Job Title: Mus musculus methionine sulfoxide reductase...

BLASTN 2.2.16 (Mar-25-2007)
RID: 65YNXUSS012


Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
           5,319,389 sequences; 20,775,880,397 total letters

If you have any problems or questions with the results of this search
please refer to the BLAST FAQs Taxonomy reports

Query=  Mus musculus methionine sulfoxide reductase A (Msra)
Length=1890


Distance tree of resultsNew  
Legend for links to other resources: UniGene GEO Gene Structure Map Viewer Sequences producing significant alignments: (Click headers to sort columns)
Accession Description Max score Total score Query coverage E value Max ident Links
NM_026322.3
Mus musculus methionine sulfoxide reductase A (Msra), mRNA >gb|BC089311.1| Mus musculus methionine sulfoxide reductase A, mRNA (cDNA clone MGC:101976 IMAGE:6412625), complete cds
34913491100%0.0100% UniGene infoGeoGene info
AK049714.1
Mus musculus 12 days embryo spinal cord cDNA, RIKEN full-length enriched library, clone:C530043P13 product:PEPTIDE METHIONINE SULFOXIDE REDUCTASE homolog [Rattus norvegicus], full insert sequence
2669266976%0.0100% UniGene infoGene info
AK009822.1
Mus musculus adult male tongue cDNA, RIKEN full-length enriched library, clone:2310045J23 product:PEPTIDE METHIONINE SULFOXIDE REDUCTASE homolog [Rattus norvegicus], full insert sequence
2460246070%0.0100% UniGene infoGeoGene info
AK002356.1
Mus musculus adult male kidney cDNA, RIKEN full-length enriched library, clone:0610008P03 product:PEPTIDE METHIONINE SULFOXIDE REDUCTASE homolog [Rattus norvegicus], full insert sequence
2444244470%0.099% UniGene infoGeoGene info
AK018338.1
Mus musculus 10 days neonate cerebellum cDNA, RIKEN full-length enriched library, clone:6530413P12 product:similar to PEPTIDE METHIONINE SULFOXIDE REDUCTASE [Rattus norvegicus], full insert sequence
2049204959%0.099% UniGene infoGeoGene info
BC014738.1
Mus musculus methionine sulfoxide reductase A, mRNA (cDNA clone MGC:25961 IMAGE:4239349), complete cds
1766240468%0.0100% UniGene infoGeoGene info
AC166997.1
Mus musculus BAC clone RP23-107H9 from chromosome 14, complete sequence
1351135138%0.0100%
NM_053307.2
Rattus norvegicus methionine sulfoxide reductase A (Msra), mRNA >gb|BC087009.1| Rattus norvegicus methionine sulfoxide reductase A, mRNA (cDNA clone MGC:93315 IMAGE:7107102), complete cds
1277165669%0.090% UniGene infoGeoGene info
AY005464.1
Rattus norvegicus peptide methionine sulfoxide reductase mRNA, complete cds
1009100937%0.092% UniGene infoGeoGene info
AK030278.1
Mus musculus 11 days pregnant adult female ovary and uterus cDNA, RIKEN full-length enriched library, clone:5031404C24 product:methionine sulfoxide reductase A, full insert sequence
734 73421%0.0100% UniGene infoGene info
XM_001138292.1
PREDICTED: Pan troglodytes similar to cytosolic methionine-S-sulfoxide reductase, transcript variant 7 (LOC739556), mRNA
649 64934%0.084% Gene info
XM_001138036.1
PREDICTED: Pan troglodytes similar to cytosolic methionine-S-sulfoxide reductase, transcript variant 4 (LOC739556), mRNA
649 64934%0.084% Gene info
AB220441.1
Macaca fascicularis mRNA, clone QccE-19538: similar to Homo sapiens methionine sulfoxide reductase A (MSRA), NM_012331.2
649 64934%0.084% UniGene info
BC054033.1
Homo sapiens methionine sulfoxide reductase A, mRNA (cDNA clone MGC:64957 IMAGE:6504055), complete cds
638 63834%3e-17984% UniGene infoGene info
AF086925.1
Homo sapiens methionine sulfoxide reductase mRNA, complete cds
638 63834%3e-17984% UniGene infoGene info
NM_012331.2
Homo sapiens methionine sulfoxide reductase A (MSRA), mRNA
638 63834%3e-17984% UniGene infoGeoGene info
AY958429.1
Homo sapiens methionine sulfoxide reductase A1 mRNA, complete cds, alternatively spliced
638 63834%3e-17984% UniGene infoGene info
AJ242973.1
Homo sapiens mRNA for peptide methionine sulfoxide reductase (msrA gene)
638 63834%3e-17984% UniGene infoGeoGene info
XM_001089893.1
PREDICTED: Macaca mulatta similar to Peptide methionine sulfoxide reductase (Protein-methionine-S-oxide reductase) (PMSR) (Peptide Met(O) reductase), transcript variant 3 (MSRA), mRNA
627 62734%6e-17684% UniGene infoGene info
AF183420.1
Homo sapiens peptide methionine sulfoxide reductase mRNA, complete cds
619 61937%1e-17382% UniGene infoGeoGene info
XM_001138120.1
PREDICTED: Pan troglodytes similar to cytosolic methionine-S-sulfoxide reductase, transcript variant 5 (LOC739556), mRNA
617 61730%4e-17386% Gene info
XM_001138207.1
PREDICTED: Pan troglodytes similar to cytosolic methionine-S-sulfoxide reductase, transcript variant 6 (LOC739556), mRNA
617 61730%4e-17386% Gene info
BC047552.1
Homo sapiens methionine sulfoxide reductase A, mRNA (cDNA clone IMAGE:5302099), with apparent retained intron
606 60630%8e-17085% UniGene infoGene info
AY958431.1
Homo sapiens methionine sulfoxide reductase A3 mRNA, complete cds, alternatively spliced
606 60630%8e-17085% UniGene infoGene info
AY958430.1
Homo sapiens methionine sulfoxide reductase A2 mRNA, complete cds, alternatively spliced
606 60630%8e-17085% UniGene infoGene info
AY690665.1
Homo sapiens cytosolic methionine-S-sulfoxide reductase (MSRA) mRNA, complete cds, alternatively spliced
606 60630%8e-17085% UniGene infoGene info
XM_001089777.1
PREDICTED: Macaca mulatta similar to Peptide methionine sulfoxide reductase (Protein-methionine-S-oxide reductase) (PMSR) (Peptide Met(O) reductase), transcript variant 2 (MSRA), mRNA
