| | || |||||||| || || || | || Sbjct 241 TACGTGGGAGGGGAAC-CGCTGC-AGAAGGAGGCACGAGAGCTGTTTGTTAAGGGGACCA 298 Query 1455 TGAGG-GATATCCGAGAG-AACTTCCAGGATCTGATG-CAGTACTGCGCCCGTGATGTGT 1511 || | || || | || ||||||||||| |||||| | |||||| ||| | ||||| Sbjct 299 TG-GCTGACGTCAG-GAATAACTTCCAGGAGCTGATGTC-GTACTGTGCCAGCGATGTCC 355 Query 1512 GGGCCACCTTTGAGGTTTTCCAGCAGCAGCTGCCACTCTTCTTGGAGAGGTGTCCCCACC 1571 ||||||||| |||||| |||||| |||||||||| |||||| |||||||||| ||||||| Sbjct 356 GGGCCACCTATGAGGTGTTCCAGGAGCAGCTGCCGCTCTTCATGGAGAGGTGCCCCCACC 415 Query 1572 CAGTGAC-TCTGGCTGGCATGCTGGAGATGGGTGTGTCCTACCTGCCTGTCAACCAG-AA 1629 | ||||| | || |||| ||| |||||||||| |||||||||||||| |||||| || || Sbjct 416 CCGTGACGTTTG-CTGGGATGTTGGAGATGGGGGTGTCCTACCTGCCGGTCAAC-AGCAA 473 Query 1630 CTGG-G-AGCGTTACCTG-ACAGAGGCACAGAACACATATGAGGAGCTCCAGCGGGAGAT 1686 |||| | || || ||||| || || || ||| ||| ||||||||||| ||| |||||| Sbjct 474 CTGGAGGAG-GT-ACCTGGAC-GATGCTCAGGGCACCTATGAGGAGCTGCAGAAGGAGAT 530 Query 1687 GAAGAAGTCGCT-GATGGATCTGGCTAATGATGCCTGTCAGTTGCT 1731 ||| ||||| || |||| | ||||| || |||||||| ||| |||| Sbjct 531 GAAAAAGTC-CTTGATGAACCTGGCCAACGATGCCTGCCAGCTGCT 575 >gb|AF268973.1|AF268970S4 Gene info Mus musculus mitochondrial DNA polymerase gamma (Polg) gene, exons 11 through 15; nuclear gene for mitochondrial product Length=2274 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 303 bits (164), Expect = 3e-78 Identities = 169/171 (98%), Gaps = 2/171 (1%) Strand=Plus/Plus Query 2555 CCT-CACAAGGACGGTAACAACTACAATGTGGGCAGTCCCTTTGCCAAAGATTTCCTGCC 2613 ||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1338 CCTCCAC-AGGACGGTAACAACTACAATGTGGGCAGTCCCTTTGCCAAAGATTTCCTGCC 1396 Query 2614 CAAGATGGAGGATGGCACCCTGCAGGCTGGCCCAGGAGGTGCCAGTGGGCCTCGTGCCCT 2673 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1397 CAAGATGGAGGATGGCACCCTGCAGGCTGGCCCAGGAGGTGCCAGTGGGCCTCGTGCCCT 1456 Query 2674 GGAAATAAATAAAATGATTTCTTTTTGGAGGAATGCTCATAAACGTATCAG 2724 ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1457 GGAAATAAATAAAATGATTTCTTTTTGGAGGAATGCTCATAAACGTATCAG 1507 Score = 230 bits (124), Expect = 5e-56 Identities = 126/127 (99%), Gaps = 0/127 (0%) Strand=Plus/Plus Query 2253 ACAGAGCCATCGAGTCCTTATACAGGAAGCACTGCCTTGAACAGGGGAAGCAGCAATTGG 2312 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 111 ACAGAGCCATCGAGTCCTTATACAGGAAGCACTGCCTTGAACAGGGGAAGCAGCAATTGG 170 Query 2313 AGCCCCAGGAGGTAGACCTGGCTGAGGAGTTCTTACTCACTGACAGTAGTGCCATGTGGC 2372 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct 171 AGCCCCAGGAGGTAGACCTGGCTGAGGAGTTCTTACTCACTGACAATAGTGCCATGTGGC 230 Query 2373 AAACGGT 2379 ||||||| Sbjct 231 AAACGGT 237 Score = 204 bits (110), Expect = 3e-48 Identities = 110/110 (100%), Gaps = 0/110 (0%) Strand=Plus/Plus Query 2455 GCCTGCTGCTTGTGCCCCCAAATCCAGCCAGCCCACGTATCACCATGGCAACGGACCTTA 2514 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 794 GCCTGCTGCTTGTGCCCCCAAATCCAGCCAGCCCACGTATCACCATGGCAACGGACCTTA 853 Query 2515 TAATGATGTGAATATCCCTGGTTGCTGGTTTTTCAAGCTGCCTCACAAGG 2564 |||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 854 TAATGATGTGAATATCCCTGGTTGCTGGTTTTTCAAGCTGCCTCACAAGG 903 Score = 147 bits (79), Expect = 5e-31 Identities = 79/79 (100%), Gaps = 0/79 (0%) Strand=Plus/Plus Query 2377 GGTAGAAGAACTGGGCTGCTTAGACGTAGAGGCTGAGGCCAAGATGGAGAATTCAGGGCT 2436 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 430 GGTAGAAGAACTGGGCTGCTTAGACGTAGAGGCTGAGGCCAAGATGGAGAATTCAGGGCT 489 Query 2437 GAGCCAACCTCTAGTTCTG 2455 ||||||||||||||||||| Sbjct 490 GAGCCAACCTCTAGTTCTG 508 Score = 106 bits (57), Expect = 9e-19 Identities = 57/57 (100%), Gaps = 0/57 (0%) Strand=Plus/Plus