601 60130%4e-16885% UniGene infoGene info
BC102980.1
Bos taurus methionine sulfoxide reductase A, mRNA (cDNA clone MGC:128238 IMAGE:7985018), complete cds
595 59537%2e-16681% UniGene infoGene info
AC134898.4
Mus musculus BAC clone RP23-478H2 from chromosome 14, complete sequence
590132937%8e-165100%
XM_845008.1
PREDICTED: Canis familiaris similar to Peptide methionine sulfoxide reductase (Protein-methionine-S-oxide reductase) (PMSR) (Peptide Met(O) reductase) (LOC608103), mRNA
588 58830%3e-16485% UniGene infoGene info
BT021044.1
Bos taurus methionine sulfoxide reductase A (MSRA), mRNA, complete cds
584 58437%4e-16381% UniGene infoGene info
NM_174114.2
Bos taurus methionine sulfoxide reductase A (MSRA), mRNA >gb|U37150.1|BTU37150 Bos taurus peptide methionine sulfoxide reductase (msrA) mRNA, complete cds
584 58437%4e-16381% UniGene infoGene info
AK233412.1
Sus scrofa mRNA, clone:LVRM10142H04, expressed in liver
556 55630%8e-15584% UniGene info
AK233136.1
Sus scrofa mRNA, clone:LVRM10087F01, expressed in liver
556 55632%8e-15583% UniGene info
XM_001137694.1
PREDICTED: Pan troglodytes similar to cytosolic methionine-S-sulfoxide reductase, transcript variant 1 (LOC739556), mRNA
468 46825%4e-12884% Gene info
XM_001137955.1
PREDICTED: Pan troglodytes similar to cytosolic methionine-S-sulfoxide reductase, transcript variant 3 (LOC739556), mRNA
403 54128%1e-10885% Gene info
XM_001137861.1
PREDICTED: Pan troglodytes similar to cytosolic methionine-S-sulfoxide reductase, transcript variant 2 (LOC739556), mRNA
403 54128%1e-10885% Gene info
EF191679.1
Taeniopygia guttata clone 0069P0006G11 methionine sulfoxide reductase A variant 2-like mRNA, complete sequence
401 40129%4e-10880% UniGene info
XM_001089547.1
PREDICTED: Macaca mulatta similar to Peptide methionine sulfoxide reductase (Protein-methionine-S-oxide reductase) (PMSR) (Peptide Met(O) reductase), transcript variant 1 (MSRA), mRNA
387 51928%1e-10384% UniGene infoGene info
XM_001381994.1
PREDICTED: Monodelphis domestica similar to peptide methionine sulfoxide reductase (LOC100033156), mRNA
340 34029%9e-9078% Gene info
BC133683.1
Mus musculus cDNA clone IMAGE:40110461
331 3319%5e-87100%
XM_420035.2
PREDICTED: Gallus gallus similar to cytosolic methionine-S-sulfoxide reductase (LOC422027), mRNA
228 22818%7e-5678% UniGene infoGene info
AC154332.2
Mus musculus BAC clone RP23-259P17 from chromosome 14, complete sequence
224 76721%1e-54100%
AF153342.6
Homo sapiens chromosome 8 clone GS1-265m2 map 8p23, complete sequence
156 1565%4e-3492%
AC112673.7
Homo sapiens chromosome 8, clone RP11-212F11, complete sequence
156 1565%4e-3492%
AY958432.1
Homo sapiens methionine sulfoxide reductase gene, complete cds, alternatively spliced
156 2689%4e-3494% Geo
XM_001256201.1
PREDICTED: Bos taurus similar to Chain A, Crystal Structure Of Bovine Peptide Methionine Sulfoxide Reductase (LOC789448), partial mRNA
154 1545%1e-3393% UniGene infoGene info
AC023385.10
Homo sapiens chromosome 8, clone RP11-675P19, complete sequence
111 1113%8e-2194%
AC079200.6
Homo sapiens chromosome 8, clone RP11-1058B24, complete sequence
111 1113%8e-2194%
CP000712.1
Pseudomonas putida F1, complete genome
76.876.88%3e-1076%
Alignments
>ref|NM_026322.3| UniGene infoGeoGene info Mus musculus methionine sulfoxide reductase A (Msra), mRNA gb|BC089311.1| UniGene infoGene info Mus musculus methionine sulfoxide reductase A, mRNA (cDNA clone MGC:101976 IMAGE:6412625), complete cds Length=1890 Score = 3491 bits (1890), Expect = 0.0 Identities = 1890/1890 (100%), Gaps = 0/1890 (0%) Strand=Plus/Plus Query 1 AACGCCCTGGTCATACAGGAGGGCTGTGGAAGTCTATCTGCTGTTCTGAAATGGCCTCAG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1 AACGCCCTGGTCATACAGGAGGGCTGTGGAAGTCTATCTGCTGTTCTGAAATGGCCTCAG 60 Query 61 GCTTCAAGCCTTTCAGAGCCTCCTTGGCCTTCCCAAGGCTGGAATGACTTCTCTCTCTGG 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 61 GCTTCAAGCCTTTCAGAGCCTCCTTGGCCTTCCCAAGGCTGGAATGACTTCTCTCTCTGG 120 Query 121 GAGACAACACTCCATTCTGTAGGGGTGACGTCTGTAGGAAGATCACCGTTTGAAGAAGTG 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 121 GAGACAACACTCCATTCTGTAGGGGTGACGTCTGTAGGAAGATCACCGTTTGAAGAAGTG 180 Query 181 CTGGTGGAAAGACAATTGTGGTCTAGAAAATTCCTGCAGATAATTTATAGGTGACATAAG 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 181 CTGGTGGAAAGACAATTGTGGTCTAGAAAATTCCTGCAGATAATTTATAGGTGACATAAG 240 Query 241 TAAGATTAAACTGAACACTCTTCGAGGAAACTAACACGATGAAGATTAGCAAGGTCGGAT 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 241 TAAGATTAAACTGAACACTCTTCGAGGAAACTAACACGATGAAGATTAGCAAGGTCGGAT 300 Query 301 GGCCTGTGGGGCTGCAAGAAAACCAGACGCTGCTTGAAGGGAAGTGTCTGCTGACAGCGC 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 301 GGCCTGTGGGGCTGCAAGAAAACCAGACGCTGCTTGAAGGGAAGTGTCTGCTGACAGCGC 360 Query 361 ATGCGCATGCCTGGAGCTCAGCTTCGAGATCTTCCTATCTGTGGAGTAAGAAGTGAGTAC 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 361 ATGCGCATGCCTGGAGCTCAGCTTCGAGATCTTCCTATCTGTGGAGTAAGAAGTGAGTAC 420 Query 421 ATCGCACCCGGAACCCTGGCTGCGGAGGTGGAGAAACGGCAGCAACTCTGACCTCCCGCG 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 421 ATCGCACCCGGAACCCTGGCTGCGGAGGTGGAGAAACGGCAGCAACTCTGACCTCCCGCG 480 Query 481 GTGGCGCCCAGCCAGCATCAATTTTGGCCCGCGCGGCTTCACGTACTCTGGGAACTTTGT 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 481 GTGGCGCCCAGCCAGCATCAATTTTGGCCCGCGCGGCTTCACGTACTCTGGGAACTTTGT 540 Query 541 CCCTCAGAGACAGCCAGGCCTGGAGGTCTGCCCCGCGAGACGGACACGCCGCCCATGCTC 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 541 CCCTCAGAGACAGCCAGGCCTGGAGGTCTGCCCCGCGAGACGGACACGCCGCCCATGCTC 600 Query 601 TCCGCCTCTAGAAGGGCTCTCCAGCTCCTCTCTAGCGCCAACCCGGTACGGAGGATGGGC 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 601 TCCGCCTCTAGAAGGGCTCTCCAGCTCCTCTCTAGCGCCAACCCGGTACGGAGGATGGGC 660 Query 661 GACTCAGCTTCGAAAGTCATCTCCGCAGAGGAAGCCTTGCCGGGACGCACCGAGCCGATC 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 661 GACTCAGCTTCGAAAGTCATCTCCGCAGAGGAAGCCTTGCCGGGACGCACCGAGCCGATC 720 Query 721 CCTGTAACAGCCAAACACCATGTCAGTGGCAACAGAACGGTTGAACCTTTCCCAGAGGGA 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 721 CCTGTAACAGCCAAACACCATGTCAGTGGCAACAGAACGGTTGAACCTTTCCCAGAGGGA 780 Query 781 ACACAGATGGCTGTATTTGGAATGGGCTGCTTCTGGGGAGCTGAGCGCAAGTTCTGGGTC 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 781 ACACAGATGGCTGTATTTGGAATGGGCTGCTTCTGGGGAGCTGAGCGCAAGTTCTGGGTC 840 Query 841 TTGAAAGGAGTGTACTCAACCCAAGTGGGCTTTGCAGGAGGCCACACACGCAATCCCACC 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 841 TTGAAAGGAGTGTACTCAACCCAAGTGGGCTTTGCAGGAGGCCACACACGCAATCCCACC 900 Query 901 TACAAAGAGGTCTGCTCAGAAAAAACTGGCCACGCCGAAGTCGTCCGGGTTGTGTACCGG 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 901 TACAAAGAGGTCTGCTCAGAAAAAACTGGCCACGCCGAAGTCGTCCGGGTTGTGTACCGG 960 Query 961 CCAGAGCACATCAGCTTTGAGGAACTGCTCAAGGTCTTCTGGGAGAATCACGACCCGACC 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 961 CCAGAGCACATCAGCTTTGAGGAACTGCTCAAGGTCTTCTGGGAGAATCACGACCCGACC 1020 Query 1021 CAAGGCATGCGCCAAGGCAATGACTTTGGTACACAGTACCGGTCAGCAGTCTATCCCACA 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1021 CAAGGCATGCGCCAAGGCAATGACTTTGGTACACAGTACCGGTCAGCAGTCTATCCCACA 1080 Query 1081 TCCGCCGTGCAGATGGAAGCAGCCCTGAGATCCAAGGAAGAATACCAAAAGGTTCTTTCA 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1081 TCCGCCGTGCAGATGGAAGCAGCCCTGAGATCCAAGGAAGAATACCAAAAGGTTCTTTCA 1140 Query 1141 AAGCATAACTTTGGCCCCATCACCACCGACATCCGAGAGGGACAAGTGTTCTACTATGCC 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1141 AAGCATAACTTTGGCCCCATCACCACCGACATCCGAGAGGGACAAGTGTTCTACTATGCC 1200 Query 1201 GAAGACTACCACCAGCAATACCTGAGCAAGAACCCAGACGGCTACTGTGGCCTCGGGGGT 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1201 GAAGACTACCACCAGCAATACCTGAGCAAGAACCCAGACGGCTACTGTGGCCTCGGGGGT 1260 Query 1261 ACTGGAGTTTCCTGCCCGATGGCCATTAAAAAATAATTTCTCTCCACGAAGCTGTCCCTG 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1261 ACTGGAGTTTCCTGCCCGATGGCCATTAAAAAATAATTTCTCTCCACGAAGCTGTCCCTG 1320 Query 1321 AAGGTTCCATCAACACCATGATTGCTGGATGGAGTGGCACTGCTGTGATTCACATCTGTC 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1321 AAGGTTCCATCAACACCATGATTGCTGGATGGAGTGGCACTGCTGTGATTCACATCTGTC 1380 Query 1381 ACTTTATGCAAAGCACACACACCACACGGACCTTTACATGAATCTGGTTGTTATTGGGGT 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1381 ACTTTATGCAAAGCACACACACCACACGGACCTTTACATGAATCTGGTTGTTATTGGGGT 1440 Query 1441 TTGATTTCCAGAGAGTAGCATGACAAGGTGATACACTGTAATCTGCCTTCTGATCAGTCC 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1441 TTGATTTCCAGAGAGTAGCATGACAAGGTGATACACTGTAATCTGCCTTCTGATCAGTCC 1500 Query 1501 GGGTGGGGACAAATCATGACATTTTAGTGGATTGTTTGGATCTGCTCAGACTGGAAGGAT 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1501 GGGTGGGGACAAATCATGACATTTTAGTGGATTGTTTGGATCTGCTCAGACTGGAAGGAT 1560 Query 1561 GCTGAGGGTTCTGAAGCAGGGGGATGGCCAGGAGAGCACAGGGTACTGGGACCCCTTGGT 1620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1561 GCTGAGGGTTCTGAAGCAGGGGGATGGCCAGGAGAGCACAGGGTACTGGGACCCCTTGGT 1620 Query 1621 CTGTGCTGACATACCTCACCCACTTCCCTGCCCTCGGGTGCCCAATTCATTAGTGTCTAC 1680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1621 CTGTGCTGACATACCTCACCCACTTCCCTGCCCTCGGGTGCCCAATTCATTAGTGTCTAC 1680 Query 1681 AGATCCCATGAATCATTTGCCAAATCGCTTTGCTCTGCTGGCTCTAGATGTGTACTAGGG 1740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1681 AGATCCCATGAATCATTTGCCAAATCGCTTTGCTCTGCTGGCTCTAGATGTGTACTAGGG 1740 Query 1741 GTTTCTCTCCCCCTCCATCCTCTCTGCAGAGAAAAGACAGGAGTGACCTTAATGAATTCT 1800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1741 GTTTCTCTCCCCCTCCATCCTCTCTGCAGAGAAAAGACAGGAGTGACCTTAATGAATTCT 1800 Query 1801 AACATTCTGCTTACAGCTATGATAAAGCTTGTTCTAATAAAAATCTGCAGTTTGGTAATa 1860 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1801 AACATTCTGCTTACAGCTATGATAAAGCTTGTTCTAATAAAAATCTGCAGTTTGGTAATA 1860 Query 1861 aaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 1890 |||||||||||||||||||||||||||||| Sbjct 1861 AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 1890 >dbj|AK049714.1| UniGene infoGene info Mus musculus 12 days embryo spinal cord cDNA, RIKEN full-length enriched library, clone:C530043P13 product:PEPTIDE METHIONINE SULFOXIDE REDUCTASE homolog [Rattus norvegicus], full insert sequence Length=1458 Score = 2669 bits (1445), Expect = 0.0 Identities = 1445/1445 (100%), Gaps = 0/1445 (0%) Strand=Plus/Plus Query 412 AGTGAGTACATCGCACCCGGAACCCTGGCTGCGGAGGTGGAGAAACGGCAGCAACTCTGA 471 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 14 AGTGAGTACATCGCACCCGGAACCCTGGCTGCGGAGGTGGAGAAACGGCAGCAACTCTGA 73 Query 472 CCTCCCGCGGTGGCGCCCAGCCAGCATCAATTTTGGCCCGCGCGGCTTCACGTACTCTGG 531 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 74 CCTCCCGCGGTGGCGCCCAGCCAGCATCAATTTTGGCCCGCGCGGCTTCACGTACTCTGG 133 Query 532 GAACTTTGTCCCTCAGAGACAGCCAGGCCTGGAGGTCTGCCCCGCGAGACGGACACGCCG 591 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 134 GAACTTTGTCCCTCAGAGACAGCCAGGCCTGGAGGTCTGCCCCGCGAGACGGACACGCCG 193 Query 592 CCCATGCTCTCCGCCTCTAGAAGGGCTCTCCAGCTCCTCTCTAGCGCCAACCCGGTACGG 651 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 194 CCCATGCTCTCCGCCTCTAGAAGGGCTCTCCAGCTCCTCTCTAGCGCCAACCCGGTACGG 