Query 2722 CAGTTCCCAGATGGTGGTATGGCTCCCCAGGTCAGCTCTGCCCCGGGTTGTGACCAG 2778 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2088 CAGTTCCCAGATGGTGGTATGGCTCCCCAGGTCAGCTCTGCCCCGGGTTGTGACCAG 2144 >ref|NM_018193.2| UniGene infoGeoGene info Homo sapiens Fanconi anemia, complementation group I (FANCI), mRNA Length=4569 Score = 302 bits (163), Expect = 1e-77 Identities = 307/371 (82%), Gaps = 32/371 (8%) Strand=Plus/Minus Query 3941 GGTGAAGCACTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACGA 4000 |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4266 GGTGAAGCGCTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACGA 4207 Query 4001 AGCCAGCCTGGACCCTAGCTCTGTCTGGAGGTTCTGTATTTGCTCCTGTGGAGCTTTATT 4060 |||||||||||||| |||| ||| ||||||| |||||||||||||| ||||||||| || Sbjct 4206 AGCCAGCCTGGACCATAGCACTGCCTGGAGGCTCTGTATTTGCTCCCGTGGAGCTTCATC 4147 Query 4061 GGAGCGGTGCAGGTTCCTAAACTCAGGCTTTCAGATGTGCTTTTTTGCAAAAGG-C---- 4115 || | |||||||| ||| |||||||||||||||| |||||||||| |||||||| | Sbjct 4146 GGGGTGGTGCAGGCTCCCAAACTCAGGCTTTCAGCTGTGCTTTTT-GCAAAAGGGCTTGC 4088 Query 4116 --A-G-CCA----TTTTTCTGTAGCAGGACCTGCCCAGGAA-AGTCCTCCTAACGGAAGG 4166 | | ||| |||||| ||||||||||||||| || || | |||| ||||| ||||| Sbjct 4087 CTAAGGCCAGCCATTTTTCAGTAGCAGGACCTGCCAAG-AAGATTCCTTCTAACTGAAGG 4029 Query 4167 --CAC---AATTCAGTGCGTTCAGAACCAGGACACCAACATCAGTGCAGG-CTGT-GTGA 4219 || ||||||||| ||||||||||| || |||||||| ||| || || | || Sbjct 4028 TGCAGTTGAATTCAGTGGGTTCAGAACCAAGATGCCAACATCGGTGT-GGACTACAG-GA 3971 Query 4220 CAAGGGGTA------CT-GTTGGGCACAAATGAAGCAGATGCCCCAAAGGTCACATTAAC 4272 ||||||| | || |||||| | |||||||||||| ||||||||| |||||||||| Sbjct 3970 CAAGGGGCATTGTTGCTTGTTGGGTAAAAATGAAGCAGAAGCCCCAAAGTTCACATTAAC 3911 Query 4273 TCAGGCATTTC 4283 ||||||||||| Sbjct 3910 TCAGGCATTTC 3900 >dbj|AK027564.1| UniGene infoGeoGene info Homo sapiens cDNA FLJ14658 fis, clone NT2RP2002549 Length=3457 Score = 296 bits (160), Expect = 5e-76 Identities = 307/372 (82%), Gaps = 33/372 (8%) Strand=Plus/Minus Query 3941 GGTGAAGCACTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACGA 4000 |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3154 GGTGAAGCGCTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACGA 3095 Query 4001 AGCCAGCCTGGACCCTAGCTCTGTCTGGAGGTTCTGTATTTGCTCCTGTGGAGCTTTATT 4060 |||||||||||||| |||| ||| ||||||| |||||||||||||| ||||||||| || Sbjct 3094 AGCCAGCCTGGACCATAGCACTGCCTGGAGGCTCTGTATTTGCTCCCGTGGAGCTTCATC 3035 Query 4061 GGAGCGG-TGCAGGTTCCTAAACTCAGGCTTTCAGATGTGCTTTTTTGCAAAAGG-C--- 4115 || | || |||||| ||| |||||||||||||||| |||||||||| |||||||| | Sbjct 3034 GGGGTGGGTGCAGGCTCCCAAACTCAGGCTTTCAGCTGTGCTTTTT-GCAAAAGGGCTTG 2976 Query 4116 ---A-G-CCA----TTTTTCTGTAGCAGGACCTGCCCAGGAA-AGTCCTCCTAACGGAAG 4165 | | ||| |||||| ||||||||||||||| || || | |||| ||||| |||| Sbjct 2975 CCTAAGGCCAGCCATTTTTCAGTAGCAGGACCTGCCAAG-AAGATTCCTTCTAACTGAAG 2917 Query 4166 G--CAC---AATTCAGTGCGTTCAGAACCAGGACACCAACATCAGTGCAGG-CTGT-GTG 4218 | || ||||||||| ||||||||||| || |||||||| ||| || || | | Sbjct 2916 GTGCAGTTGAATTCAGTGGGTTCAGAACCAAGATGCCAACATCGGTGT-GGACTACAG-G 2859 Query 4219 ACAAGGGGTA------CT-GTTGGGCACAAATGAAGCAGATGCCCCAAAGGTCACATTAA 4271 |||||||| | || |||||| | |||||||||||| ||||||||| ||||||||| Sbjct 2858 ACAAGGGGCATTGTTGCTTGTTGGGTAAAAATGAAGCAGAAGCCCCAAAGTTCACATTAA 2799 Query 4272 CTCAGGCATTTC 4283 |||||||||||| Sbjct 2798 CTCAGGCATTTC 2787 >dbj|AB058697.1| UniGene infoGeoGene info Homo sapiens mRNA for KIAA1794 protein, partial cds Length=4671 Score = 296 bits (160), Expect = 5e-76 Identities = 307/372 (82%), Gaps = 33/372 (8%) Strand=Plus/Minus Query 3941 GGTGAAGCACTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACGA 4000 |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4371 GGTGAAGCGCTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACGA 4312 Query 4001 AGCCAGCCTGGACCCTAGCTCTGTCTGGAGGTTCTGTATTTGCTCCTGTGGAGCTTTATT 4060 |||||||||||||| |||| ||| ||||||| |||||||||||||| ||||||||| || Sbjct 4311 AGCCAGCCTGGACCATAGCACTGCCTGGAGGCTCTGTATTTGCTCCCGTGGAGCTTCATC 4252 Query 4061 GGAGCGG-TGCAGGTTCCTAAACTCAGGCTTTCAGATGTGCTTTTTTGCAAAAGG-C--- 4115 || | || |||||| ||| |||||||||||||||| |||||||||| |||||||| | Sbjct 4251 GGGGTGGGTGCAGGCTCCCAAACTCAGGCTTTCAGCTGTGCTTTTT-GCAAAAGGGCTTG 4193 Query 4116 ---A-G-CCA----TTTTTCTGTAGCAGGACCTGCCCAGGAA-AGTCCTCCTAACGGAAG 4165 | | ||| |||||| ||||||||||||||| || || | |||| ||||| |||| Sbjct 4192 CCTAAGGCCAGCCATTTTTCAGTAGCAGGACCTGCCAAG-AAGATTCCTTCTAACTGAAG 4134 Query 4166 G--CAC---AATTCAGTGCGTTCAGAACCAGGACACCAACATCAGTGCAGG-CTGT-GTG 4218 | || ||||||||| ||||||||||| || |||||||| ||| || || | | Sbjct 4133 GTGCAGTTGAATTCAGTGGGTTCAGAACCAAGATGCCAACATCGGTGT-GGACTACAG-G 4076 Query 4219 ACAAGGGGTA------CT-GTTGGGCACAAATGAAGCAGATGCCCCAAAGGTCACATTAA 4271 |||||||| | || |||||| | |||||||||||| ||||||||| ||||||||| Sbjct 4075 ACAAGGGGCATTGTTGCTTGTTGGGTAAAAATGAAGCAGAAGCCCCAAAGTTCACATTAA 4016 Query 4272 CTCAGGCATTTC 4283 |||||||||||| Sbjct 4015 CTCAGGCATTTC 4004 >ref|XM_001166865.1| Gene info PREDICTED: Pan troglodytes similar to KIAA1794 protein, transcript variant 2 (LOC453636), mRNA Length=4839 Score = 291 bits (157), Expect = 2e-74 Identities = 306/372 (82%), Gaps = 34/372 (9%) Strand=Plus/Minus Query 3941 GGTGAAGCACTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACGA 4000 |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4369 GGTGAAGCGCTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACGA 4310 Query 4001 AGCCAGCCTGGACCCTAGCTCTGTCTGGAGGTTCTGTATTTGCTCCTGTGGAGCTTTATT 4060 |||||||||||||| |||| ||| ||||||| |||||||||||||| ||||||||| || Sbjct 4309 AGCCAGCCTGGACCATAGCACTGCCTGGAGGCTCTGTATTTGCTCCCGTGGAGCTTCATC 4250 Query 4061 -GGAGCGGTGCAGGTTCCTAAACTCAGGCTTTCAGATGTGCTTTTTTGCAAAAGG-C--- 4115 || | |||||||| ||| |||||||||||||||| |||||||||| |||||||| | Sbjct 4249 AGG-GTGGTGCAGGCTCCCAAACTCAGGCTTTCAGCTGTGCTTTTT-GCAAAAGGGCTTG 4192 Query 4116 ---A-G-CCA----TTTTTCTGTAGCAGGACCTGCCCAGGAA-AGTCCTCCTAACGGAAG 4165 | | ||| |||||| ||||||||||||||| || || | |||| ||||| |||| Sbjct 4191 CCTAAGGCCAGCCATTTTTCAGTAGCAGGACCTGCCAAG-AAGATTCCTTCTAACTGAAG 4133 Query 4166 G--CAC---AATTCAGTGCGTTCAGAACCAGGACACCAACATCAGTGCAGG-CTGT-GTG 4218 | || ||||||||| ||||||||||| || ||||| || ||| || || | | Sbjct 4132 GTGCAGTTGAATTCAGTGGGTTCAGAACCAAGATGCCAACGTCGGTGT-GGACTACAG-G 4075 Query 4219 ACAAGGGGTA------CT-GTTGGGCACAAATGAAGCAGATGCCCCAAAGGTCACATTAA 4271 |||||||| | || |||||| | |||||||||||| ||||||||| ||||||||| Sbjct 4074 ACAAGGGGCATTGTTGCTCGTTGGGTAAAAATGAAGCAGAAGCCCCAAAGTTCACATTAA 4015 Query 4272 CTCAGGCATTTC 4283 |||||||||||| Sbjct 4014 CTCAGGCATTTC 4003 >ref|XM_001166926.1| Gene info PREDICTED: Pan troglodytes similar to KIAA1794 protein, transcript variant 3 (LOC453636), mRNA Length=4965 Score = 291 bits (157), Expect = 2e-74 Identities = 306/372 (82%), Gaps = 34/372 (9%) Strand=Plus/Minus Query 3941 GGTGAAGCACTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACGA 4000 |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4495 GGTGAAGCGCTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACGA 4436 Query 4001 AGCCAGCCTGGACCCTAGCTCTGTCTGGAGGTTCTGTATTTGCTCCTGTGGAGCTTTATT 4060 |||||||||||||| |||| ||| ||||||| |||||||||||||| ||||||||| || Sbjct 4435 AGCCAGCCTGGACCATAGCACTGCCTGGAGGCTCTGTATTTGCTCCCGTGGAGCTTCATC 4376 Query 