253 Query 652 AGGATGGGCGACTCAGCTTCGAAAGTCATCTCCGCAGAGGAAGCCTTGCCGGGACGCACC 711 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 254 AGGATGGGCGACTCAGCTTCGAAAGTCATCTCCGCAGAGGAAGCCTTGCCGGGACGCACC 313 Query 712 GAGCCGATCCCTGTAACAGCCAAACACCATGTCAGTGGCAACAGAACGGTTGAACCTTTC 771 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 314 GAGCCGATCCCTGTAACAGCCAAACACCATGTCAGTGGCAACAGAACGGTTGAACCTTTC 373 Query 772 CCAGAGGGAACACAGATGGCTGTATTTGGAATGGGCTGCTTCTGGGGAGCTGAGCGCAAG 831 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 374 CCAGAGGGAACACAGATGGCTGTATTTGGAATGGGCTGCTTCTGGGGAGCTGAGCGCAAG 433 Query 832 TTCTGGGTCTTGAAAGGAGTGTACTCAACCCAAGTGGGCTTTGCAGGAGGCCACACACGC 891 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 434 TTCTGGGTCTTGAAAGGAGTGTACTCAACCCAAGTGGGCTTTGCAGGAGGCCACACACGC 493 Query 892 AATCCCACCTACAAAGAGGTCTGCTCAGAAAAAACTGGCCACGCCGAAGTCGTCCGGGTT 951 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 494 AATCCCACCTACAAAGAGGTCTGCTCAGAAAAAACTGGCCACGCCGAAGTCGTCCGGGTT 553 Query 952 GTGTACCGGCCAGAGCACATCAGCTTTGAGGAACTGCTCAAGGTCTTCTGGGAGAATCAC 1011 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 554 GTGTACCGGCCAGAGCACATCAGCTTTGAGGAACTGCTCAAGGTCTTCTGGGAGAATCAC 613 Query 1012 GACCCGACCCAAGGCATGCGCCAAGGCAATGACTTTGGTACACAGTACCGGTCAGCAGTC 1071 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 614 GACCCGACCCAAGGCATGCGCCAAGGCAATGACTTTGGTACACAGTACCGGTCAGCAGTC 673 Query 1072 TATCCCACATCCGCCGTGCAGATGGAAGCAGCCCTGAGATCCAAGGAAGAATACCAAAAG 1131 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 674 TATCCCACATCCGCCGTGCAGATGGAAGCAGCCCTGAGATCCAAGGAAGAATACCAAAAG 733 Query 1132 GTTCTTTCAAAGCATAACTTTGGCCCCATCACCACCGACATCCGAGAGGGACAAGTGTTC 1191 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 734 GTTCTTTCAAAGCATAACTTTGGCCCCATCACCACCGACATCCGAGAGGGACAAGTGTTC 793 Query 1192 TACTATGCCGAAGACTACCACCAGCAATACCTGAGCAAGAACCCAGACGGCTACTGTGGC 1251 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 794 TACTATGCCGAAGACTACCACCAGCAATACCTGAGCAAGAACCCAGACGGCTACTGTGGC 853 Query 1252 CTCGGGGGTACTGGAGTTTCCTGCCCGATGGCCATTAAAAAATAATTTCTCTCCACGAAG 1311 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 854 CTCGGGGGTACTGGAGTTTCCTGCCCGATGGCCATTAAAAAATAATTTCTCTCCACGAAG 913 Query 1312 CTGTCCCTGAAGGTTCCATCAACACCATGATTGCTGGATGGAGTGGCACTGCTGTGATTC 1371 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 914 CTGTCCCTGAAGGTTCCATCAACACCATGATTGCTGGATGGAGTGGCACTGCTGTGATTC 973 Query 1372 ACATCTGTCACTTTATGCAAAGCACACACACCACACGGACCTTTACATGAATCTGGTTGT 1431 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 974 ACATCTGTCACTTTATGCAAAGCACACACACCACACGGACCTTTACATGAATCTGGTTGT 1033 Query 1432 TATTGGGGTTTGATTTCCAGAGAGTAGCATGACAAGGTGATACACTGTAATCTGCCTTCT 1491 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1034 TATTGGGGTTTGATTTCCAGAGAGTAGCATGACAAGGTGATACACTGTAATCTGCCTTCT 1093 Query 1492 GATCAGTCCGGGTGGGGACAAATCATGACATTTTAGTGGATTGTTTGGATCTGCTCAGAC 1551 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1094 GATCAGTCCGGGTGGGGACAAATCATGACATTTTAGTGGATTGTTTGGATCTGCTCAGAC 1153 Query 1552 TGGAAGGATGCTGAGGGTTCTGAAGCAGGGGGATGGCCAGGAGAGCACAGGGTACTGGGA 1611 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1154 TGGAAGGATGCTGAGGGTTCTGAAGCAGGGGGATGGCCAGGAGAGCACAGGGTACTGGGA 1213 Query 1612 CCCCTTGGTCTGTGCTGACATACCTCACCCACTTCCCTGCCCTCGGGTGCCCAATTCATT 1671 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1214 CCCCTTGGTCTGTGCTGACATACCTCACCCACTTCCCTGCCCTCGGGTGCCCAATTCATT 1273 Query 1672 AGTGTCTACAGATCCCATGAATCATTTGCCAAATCGCTTTGCTCTGCTGGCTCTAGATGT 1731 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1274 AGTGTCTACAGATCCCATGAATCATTTGCCAAATCGCTTTGCTCTGCTGGCTCTAGATGT 1333 Query 1732 GTACTAGGGGTTTCTCTCCCCCTCCATCCTCTCTGCAGAGAAAAGACAGGAGTGACCTTA 1791 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1334 GTACTAGGGGTTTCTCTCCCCCTCCATCCTCTCTGCAGAGAAAAGACAGGAGTGACCTTA 1393 Query 1792 ATGAATTCTAACATTCTGCTTACAGCTATGATAAAGCTTGTTCTAATAAAAATCTGCAGT 1851 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1394 ATGAATTCTAACATTCTGCTTACAGCTATGATAAAGCTTGTTCTAATAAAAATCTGCAGT 1453 Query 1852 TTGGT 1856 ||||| Sbjct 1454 TTGGT 1458 >dbj|AK009822.1| UniGene infoGeoGene info Mus musculus adult male tongue cDNA, RIKEN full-length enriched library, clone:2310045J23 product:PEPTIDE METHIONINE SULFOXIDE REDUCTASE homolog [Rattus norvegicus], full insert sequence Length=1334 Score = 2460 bits (1332), Expect = 0.0 Identities = 1332/1332 (100%), Gaps = 0/1332 (0%) Strand=Plus/Plus Query 525 ACTCTGGGAACTTTGTCCCTCAGAGACAGCCAGGCCTGGAGGTCTGCCCCGCGAGACGGA 584 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3 ACTCTGGGAACTTTGTCCCTCAGAGACAGCCAGGCCTGGAGGTCTGCCCCGCGAGACGGA 62 Query 585 CACGCCGCCCATGCTCTCCGCCTCTAGAAGGGCTCTCCAGCTCCTCTCTAGCGCCAACCC 644 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 63 CACGCCGCCCATGCTCTCCGCCTCTAGAAGGGCTCTCCAGCTCCTCTCTAGCGCCAACCC 122 Query 645 GGTACGGAGGATGGGCGACTCAGCTTCGAAAGTCATCTCCGCAGAGGAAGCCTTGCCGGG 704 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 123 GGTACGGAGGATGGGCGACTCAGCTTCGAAAGTCATCTCCGCAGAGGAAGCCTTGCCGGG 182 Query 705 ACGCACCGAGCCGATCCCTGTAACAGCCAAACACCATGTCAGTGGCAACAGAACGGTTGA 764 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 183 ACGCACCGAGCCGATCCCTGTAACAGCCAAACACCATGTCAGTGGCAACAGAACGGTTGA 242 Query 765 ACCTTTCCCAGAGGGAACACAGATGGCTGTATTTGGAATGGGCTGCTTCTGGGGAGCTGA 824 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 243 ACCTTTCCCAGAGGGAACACAGATGGCTGTATTTGGAATGGGCTGCTTCTGGGGAGCTGA 302 Query 825 GCGCAAGTTCTGGGTCTTGAAAGGAGTGTACTCAACCCAAGTGGGCTTTGCAGGAGGCCA 884 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 303 GCGCAAGTTCTGGGTCTTGAAAGGAGTGTACTCAACCCAAGTGGGCTTTGCAGGAGGCCA 362 Query 885 CACACGCAATCCCACCTACAAAGAGGTCTGCTCAGAAAAAACTGGCCACGCCGAAGTCGT 944 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 363 CACACGCAATCCCACCTACAAAGAGGTCTGCTCAGAAAAAACTGGCCACGCCGAAGTCGT 422 Query 945 CCGGGTTGTGTACCGGCCAGAGCACATCAGCTTTGAGGAACTGCTCAAGGTCTTCTGGGA 1004 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 423 CCGGGTTGTGTACCGGCCAGAGCACATCAGCTTTGAGGAACTGCTCAAGGTCTTCTGGGA 482 Query 1005 GAATCACGACCCGACCCAAGGCATGCGCCAAGGCAATGACTTTGGTACACAGTACCGGTC 1064 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 483 GAATCACGACCCGACCCAAGGCATGCGCCAAGGCAATGACTTTGGTACACAGTACCGGTC 542 Query 1065 AGCAGTCTATCCCACATCCGCCGTGCAGATGGAAGCAGCCCTGAGATCCAAGGAAGAATA 1124 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 543 AGCAGTCTATCCCACATCCGCCGTGCAGATGGAAGCAGCCCTGAGATCCAAGGAAGAATA 602 Query 1125 CCAAAAGGTTCTTTCAAAGCATAACTTTGGCCCCATCACCACCGACATCCGAGAGGGACA 1184 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 603 CCAAAAGGTTCTTTCAAAGCATAACTTTGGCCCCATCACCACCGACATCCGAGAGGGACA 662 Query 1185 AGTGTTCTACTATGCCGAAGACTACCACCAGCAATACCTGAGCAAGAACCCAGACGGCTA 1244 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 663 AGTGTTCTACTATGCCGAAGACTACCACCAGCAATACCTGAGCAAGAACCCAGACGGCTA 722 Query 1245 CTGTGGCCTCGGGGGTACTGGAGTTTCCTGCCCGATGGCCATTAAAAAATAATTTCTCTC 1304 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 723 CTGTGGCCTCGGGGGTACTGGAGTTTCCTGCCCGATGGCCATTAAAAAATAATTTCTCTC 782 Query 1305 CACGAAGCTGTCCCTGAAGGTTCCATCAACACCATGATTGCTGGATGGAGTGGCACTGCT 1364 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 783 CACGAAGCTGTCCCTGAAGGTTCCATCAACACCATGATTGCTGGATGGAGTGGCACTGCT 842 Query 1365 GTGATTCACATCTGTCACTTTATGCAAAGCACACACACCACACGGACCTTTACATGAATC 1424 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 843 GTGATTCACATCTGTCACTTTATGCAAAGCACACACACCACACGGACCTTTACATGAATC 902 Query 1425 TGGTTGTTATTGGGGTTTGATTTCCAGAGAGTAGCATGACAAGGTGATACACTGTAATCT 1484 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 903 TGGTTGTTATTGGGGTTTGATTTCCAGAGAGTAGCATGACAAGGTGATACACTGTAATCT 962 Query 1485 GCCTTCTGATCAGTCCGGGTGGGGACAAATCATGACATTTTAGTGGATTGTTTGGATCTG 1544 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 963 GCCTTCTGATCAGTCCGGGTGGGGACAAATCATGACATTTTAGTGGATTGTTTGGATCTG 1022 Query 1545 CTCAGACTGGAAGGATGCTGAGGGTTCTGAAGCAGGGGGATGGCCAGGAGAGCACAGGGT 1604 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1023 CTCAGACTGGAAGGATGCTGAGGGTTCTGAAGCAGGGGGATGGCCAGGAGAGCACAGGGT 1082 Query 1605 ACTGGGACCCCTTGGTCTGTGCTGACATACCTCACCCACTTCCCTGCCCTCGGGTGCCCA 1664 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1083 ACTGGGACCCCTTGGTCTGTGCTGACATACCTCACCCACTTCCCTGCCCTCGGGTGCCCA 1142 Query 1665 ATTCATTAGTGTCTACAGATCCCATGAATCATTTGCCAAATCGCTTTGCTCTGCTGGCTC 1724 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1143 ATTCATTAGTGTCTACAGATCCCATGAATCATTTGCCAAATCGCTTTGCTCTGCTGGCTC 1202 Query 1725 TAGATGTGTACTAGGGGTTTCTCTCCCCCTCCATCCTCTCTGCAGAGAAAAGACAGGAGT 1784 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1203 TAGATGTGTACTAGGGGTTTCTCTCCCCCTCCATCCTCTCTGCAGAGAAAAGACAGGAGT 1262 Query 1785 GACCTTAATGAATTCTAACATTCTGCTTACAGCTATGATAAAGCTTGTTCTAATAAAAAT 1844 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1263 GACCTTAATGAATTCTAACATTCTGCTTACAGCTATGATAAAGCTTGTTCTAATAAAAAT 1322 Query 1845 CTGCAGTTTGGT 1856 |||||||||||| Sbjct 1323 CTGCAGTTTGGT 1334 >dbj|AK002356.1| UniGene infoGeoGene info Mus musculus adult male kidney cDNA, RIKEN full-length enriched library, clone:0610008P03 product:PEPTIDE METHIONINE SULFOXIDE REDUCTASE homolog [Rattus norvegicus], full insert sequence Length=1337 Score = 2444 bits (1323), Expect = 0.0 Identities = 1333/1337 (99%), Gaps = 4/1337 (0%) Strand=Plus/Plus Query 525 ACTCTGGGAACTTTGTCCCTCAGAGACAGCCAGGCCTGGAGGTCTGCCCCGCGAGACGGA 584 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1 ACTCTGGGAACTTTGTCCCTCAGAGACAGCCAGGCCTGGAGGTCTGCCCCGCGAGACGGA 60 Query 585 CACGCCGCCCATGCTCTCCGCCTCTAGAAGGGCTCTCCAGCTCCTCTCTAGCGCCAACCC 644 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 61 CACGCCGCCCATGCTCTCCGCCTCTAGAAGGGCTCTCCAGCTCCTCTCTAGCGCCAACCC 120 Query 645 GGTACGGA-GGATGGGCGACTCAGCTTCGAAAGTCATCTCCGCAGAGGAAGCCTTGCCGG 703 ||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 121 GGTAC-GAGGGATGGGCGACTCAGCTTCGAAAGTCATCTCCGCAGAGGAAGCCTTGCCGG 179 Query 704 GACGCACCGAGCCGATCCCTGTAACAGCCAAACACCATGTCAGTGGCAACAGAACGGTTG 763 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 180 GACGCACCGAGCCGATCCCTGTAACAGCCAAACACCATGTCAGTGGCAACAGAACGGTTG 239 Query 764 AACCTTTCCCAGAGGGAACACAGATGGCTGTATTTGGAATGGGCTGCTTCTGGGGAGCTG 823 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 240 AACCTTTCCCAGAGGGAACACAGATGGCTGTATTTGGAATGGGCTGCTTCTGGGGAGCTG 299 Query 824 AGCGCAAGTTCTGGGTCTTGAAAGGAGTGTACTCAACCCAAGTGGGCTTTGCAGGAGGCC 883 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 300 AGCGCAAGTTCTGGGTCTTGAAAGGAGTGTACTCAACCCAAGTGGGCTTTGCAGGAGGCC 359 Query 884 ACACACGCAATCCCACCTACAAAGAGGTCTGCTCAGAAAAAACTGGCCACGCCGAAGTCG 943 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 360 ACACACGCAATCCCACCTACAAAGAGGTCTGCTCAGAAAAAACTGGCCACGCCGAAGTCG 419 Query 944 TCCGGGTTGTGTACCGGCCAGAGCACATCAGCTTTGAGGAACTGCTCAAGGTCTTCTGGG 1003 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 420 TCCGGGTTGTGTACCGGCCAGAGCACATCAGCTTTGAGGAACTGCTCAAGGTCTTCTGGG 479 Query 1004 AGAATCACGACCCGACCCAAGGCATGCGCCAAGGCAATGACTTTGGTACACAGTACCGGT 