4061 -GGAGCGGTGCAGGTTCCTAAACTCAGGCTTTCAGATGTGCTTTTTTGCAAAAGG-C--- 4115 || | |||||||| ||| |||||||||||||||| |||||||||| |||||||| | Sbjct 4375 AGG-GTGGTGCAGGCTCCCAAACTCAGGCTTTCAGCTGTGCTTTTT-GCAAAAGGGCTTG 4318 Query 4116 ---A-G-CCA----TTTTTCTGTAGCAGGACCTGCCCAGGAA-AGTCCTCCTAACGGAAG 4165 | | ||| |||||| ||||||||||||||| || || | |||| ||||| |||| Sbjct 4317 CCTAAGGCCAGCCATTTTTCAGTAGCAGGACCTGCCAAG-AAGATTCCTTCTAACTGAAG 4259 Query 4166 G--CAC---AATTCAGTGCGTTCAGAACCAGGACACCAACATCAGTGCAGG-CTGT-GTG 4218 | || ||||||||| ||||||||||| || ||||| || ||| || || | | Sbjct 4258 GTGCAGTTGAATTCAGTGGGTTCAGAACCAAGATGCCAACGTCGGTGT-GGACTACAG-G 4201 Query 4219 ACAAGGGGTA------CT-GTTGGGCACAAATGAAGCAGATGCCCCAAAGGTCACATTAA 4271 |||||||| | || |||||| | |||||||||||| ||||||||| ||||||||| Sbjct 4200 ACAAGGGGCATTGTTGCTCGTTGGGTAAAAATGAAGCAGAAGCCCCAAAGTTCACATTAA 4141 Query 4272 CTCAGGCATTTC 4283 |||||||||||| Sbjct 4140 CTCAGGCATTTC 4129 >ref|XM_001167075.1| Gene info PREDICTED: Pan troglodytes similar to KIAA1794 protein, transcript variant 7 (LOC453636), mRNA Length=4745 Score = 291 bits (157), Expect = 2e-74 Identities = 306/372 (82%), Gaps = 34/372 (9%) Strand=Plus/Minus Query 3941 GGTGAAGCACTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACGA 4000 |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4275 GGTGAAGCGCTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACGA 4216 Query 4001 AGCCAGCCTGGACCCTAGCTCTGTCTGGAGGTTCTGTATTTGCTCCTGTGGAGCTTTATT 4060 |||||||||||||| |||| ||| ||||||| |||||||||||||| ||||||||| || Sbjct 4215 AGCCAGCCTGGACCATAGCACTGCCTGGAGGCTCTGTATTTGCTCCCGTGGAGCTTCATC 4156 Query 4061 -GGAGCGGTGCAGGTTCCTAAACTCAGGCTTTCAGATGTGCTTTTTTGCAAAAGG-C--- 4115 || | |||||||| ||| |||||||||||||||| |||||||||| |||||||| | Sbjct 4155 AGG-GTGGTGCAGGCTCCCAAACTCAGGCTTTCAGCTGTGCTTTTT-GCAAAAGGGCTTG 4098 Query 4116 ---A-G-CCA----TTTTTCTGTAGCAGGACCTGCCCAGGAA-AGTCCTCCTAACGGAAG 4165 | | ||| |||||| ||||||||||||||| || || | |||| ||||| |||| Sbjct 4097 CCTAAGGCCAGCCATTTTTCAGTAGCAGGACCTGCCAAG-AAGATTCCTTCTAACTGAAG 4039 Query 4166 G--CAC---AATTCAGTGCGTTCAGAACCAGGACACCAACATCAGTGCAGG-CTGT-GTG 4218 | || ||||||||| ||||||||||| || ||||| || ||| || || | | Sbjct 4038 GTGCAGTTGAATTCAGTGGGTTCAGAACCAAGATGCCAACGTCGGTGT-GGACTACAG-G 3981 Query 4219 ACAAGGGGTA------CT-GTTGGGCACAAATGAAGCAGATGCCCCAAAGGTCACATTAA 4271 |||||||| | || |||||| | |||||||||||| ||||||||| ||||||||| Sbjct 3980 ACAAGGGGCATTGTTGCTCGTTGGGTAAAAATGAAGCAGAAGCCCCAAAGTTCACATTAA 3921 Query 4272 CTCAGGCATTTC 4283 |||||||||||| Sbjct 3920 CTCAGGCATTTC 3909 >ref|XM_001166767.1| Gene info PREDICTED: Pan troglodytes similar to KIAA1794 protein, transcript variant 1 (LOC453636), mRNA Length=4817 Score = 291 bits (157), Expect = 2e-74 Identities = 306/372 (82%), Gaps = 34/372 (9%) Strand=Plus/Minus Query 3941 GGTGAAGCACTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACGA 4000 |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4347 GGTGAAGCGCTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACGA 4288 Query 4001 AGCCAGCCTGGACCCTAGCTCTGTCTGGAGGTTCTGTATTTGCTCCTGTGGAGCTTTATT 4060 |||||||||||||| |||| ||| ||||||| |||||||||||||| ||||||||| || Sbjct 4287 AGCCAGCCTGGACCATAGCACTGCCTGGAGGCTCTGTATTTGCTCCCGTGGAGCTTCATC 4228 Query 4061 -GGAGCGGTGCAGGTTCCTAAACTCAGGCTTTCAGATGTGCTTTTTTGCAAAAGG-C--- 4115 || | |||||||| ||| |||||||||||||||| |||||||||| |||||||| | Sbjct 4227 AGG-GTGGTGCAGGCTCCCAAACTCAGGCTTTCAGCTGTGCTTTTT-GCAAAAGGGCTTG 4170 Query 4116 ---A-G-CCA----TTTTTCTGTAGCAGGACCTGCCCAGGAA-AGTCCTCCTAACGGAAG 4165 | | ||| |||||| ||||||||||||||| || || | |||| ||||| |||| Sbjct 4169 CCTAAGGCCAGCCATTTTTCAGTAGCAGGACCTGCCAAG-AAGATTCCTTCTAACTGAAG 