1063 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 480 AGAATCACGACCCGACCCAAGGCATGCGCCAAGGCAATGACTTTGGTACACAGTACCGGT 539 Query 1064 CAGCAGTCTATCCCACATCCGCCGTGCAGATGGAAGCAGCCCTGAGATCCAAGGAAGAAT 1123 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 540 CAGCAGTCTATCCCACATCCGCCGTGCAGATGGAAGCAGCCCTGAGATCCAAGGAAGAAT 599 Query 1124 ACCAAAAGGTTCTTTCAAAGCATAACTTTG-GCCCCATCACCACCGACATCCGAGAGGGA 1182 |||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||| Sbjct 600 ACCAAAAGGTTCTTTCAAAGCATAACTTTGTGCCC-ATCACCACCGACATCCGAGAGGGA 658 Query 1183 CAAGTGTTCTACTATGCCGAAGACTACCACCAGCAATACCTGAGCAAGAACCCAGACGGC 1242 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 659 CAAGTGTTCTACTATGCCGAAGACTACCACCAGCAATACCTGAGCAAGAACCCAGACGGC 718 Query 1243 TACTGTGGCCTCGGGGGTACTGGAGTTTCCTGCCCGATGGCCATTAAAAAATAATTTCTC 1302 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 719 TACTGTGGCCTCGGGGGTACTGGAGTTTCCTGCCCGATGGCCATTAAAAAATAATTTCTC 778 Query 1303 TCCACGAAGCTGTCCCTGAAGGTTCCATCAACACCATGATTGCTGGATGGAGTGGCACTG 1362 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 779 TCCACGAAGCTGTCCCTGAAGGTTCCATCAACACCATGATTGCTGGATGGAGTGGCACTG 838 Query 1363 CTGTGATTCACATCTGTCACTTTATGCAAAGCACACACACCACACGGACCTTTACATGAA 1422 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 839 CTGTGATTCACATCTGTCACTTTATGCAAAGCACACACACCACACGGACCTTTACATGAA 898 Query 1423 TCTGGTTGTTATTGGGGTTTGATTTCCAGAGAGTAGCATGACAAGGTGATACACTGTAAT 1482 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 899 TCTGGTTGTTATTGGGGTTTGATTTCCAGAGAGTAGCATGACAAGGTGATACACTGTAAT 958 Query 1483 CTGCCTTCTGATCAGTCCGGGTGGGGACAAATCATGACATTTTAGTGGATTGTTTGGATC 1542 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 959 CTGCCTTCTGATCAGTCCGGGTGGGGACAAATCATGACATTTTAGTGGATTGTTTGGATC 1018 Query 1543 TGCTCAGACTGGAAGGATGCTGAGGGTTCTGAAGCAGGGGGATGGCCAGGAGAGCACAGG 1602 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1019 TGCTCAGACTGGAAGGATGCTGAGGGTTCTGAAGCAGGGGGATGGCCAGGAGAGCACAGG 1078 Query 1603 GTACTGGGACCCCTTGGTCTGTGCTGACATACCTCACCCACTTCCCTGCCCTCGGGTGCC 1662 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1079 GTACTGGGACCCCTTGGTCTGTGCTGACATACCTCACCCACTTCCCTGCCCTCGGGTGCC 1138 Query 1663 CAATTCATTAGTGTCTACAGATCCCATGAATCATTTGCCAAATCGCTTTGCTCTGCTGGC 1722 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1139 CAATTCATTAGTGTCTACAGATCCCATGAATCATTTGCCAAATCGCTTTGCTCTGCTGGC 1198 Query 1723 TCTAGATGTGTACTAGGGGTTTCTCTCCCCCTCCATCCTCTCTGCAGAGAAAAGACAGGA 1782 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1199 TCTAGATGTGTACTAGGGGTTTCTCTCCCCCTCCATCCTCTCTGCAGAGAAAAGACAGGA 1258 Query 1783 GTGACCTTAATGAATTCTAACATTCTGCTTACAGCTATGATAAAGCTTGTTCTAATAAAA 1842 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1259 GTGACCTTAATGAATTCTAACATTCTGCTTACAGCTATGATAAAGCTTGTTCTAATAAAA 1318 Query 1843 ATCTGCAGTTTGGTAAT 1859 ||||||||||||||||| Sbjct 1319 ATCTGCAGTTTGGTAAT 1335 >dbj|AK018338.1| UniGene infoGeoGene info Mus musculus 10 days neonate cerebellum cDNA, RIKEN full-length enriched library, clone:6530413P12 product:similar to PEPTIDE METHIONINE SULFOXIDE REDUCTASE [Rattus norvegicus], full insert sequence Length=1183 Score = 2049 bits (1109), Expect = 0.0 Identities = 1125/1132 (99%), Gaps = 3/1132 (0%) Strand=Plus/Plus Query 729 AGCCAAACACCATGTCAGTGGCAACAGAACGGTTGAACCTTTCCCAGAGGGAACACAGAT 788 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 52 AGCCAAACACCATGTCAGTGGCAACAGAACGGTTGAACCTTTCCCAGAGGGAACACAGAT 111 Query 789 GGCTGTATTTGGAATGGGCTGCTTCTGGGGAGCTGAGCGCAAGTTCTGGGTCTTGAAAGG 848 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 112 GGCTGTATTTGGAATGGGCTGCTTCTGGGGAGCTGAGCGCAAGTTCTGGGTCTTGAAAGG 171 Query 849 AGTGTACTCAACCCAAGTGGGCTTTGCAGGAGGCCACACACGCAATCCCACCTACAAAGA 908 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 172 AGTGTACTCAACCCAAGTGGGCTTTGCAGGAGGCCACACACGCAATCCCACCTACAAAGA 231 Query 909 GGTCTGCTCAGAAAAAACTGGCCACGCCGAAGTCGTCCGGGTTGTGTACCGGCCAGAGCA 968 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 232 GGTCTGCTCAGAAAAAACTGGCCACGCCGAAGTCGTCCGGGTTGTGTACCGGCCAGAGCA 291 Query 969 CATCAGCTTTGAGGAACTGCTCAAGGTCTTCTGGGAGAATCACGACCCGACCCAAGGCAT 1028 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 292 CATCAGCTTTGAGGAACTGCTCAAGGTCTTCTGGGAGAATCACGACCCGACCCAAGGCAT 351 Query 1029 GCGCCAAGGCAATGACTTTGGTACACAGTACCGGTCAGCAGTCTATCCCACATCCGCCGT 1088 |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| Sbjct 352 GCGCCAAGGCAATGACTTTGGTACACAGTACCCCTCAGCAGTCTATCCCACATCCGCCGT 411 Query 1089 GCAGATGGAAGCAGCCCTGAGATCCAAGGAAGAATACCAAAAGGTTCTTTCAAAGCATAA 1148 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 412 GCAGATGGAAGCAGCCCTGAGATCCAAGGAAGAATACCAAAAGGTTCTTTCAAAGCATAA 471 Query 1149 CTTTGGCCCCATCACCACCGACATCCGAGAGGGACAAGTGTTCTACTATGCCGAAGACTA 1208 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 472 CTTTGGCCCCATCACCACCGACATCCGAGAGGGACAAGTGTTCTACTATGCCGAAGACTA 531 Query 1209 CCACCAGCAATACCTGAGCAAGAACCCAGACGGCTACTGTGGCCTCGGGGGTACTGGAGT 1268 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 532 CCACCAGCAATACCTGAGCAAGAACCCAGACGGCTACTGTGGCCTCGGGGGTACTGGAGT 591 Query 1269 TTCCTGCCCGATGGCCATTAAAAAATAATTTCTCTCCACGAAGCTGTCCCTGAAGGTTCC 1328 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 592 TTCCTGCCCGATGGCCATTAAAAAATAATTTCTCTCCACGAAGCTGTCCCTGAAGGTTCC 651 Query 1329 ATCAACACCATGATTGCTGGATGGAGTGGCACTGCTGTGATTCACATCTGTCACTTTATG 1388 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 652 ATCAACACCATGATTGCTGGATGGAGTGGCACTGCTGTGATTCACATCTGTCACTTTATG 711 Query 1389 CAAAGCACACACACCACACGGACCTTTACATGAATCTGGTTGTTATTGGGGTTTGATTTC 1448 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 712 CAAAGCACACACACCACACGGACCTTTACATGAATCTGGTTGTTATTGGGGTTTGATTTC 771 Query 1449 CAGAGAGTAGCATGACAAGGTGATACACTGTAATCTGCCTTCTGATCAGTCCGGGTGGGG 1508 ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| Sbjct 772 CAGAGAGTAGCATGACAAGGTGATACACTGTAATCTGACTTCTGATCAGTCCGGGTGGGG 831 Query 1509 ACAAATCATGACATTTTAGTGGATTGTTTGGATCTGCTCAGACTGGAAGGATGCTGAGGG 1568 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 832 ACAAATCATGACATTTTAGTGGATTGTTTGGATCTGCTCAGACTGGAAGGATGCTGAGGG 891 Query 1569 TTCTGAAGCAGGGGGATGGCCAGGAGAGCACAGGGTACTGGGACCCCTTGGTCTGTGCTG 1628 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 892 TTCTGAAGCAGGGGGATGGCCAGGAGAGCACAGGGTACTGGGACCCCTTGGTCTGTGCTG 951 Query 1629 ACATACCTCACCCACTTCCCTGCCCTCGGGTGCCCAATTCATTAGTGTCTACAGATCCCA 1688 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 952 ACATACCTCACCCACTTCCCTGCCCTCGGGTGCCCAATTCATTAGTGTCTACAGATCCCA 1011 Query 1689 TGAATCATTTGCCAAA-TCGCTTTGCTCTGCTGGCTCTAGATGTGTACTAGGGGTTTCTC 1747 |||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||| Sbjct 1012 TGAATCATTTGCCAAACT-GCTTTGCTCTGCTGGCTCTAGATGTGTACTGGGGGTTTCTC 1070 Query 1748 TCCCCCTCCATCCTCTCTGCAGAGAAAAGACAGGAGTGACCTTAATGAATTCTAACATTC 1807 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1071 TCCCCCTCCATCCTCTCTGCAGAGAAAAGACAGGAGTGACCTTAATGAATTCTAACATTC 1130 Query 1808 TGCTTACAGCTATGATAAAGCTTGTTCTAATAAAAATCTGCAGTTTGGTAAT 1859 || ||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1131 TG-TTACAGCTATGATAAAGCTTGTTCTAATAAAAATCTGCAGTTTGGTAAT 1181 >gb|BC014738.1| UniGene infoGeoGene info Mus musculus methionine sulfoxide reductase A, mRNA (cDNA clone MGC:25961 IMAGE:4239349), complete cds Length=1300 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 1766 bits (956), Expect = 0.0 Identities = 956/956 (100%), Gaps = 0/956 (0%) Strand=Plus/Plus Query 919 GAAAAAACTGGCCACGCCGAAGTCGTCCGGGTTGTGTACCGGCCAGAGCACATCAGCTTT 978 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 345 GAAAAAACTGGCCACGCCGAAGTCGTCCGGGTTGTGTACCGGCCAGAGCACATCAGCTTT 404 Query 979 GAGGAACTGCTCAAGGTCTTCTGGGAGAATCACGACCCGACCCAAGGCATGCGCCAAGGC 1038 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 405 GAGGAACTGCTCAAGGTCTTCTGGGAGAATCACGACCCGACCCAAGGCATGCGCCAAGGC 464 Query 1039 AATGACTTTGGTACACAGTACCGGTCAGCAGTCTATCCCACATCCGCCGTGCAGATGGAA 1098 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 465 AATGACTTTGGTACACAGTACCGGTCAGCAGTCTATCCCACATCCGCCGTGCAGATGGAA 524 Query 1099 GCAGCCCTGAGATCCAAGGAAGAATACCAAAAGGTTCTTTCAAAGCATAACTTTGGCCCC 1158 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 525 GCAGCCCTGAGATCCAAGGAAGAATACCAAAAGGTTCTTTCAAAGCATAACTTTGGCCCC 584 Query 1159 ATCACCACCGACATCCGAGAGGGACAAGTGTTCTACTATGCCGAAGACTACCACCAGCAA 1218 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 585 ATCACCACCGACATCCGAGAGGGACAAGTGTTCTACTATGCCGAAGACTACCACCAGCAA 644 Query 1219 TACCTGAGCAAGAACCCAGACGGCTACTGTGGCCTCGGGGGTACTGGAGTTTCCTGCCCG 1278 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 645 TACCTGAGCAAGAACCCAGACGGCTACTGTGGCCTCGGGGGTACTGGAGTTTCCTGCCCG 704 Query 1279 ATGGCCATTAAAAAATAATTTCTCTCCACGAAGCTGTCCCTGAAGGTTCCATCAACACCA 1338 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 705 ATGGCCATTAAAAAATAATTTCTCTCCACGAAGCTGTCCCTGAAGGTTCCATCAACACCA 764 Query 1339 TGATTGCTGGATGGAGTGGCACTGCTGTGATTCACATCTGTCACTTTATGCAAAGCACAC 1398 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 765 TGATTGCTGGATGGAGTGGCACTGCTGTGATTCACATCTGTCACTTTATGCAAAGCACAC 824 Query 1399 ACACCACACGGACCTTTACATGAATCTGGTTGTTATTGGGGTTTGATTTCCAGAGAGTAG 1458 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 825 ACACCACACGGACCTTTACATGAATCTGGTTGTTATTGGGGTTTGATTTCCAGAGAGTAG 884 Query 1459 CATGACAAGGTGATACACTGTAATCTGCCTTCTGATCAGTCCGGGTGGGGACAAATCATG 1518 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 885 CATGACAAGGTGATACACTGTAATCTGCCTTCTGATCAGTCCGGGTGGGGACAAATCATG 944 Query 1519 ACATTTTAGTGGATTGTTTGGATCTGCTCAGACTGGAAGGATGCTGAGGGTTCTGAAGCA 1578 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 945 ACATTTTAGTGGATTGTTTGGATCTGCTCAGACTGGAAGGATGCTGAGGGTTCTGAAGCA 1004 Query 1579 GGGGGATGGCCAGGAGAGCACAGGGTACTGGGACCCCTTGGTCTGTGCTGACATACCTCA 1638 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1005 GGGGGATGGCCAGGAGAGCACAGGGTACTGGGACCCCTTGGTCTGTGCTGACATACCTCA 1064 Query 1639 CCCACTTCCCTGCCCTCGGGTGCCCAATTCATTAGTGTCTACAGATCCCATGAATCATTT 1698 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1065 CCCACTTCCCTGCCCTCGGGTGCCCAATTCATTAGTGTCTACAGATCCCATGAATCATTT 1124 Query 1699 GCCAAATCGCTTTGCTCTGCTGGCTCTAGATGTGTACTAGGGGTTTCTCTCCCCCTCCAT 1758 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1125 GCCAAATCGCTTTGCTCTGCTGGCTCTAGATGTGTACTAGGGGTTTCTCTCCCCCTCCAT 1184 Query 1759 CCTCTCTGCAGAGAAAAGACAGGAGTGACCTTAATGAATTCTAACATTCTGCTTACAGCT 1818 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1185 CCTCTCTGCAGAGAAAAGACAGGAGTGACCTTAATGAATTCTAACATTCTGCTTACAGCT 1244 Query 1819 ATGATAAAGCTTGTTCTAATAAAAATCTGCAGTTTGGTAATAAAAAAAAAAAAAAA 1874 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1245 ATGATAAAGCTTGTTCTAATAAAAATCTGCAGTTTGGTAATAAAAAAAAAAAAAAA 1300 Score = 638 bits (345), Expect = 3e-179 Identities = 345/345 (100%), Gaps = 0/345 (0%) Strand=Plus/Plus Query 455 AACGGCAGCAACTCTGACCTCCCGCGGTGGCGCCCAGCCAGCATCAATTTTGGCCCGCGC 514 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1 AACGGCAGCAACTCTGACCTCCCGCGGTGGCGCCCAGCCAGCATCAATTTTGGCCCGCGC 60 Query 515 GGCTTCACGTACTCTGGGAACTTTGTCCCTCAGAGACAGCCAGGCCTGGAGGTCTGCCCC 574 