4111 Query 4166 G--CAC---AATTCAGTGCGTTCAGAACCAGGACACCAACATCAGTGCAGG-CTGT-GTG 4218 | || ||||||||| ||||||||||| || ||||| || ||| || || | | Sbjct 4110 GTGCAGTTGAATTCAGTGGGTTCAGAACCAAGATGCCAACGTCGGTGT-GGACTACAG-G 4053 Query 4219 ACAAGGGGTA------CT-GTTGGGCACAAATGAAGCAGATGCCCCAAAGGTCACATTAA 4271 |||||||| | || |||||| | |||||||||||| ||||||||| ||||||||| Sbjct 4052 ACAAGGGGCATTGTTGCTCGTTGGGTAAAAATGAAGCAGAAGCCCCAAAGTTCACATTAA 3993 Query 4272 CTCAGGCATTTC 4283 |||||||||||| Sbjct 3992 CTCAGGCATTTC 3981 >ref|XM_510581.2| Gene info PREDICTED: Pan troglodytes similar to KIAA1794 protein, transcript variant 8 (LOC453636), mRNA Length=4938 Score = 291 bits (157), Expect = 2e-74 Identities = 306/372 (82%), Gaps = 34/372 (9%) Strand=Plus/Minus Query 3941 GGTGAAGCACTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACGA 4000 |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4468 GGTGAAGCGCTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACGA 4409 Query 4001 AGCCAGCCTGGACCCTAGCTCTGTCTGGAGGTTCTGTATTTGCTCCTGTGGAGCTTTATT 4060 |||||||||||||| |||| ||| ||||||| |||||||||||||| ||||||||| || Sbjct 4408 AGCCAGCCTGGACCATAGCACTGCCTGGAGGCTCTGTATTTGCTCCCGTGGAGCTTCATC 4349 Query 4061 -GGAGCGGTGCAGGTTCCTAAACTCAGGCTTTCAGATGTGCTTTTTTGCAAAAGG-C--- 4115 || | |||||||| ||| |||||||||||||||| |||||||||| |||||||| | Sbjct 4348 AGG-GTGGTGCAGGCTCCCAAACTCAGGCTTTCAGCTGTGCTTTTT-GCAAAAGGGCTTG 4291 Query 4116 ---A-G-CCA----TTTTTCTGTAGCAGGACCTGCCCAGGAA-AGTCCTCCTAACGGAAG 4165 | | ||| |||||| ||||||||||||||| || || | |||| ||||| |||| Sbjct 4290 CCTAAGGCCAGCCATTTTTCAGTAGCAGGACCTGCCAAG-AAGATTCCTTCTAACTGAAG 4232 Query 4166 G--CAC---AATTCAGTGCGTTCAGAACCAGGACACCAACATCAGTGCAGG-CTGT-GTG 4218 | || ||||||||| ||||||||||| || ||||| || ||| || || | | Sbjct 4231 GTGCAGTTGAATTCAGTGGGTTCAGAACCAAGATGCCAACGTCGGTGT-GGACTACAG-G 4174 Query 4219 ACAAGGGGTA------CT-GTTGGGCACAAATGAAGCAGATGCCCCAAAGGTCACATTAA 4271 |||||||| | || |||||| | |||||||||||| ||||||||| ||||||||| Sbjct 4173 ACAAGGGGCATTGTTGCTCGTTGGGTAAAAATGAAGCAGAAGCCCCAAAGTTCACATTAA 4114 Query 4272 CTCAGGCATTTC 4283 |||||||||||| Sbjct 4113 CTCAGGCATTTC 4102 >ref|XM_001167020.1| Gene info PREDICTED: Pan troglodytes similar to KIAA1794 protein, transcript variant 6 (LOC453636), mRNA Length=4909 Score = 291 bits (157), Expect = 2e-74 Identities = 306/372 (82%), Gaps = 34/372 (9%) Strand=Plus/Minus Query 3941 GGTGAAGCACTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACGA 4000 |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4439 GGTGAAGCGCTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACGA 4380 Query 4001 AGCCAGCCTGGACCCTAGCTCTGTCTGGAGGTTCTGTATTTGCTCCTGTGGAGCTTTATT 4060 |||||||||||||| |||| ||| ||||||| |||||||||||||| ||||||||| || Sbjct 4379 AGCCAGCCTGGACCATAGCACTGCCTGGAGGCTCTGTATTTGCTCCCGTGGAGCTTCATC 4320 Query 4061 -GGAGCGGTGCAGGTTCCTAAACTCAGGCTTTCAGATGTGCTTTTTTGCAAAAGG-C--- 4115 || | |||||||| ||| |||||||||||||||| |||||||||| |||||||| | Sbjct 4319 AGG-GTGGTGCAGGCTCCCAAACTCAGGCTTTCAGCTGTGCTTTTT-GCAAAAGGGCTTG 4262 Query 4116 ---A-G-CCA----TTTTTCTGTAGCAGGACCTGCCCAGGAA-AGTCCTCCTAACGGAAG 4165 | | ||| |||||| ||||||||||||||| || || | |||| ||||| |||| Sbjct 4261 CCTAAGGCCAGCCATTTTTCAGTAGCAGGACCTGCCAAG-AAGATTCCTTCTAACTGAAG 4203 Query 4166 G--CAC---AATTCAGTGCGTTCAGAACCAGGACACCAACATCAGTGCAGG-CTGT-GTG 4218 | || ||||||||| ||||||||||| || ||||| || ||| || || | | Sbjct 4202 GTGCAGTTGAATTCAGTGGGTTCAGAACCAAGATGCCAACGTCGGTGT-GGACTACAG-G 4145 Query 4219 ACAAGGGGTA------CT-GTTGGGCACAAATGAAGCAGATGCCCCAAAGGTCACATTAA 4271 |||||||| | || |||||| | |||||||||||| ||||||||| ||||||||| Sbjct 4144 ACAAGGGGCATTGTTGCTCGTTGGGTAAAAATGAAGCAGAAGCCCCAAAGTTCACATTAA 4085 Query 4272 CTCAGGCATTTC 4283 |||||||||||| Sbjct 4084 CTCAGGCATTTC 4073 >ref|XM_001166991.1| Gene info PREDICTED: Pan troglodytes similar to KIAA1794 protein, transcript variant 5 (LOC453636), mRNA Length=5006 Score = 291 bits (157), Expect = 2e-74 Identities = 306/372 (82%), Gaps = 34/372 (9%) Strand=Plus/Minus Query 3941 GGTGAAGCACTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACGA 4000 |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4536 GGTGAAGCGCTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACGA 4477 Query 4001 AGCCAGCCTGGACCCTAGCTCTGTCTGGAGGTTCTGTATTTGCTCCTGTGGAGCTTTATT 4060 |||||||||||||| |||| ||| ||||||| |||||||||||||| ||||||||| || Sbjct 4476 AGCCAGCCTGGACCATAGCACTGCCTGGAGGCTCTGTATTTGCTCCCGTGGAGCTTCATC 4417 Query 4061 -GGAGCGGTGCAGGTTCCTAAACTCAGGCTTTCAGATGTGCTTTTTTGCAAAAGG-C--- 4115 || | |||||||| ||| |||||||||||||||| |||||||||| |||||||| | Sbjct 4416 AGG-GTGGTGCAGGCTCCCAAACTCAGGCTTTCAGCTGTGCTTTTT-GCAAAAGGGCTTG 4359 Query 4116 ---A-G-CCA----TTTTTCTGTAGCAGGACCTGCCCAGGAA-AGTCCTCCTAACGGAAG 4165 | | ||| |||||| ||||||||||||||| || || | |||| ||||| |||| Sbjct 4358 CCTAAGGCCAGCCATTTTTCAGTAGCAGGACCTGCCAAG-AAGATTCCTTCTAACTGAAG 4300 Query 4166 G--CAC---AATTCAGTGCGTTCAGAACCAGGACACCAACATCAGTGCAGG-CTGT-GTG 4218 | || ||||||||| ||||||||||| || ||||| || ||| || || | | Sbjct 4299 GTGCAGTTGAATTCAGTGGGTTCAGAACCAAGATGCCAACGTCGGTGT-GGACTACAG-G 4242 Query 4219 ACAAGGGGTA------CT-GTTGGGCACAAATGAAGCAGATGCCCCAAAGGTCACATTAA 4271 |||||||| | || |||||| | |||||||||||| ||||||||| ||||||||| Sbjct 4241 ACAAGGGGCATTGTTGCTCGTTGGGTAAAAATGAAGCAGAAGCCCCAAAGTTCACATTAA 4182 Query 4272 CTCAGGCATTTC 4283 |||||||||||| Sbjct 4181 CTCAGGCATTTC 4170 >ref|XM_001166960.1| Gene info PREDICTED: Pan troglodytes similar to KIAA1794 protein, transcript variant 4 (LOC453636), mRNA Length=4963 Score = 291 bits (157), Expect = 2e-74 Identities = 306/372 (82%), Gaps = 34/372 (9%) Strand=Plus/Minus Query 3941 GGTGAAGCACTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACGA 4000 |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4493 GGTGAAGCGCTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACGA 4434 Query 4001 AGCCAGCCTGGACCCTAGCTCTGTCTGGAGGTTCTGTATTTGCTCCTGTGGAGCTTTATT 4060 |||||||||||||| |||| ||| ||||||| |||||||||||||| ||||||||| || Sbjct 4433 AGCCAGCCTGGACCATAGCACTGCCTGGAGGCTCTGTATTTGCTCCCGTGGAGCTTCATC 4374 Query 4061 -GGAGCGGTGCAGGTTCCTAAACTCAGGCTTTCAGATGTGCTTTTTTGCAAAAGG-C--- 4115 || | |||||||| ||| |||||||||||||||| |||||||||| |||||||| | Sbjct 4373 AGG-GTGGTGCAGGCTCCCAAACTCAGGCTTTCAGCTGTGCTTTTT-GCAAAAGGGCTTG 4316 Query 4116 ---A-G-CCA----TTTTTCTGTAGCAGGACCTGCCCAGGAA-AGTCCTCCTAACGGAAG 4165 | | ||| |||||| ||||||||||||||| || || | |||| ||||| |||| Sbjct 4315 CCTAAGGCCAGCCATTTTTCAGTAGCAGGACCTGCCAAG-AAGATTCCTTCTAACTGAAG 4257 Query 4166 G--CAC---AATTCAGTGCGTTCAGAACCAGGACACCAACATCAGTGCAGG-CTGT-GTG 4218 | || ||||||||| ||||||||||| || ||||| || ||| || || | | Sbjct 4256 GTGCAGTTGAATTCAGTGGGTTCAGAACCAAGATGCCAACGTCGGTGT-GGACTACAG-G 4199 Query 4219 ACAAGGGGTA------CT-GTTGGGCACAAATGAAGCAGATGCCCCAAAGGTCACATTAA 4271 |||||||| | || |||||| | |||||||||||| ||||||||| ||||||||| Sbjct 4198 ACAAGGGGCATTGTTGCTCGTTGGGTAAAAATGAAGCAGAAGCCCCAAAGTTCACATTAA 4139 Query 4272 CTCAGGCATTTC 4283 |||||||||||| Sbjct 4138 CTCAGGCATTTC 4127 >gb|DQ285413.1| Gene info Homo sapiens mitochondrial DNA polymerase gamma (POLG) gene, POLG-1085G allele, exon 3 and partial cds; nuclear gene for mitochondrial product Length=337 Score = 250 bits (135), Expect = 4e-62 Identities = 180/201 (89%), Gaps = 6/201 (2%) Strand=Plus/Plus Query 972 GGTATTCCTGGTGCAGCCGGCGGCTGGTGGAAGAGCGTTACTCTTGGACCAGCCAGCTAT 1031 |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| | Sbjct 74 GGTATTCCTGGTGCAGCCAGCGGCTGGTGGAAGAGCGTTACTCTTGGACCAGCCAGCTGT 133 Query 1032 CGCCGGCTGACCTAATCCCTTTGGGGGGCTCC-ACTAGTGCCAGCAGCTCCACCAAGCAG 1090 ||||||||||||| ||||| ||| || | || ||| ||||||||||| ||||| || || Sbjct 134 CGCCGGCTGACCTCATCCCCCTGGAGGTC-CCTACTGGTGCCAGCAGCCCCACCCAG-AG 191 Query 1091 -GA-TGGGCAGGAACAGTTAGTGGTGGGGCACAATGTTTCCTTTGACCGAGCCCATATCA 1148 || ||| ||||| |||||||||||||||||||||||||||||||||||||| ||||||| Sbjct 192 AGACTGG-CAGGAGCAGTTAGTGGTGGGGCACAATGTTTCCTTTGACCGAGCTCATATCA 250 Query 1149 GGGAACAGTATCTGATTCAGG 1169 |||| ||||| ||||| |||| Sbjct 251 GGGAGCAGTACCTGATCCAGG 271 >gb|DQ285412.1| Gene info Homo sapiens mitochondrial DNA polymerase gamma (POLG) gene, POLG-1085C allele, exon 3 and partial cds; nuclear gene for mitochondrial product Length=337 Score = 244 bits (132), Expect = 2e-60 Identities = 179/201 (89%), Gaps = 6/201 (2%) Strand=Plus/Plus Query 972 GGTATTCCTGGTGCAGCCGGCGGCTGGTGGAAGAGCGTTACTCTTGGACCAGCCAGCTAT 1031 |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| | Sbjct 74 GGTATTCCTGGTGCAGCCAGCGGCTGGTGGAAGAGCGTTACTCTTGGACCAGCCAGCTGT 133 Query 1032 CGCCGGCTGACCTAATCCCTTTGGGGGGCTCC-ACTAGTGCCAGCAGCTCCACCAAGCAG 1090 ||||||||||||| ||||| ||| || | || ||| ||||||||||| ||||| || || Sbjct 134 CGCCGGCTGACCTCATCCCCCTGGAGGTC-CCTACTGGTGCCAGCAGCCCCACCCAG-AG 191 Query 1091 -GA-TGGGCAGGAACAGTTAGTGGTGGGGCACAATGTTTCCTTTGACCGAGCCCATATCA 1148 || ||| ||||| ||||||||||||| |||||||||||||||||||||||| ||||||| Sbjct 192 AGACTGG-CAGGAGCAGTTAGTGGTGGCGCACAATGTTTCCTTTGACCGAGCTCATATCA 250 Query 1149 GGGAACAGTATCTGATTCAGG 1169 |||| ||||| ||||| |||| Sbjct 251 GGGAGCAGTACCTGATCCAGG 271 >ref|XM_600723.3| UniGene infoGene info PREDICTED: Bos taurus hypothetical LOC522442 (LOC522442), mRNA Length=4407 Score = 239 bits (129), Expect = 8e-59 Identities = 346/441 (78%), Gaps = 53/441 (12%) Strand=Plus/Minus Query 3941 GGTGAAGCACTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCTTGGAAAAACGA 4000 |||||||| ||||||||||||||||||||||||||||||||||||||| |||| ||| || Sbjct 4149 GGTGAAGCGCTGGATATTTACCAGATAATTGAACTCACCAAAGGCTCCCTGGAGAAATGA 4090 Query 4001 AGCCAGCCTGGACCCTAGCTCTGTCTGGAGGTTCTGTATTTGCTCCTGTGGAGCTTTATT 4060 ||||||||||||| |||| ||| ||||||| |||||||||||||| |||||||| ||| Sbjct 4089 AGCCAGCCTGGACTATAGCCCTGCCTGGAGGCTCTGTATTTGCTCCCATGGAGCTTCATT 4030 Query 4061 GGAGCGGTGCAGGTTCCTAAA-CTCAGGCTTTCAGATGTGCTTTTTTGCAAAAGG-C--- 4115 || || ||||||| ||||||| ||||||||||||| | |||||||| |||||||| | Sbjct 4029 GGGGCAGTGCAGGCTCCTAAAACTCAGGCTTTCAGCTCTGCTTTTT-GCAAAAGGGCTGG 3971 Query 4116 ----AG-CCA----TTTTTCTGTAGCAG-GACCTGCCCAGGAAAG-T--CCTCCTAA-CG 4161 || ||| |||||| ||||||| | |||||| || || | | |||| ||| | Sbjct 3970 CCTGAGGCCAGCCATTTTTCAGTAGCAGAG-CCTGCCAAG-AATGATTGCCTC-TAAACT 3914 Query 4162 GAAGGCACAATTCAGTGCGTTCAGAACCAGGACACCAACATCAGTGCAGGCTGT-GTGAC 4220 ||||| ||||| ||| | |||||||| || |||| | |||||||| | | ||| Sbjct 3913 GAAGGTGCAATTGAGT---T-CAGAACCAAGATGCCAATGTG-GTGCAGGCAGCAG-GAC 3860 Query 4221 AAGGGGT-A------CT-GTTGGGCACAAATGAA-GCAGATGCCCCAAAGGTCACATTAA 4271 |||||| | || |||||| | ||| ||| ||||| ||||||||| ||||||||| Sbjct 3859 AAGGGGGCATTGTTGCTTGTTGGGTAAAAA-GAAAGCAGAAGCCCCAAAGTTCACATTAA 3801 Query 4272 CTCAGGCATTTC-TT-CCT----CCT---CTTCTTGGCTGGTTCTCTGTCCTGCTG-TGT 4321 |||||||||||| || ||| ||| |||||||||||||||| ||| |||| | Sbjct 3800 CTCAGGCATTTCATTTCCTTTTTCCTTTTCTTCTTGGCTGGTTCTTTGTTCTGCCCCTC- 3742 Query 4322 ATG-TGCTGATGCAGTGCCCT 4341 ||| | ||||||||||||||| Sbjct 3741 ATGCT-CTGATGCAGTGCCCT 3722 >dbj|AK186656.1| Gene info Mus musculus cDNA, clone:Y0G0138D14, strand:plus, reference:ENSEMBL:Mouse-Transcript-ENST:ENSMUST00000036427, based on BLAT search Length=91 Score = 163 bits (88), Expect = 5e-36 Identities = 90/91 (98%), Gaps = 0/91 (0%) Strand=Plus/Plus Query 2401 CGTAGAGGCTGAGGCCAAGATGGAGAATTCAGGGCTGAGCCAACCTCTAGTTCTGCCTGC 2460 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| Sbjct 1 CGTAGAGGCTGAGGCCAAGATGGAGAATTCAGGGCTGAGCCAACCTCTAGTTCTGGCTGC 60 Query 2461 TGCTTGTGCCCCCAAATCCAGCCAGCCCACG 2491 ||||||||||||||||||||||||||||||| Sbjct 61 TGCTTGTGCCCCCAAATCCAGCCAGCCCACG 91 >dbj|AK204663.1| UniGene infoGene info Mus musculus cDNA, clone:Y1G0149D17, strand:minus, reference:ENSEMBL:Mouse-Transcript-ENST:ENSMUST00000036427, based on BLAT search Length=150 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 152 bits (82), Expect = 1e-32 Identities = 87/89 (97%), Gaps = 1/89 (1%) Strand=Plus/Plus Query 3648 AGTGGCTGT-TTGAGGAATTTGCCATTGATGGGCGCTTCTGCATCAGCATCCACGACGAG 3706 ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 62 AGTGGCTGTGTTGAGGAATTTGCCATTGATGGGCGCTTCTGCATCAGCATCCACGACGAG 121 Query 3707 GTTCGCTACCTGGTGCGTGAGGAGGACCG 3735 ||||||||||||||||| ||||||||||| Sbjct 122 GTTCGCTACCTGGTGCGCGAGGAGGACCG 150 Score = 119 bits (64), Expect = 1e-22 Identities = 64/64 (100%), Gaps = 0/64 (0%) Strand=Plus/Plus Query 3509 CGTACCCCAGTACTGGGCTGCTGCATCAGCAGAGCCTTGGAGCCCTCAGTTGTCCAGGGA 3568 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1 CGTACCCCAGTACTGGGCTGCTGCATCAGCAGAGCCTTGGAGCCCTCAGTTGTCCAGGGA 60 Query 3569 GAGT 3572 |||| Sbjct 61 GAGT 64 >dbj|AK185475.1| UniGene infoGene info Mus musculus cDNA, clone:Y0G0134C24, strand:minus, reference:ENSEMBL:Mouse-Transcript-ENST:ENSMUST00000036427, based on BLAT search Length=149 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 152 bits (82), Expect = 1e-32 Identities = 86/88 (97%), Gaps = 0/88 (0%) Strand=Plus/Plus Query 3648 AGTGGCTGTTTGAGGAATTTGCCATTGATGGGCGCTTCTGCATCAGCATCCACGACGAGG 3707 ||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||| Sbjct 62 AGTGGCTGTTTGAGGAATTTGCCATTGATTGACGCTTCTGCATCAGCATCCACGACGAGG 121 Query 3708 TTCGCTACCTGGTGCGTGAGGAGGACCG 3735 |||||||||||||||||||||||||||| Sbjct 122 TTCGCTACCTGGTGCGTGAGGAGGACCG 149 Score = 119 bits (64), Expect = 1e-22 Identities = 64/64 (100%), Gaps = 0/64 (0%) Strand=Plus/Plus Query 3509 CGTACCCCAGTACTGGGCTGCTGCATCAGCAGAGCCTTGGAGCCCTCAGTTGTCCAGGGA 3568 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1 CGTACCCCAGTACTGGGCTGCTGCATCAGCAGAGCCTTGGAGCCCTCAGTTGTCCAGGGA 60 Query 3569 GAGT 3572 |||| Sbjct 61 GAGT 64
  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS,environmental 
samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Jun 2, 2007  5:48 PM
  Number of letters in database: -698,956,079
  Number of sequences in database:  5,319,389
Lambda     K      H
    1.33    0.621     1.12 
Gapped
Lambda     K      H
    1.33    0.621     1.12 
Matrix: blastn matrix:1 -2
Gap Penalties: Existence: 0, Extension: 0
Number of Sequences: 5319389
Number of Hits to DB: 217292
Number of extensions: 17
Number of successful extensions: 17
Number of sequences better than 10: 7
Number of HSP's better than 10 without gapping: 0
Number of HSP's gapped: 10
Number of HSP's successfully gapped: 10
Length of query: 4596
Length of database: 20775880397
Length adjustment: 34
Effective length of query: 4562
Effective length of database: 20595021171
Effective search space: 93954486582102
Effective search space used: 93954486582102
A: 0
X1: 15 (28.8 bits)
X2: 32 (59.1 bits)
X3: 54 (99.7 bits)
S1: 15 (28.8 bits)
S2: 23 (43.6 bits)