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 61 GGCTTCACGTACTCTGGGAACTTTGTCCCTCAGAGACAGCCAGGCCTGGAGGTCTGCCCC 120 Query 575 GCGAGACGGACACGCCGCCCATGCTCTCCGCCTCTAGAAGGGCTCTCCAGCTCCTCTCTA 634 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 121 GCGAGACGGACACGCCGCCCATGCTCTCCGCCTCTAGAAGGGCTCTCCAGCTCCTCTCTA 180 Query 635 GCGCCAACCCGGTACGGAGGATGGGCGACTCAGCTTCGAAAGTCATCTCCGCAGAGGAAG 694 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 181 GCGCCAACCCGGTACGGAGGATGGGCGACTCAGCTTCGAAAGTCATCTCCGCAGAGGAAG 240 Query 695 CCTTGCCGGGACGCACCGAGCCGATCCCTGTAACAGCCAAACACCATGTCAGTGGCAACA 754 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 241 CCTTGCCGGGACGCACCGAGCCGATCCCTGTAACAGCCAAACACCATGTCAGTGGCAACA 300 Query 755 GAACGGTTGAACCTTTCCCAGAGGGAACACAGATGGCTGTATTTG 799 ||||||||||||||||||||||||||||||||||||||||||||| Sbjct 301 GAACGGTTGAACCTTTCCCAGAGGGAACACAGATGGCTGTATTTG 345 >gb|AC166997.1| Download subject sequence spanning the HSP Mus musculus BAC clone RP23-107H9 from chromosome 14, complete sequence Length=201316 Score = 1351 bits (731), Expect = 0.0 Identities = 731/731 (100%), Gaps = 0/731 (0%) Strand=Plus/Plus Query 1130 AGGTTCTTTCAAAGCATAACTTTGGCCCCATCACCACCGACATCCGAGAGGGACAAGTGT 1189 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 79061 AGGTTCTTTCAAAGCATAACTTTGGCCCCATCACCACCGACATCCGAGAGGGACAAGTGT 79120 Query 1190 TCTACTATGCCGAAGACTACCACCAGCAATACCTGAGCAAGAACCCAGACGGCTACTGTG 1249 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 79121 TCTACTATGCCGAAGACTACCACCAGCAATACCTGAGCAAGAACCCAGACGGCTACTGTG 79180 Query 1250 GCCTCGGGGGTACTGGAGTTTCCTGCCCGATGGCCATTAAAAAATAATTTCTCTCCACGA 1309 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 79181 GCCTCGGGGGTACTGGAGTTTCCTGCCCGATGGCCATTAAAAAATAATTTCTCTCCACGA 79240 Query 1310 AGCTGTCCCTGAAGGTTCCATCAACACCATGATTGCTGGATGGAGTGGCACTGCTGTGAT 1369 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 79241 AGCTGTCCCTGAAGGTTCCATCAACACCATGATTGCTGGATGGAGTGGCACTGCTGTGAT 79300 Query 1370 TCACATCTGTCACTTTATGCAAAGCACACACACCACACGGACCTTTACATGAATCTGGTT 1429 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 79301 TCACATCTGTCACTTTATGCAAAGCACACACACCACACGGACCTTTACATGAATCTGGTT 79360 Query 1430 GTTATTGGGGTTTGATTTCCAGAGAGTAGCATGACAAGGTGATACACTGTAATCTGCCTT 1489 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 79361 GTTATTGGGGTTTGATTTCCAGAGAGTAGCATGACAAGGTGATACACTGTAATCTGCCTT 79420 Query 1490 CTGATCAGTCCGGGTGGGGACAAATCATGACATTTTAGTGGATTGTTTGGATCTGCTCAG 1549 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 79421 CTGATCAGTCCGGGTGGGGACAAATCATGACATTTTAGTGGATTGTTTGGATCTGCTCAG 79480 Query 1550 ACTGGAAGGATGCTGAGGGTTCTGAAGCAGGGGGATGGCCAGGAGAGCACAGGGTACTGG 1609 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 79481 ACTGGAAGGATGCTGAGGGTTCTGAAGCAGGGGGATGGCCAGGAGAGCACAGGGTACTGG 79540 Query 1610 GACCCCTTGGTCTGTGCTGACATACCTCACCCACTTCCCTGCCCTCGGGTGCCCAATTCA 1669 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 79541 GACCCCTTGGTCTGTGCTGACATACCTCACCCACTTCCCTGCCCTCGGGTGCCCAATTCA 79600 Query 1670 TTAGTGTCTACAGATCCCATGAATCATTTGCCAAATCGCTTTGCTCTGCTGGCTCTAGAT 1729 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 79601 TTAGTGTCTACAGATCCCATGAATCATTTGCCAAATCGCTTTGCTCTGCTGGCTCTAGAT 79660 Query 1730 GTGTACTAGGGGTTTCTCTCCCCCTCCATCCTCTCTGCAGAGAAAAGACAGGAGTGACCT 1789 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 79661 GTGTACTAGGGGTTTCTCTCCCCCTCCATCCTCTCTGCAGAGAAAAGACAGGAGTGACCT 79720 Query 1790 TAATGAATTCTAACATTCTGCTTACAGCTATGATAAAGCTTGTTCTAATAAAAATCTGCA 1849 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 79721 TAATGAATTCTAACATTCTGCTTACAGCTATGATAAAGCTTGTTCTAATAAAAATCTGCA 79780 Query 1850 GTTTGGTAATA 1860 ||||||||||| Sbjct 79781 GTTTGGTAATA 79791 >ref|NM_053307.2| UniGene infoGeoGene info Rattus norvegicus methionine sulfoxide reductase A (Msra), mRNA gb|BC087009.1| UniGene infoGene info Rattus norvegicus methionine sulfoxide reductase A, mRNA (cDNA clone MGC:93315 IMAGE:7107102), complete cds Length=1348 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 1277 bits (691), Expect = 0.0 Identities = 873/960 (90%), Gaps = 15/960 (1%) Strand=Plus/Plus Query 585 CACGCCGCCCATGCTCTCCGCCTCTAGAAGGGCTCTCCAGCTCCTCTCTAGCGCCAACCC 644 ||||| | |||||||||||||||| |||||| |||||||||||||||| ||| ||| ||| Sbjct 1 CACGCTGTCCATGCTCTCCGCCTCCAGAAGGACTCTCCAGCTCCTCTCCAGCTCCATCCC 60 Query 645 GGTACGGAGGATGGGCGACTCAGCTTCGAAAGTCATCTCCGCAGAGGAAGCCTTGCCGGG 704 |||||||| ||||||||||||| ||||||| |||||| ||| |||||||| ||||| || Sbjct 61 GGTACGGATGATGGGCGACTCATCTTCGAAGGTCATCAGCGCGGAGGAAGCTTTGCCAGG 120 Query 705 ACGCACCGAGCCGATCCCTGTAACAGCCAAACACCATGTCAGTGGCAACAGAACGGTTGA 764 |||||| ||| ||||||| ||| ||||||||||||||||||||||||||||||||||||| Sbjct 121 ACGCACAGAGTCGATCCCCGTAGCAGCCAAACACCATGTCAGTGGCAACAGAACGGTTGA 180 Query 765 ACCTTTCCCAGAGGGAACACAGATGGCTGTATTTGGAATGGGCTGCTTCTGGGGAGCTGA 824 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 181 ACCTTTCCCAGAGGGAACACAGATGGCTGTATTTGGAATGGGCTGCTTCTGGGGAGCTGA 240 Query 825 GCGCAAGTTCTGGGTCTTGAAAGGAGTGTACTCAACCCAAGTGGGCTTT-GCAGGAGGCC 883 ||||||||||||| |||||||||||||||| |||||||||||||| ||| ||||||||| Sbjct 241 GCGCAAGTTCTGGCTCTTGAAAGGAGTGTATTCAACCCAAGTGGG-TTTCGCAGGAGGCT 299 Query 884 ACACACGCAATCCCACCTACAAAGAGGTCTGCTCAGAAAAAACTGGCCACGCCGAAGTCG 943 ||||||||||||||||||||||||||||||||||||||||||| || ||||| ||||||| Sbjct 300 ACACACGCAATCCCACCTACAAAGAGGTCTGCTCAGAAAAAACCGGTCACGCAGAAGTCG 359 Query 944 TCCGGGTTGTGTACCGGCCAGAGCACATCAGCTTTGAGGAACTGCTCAAGGTCTTCTGGG 1003 |||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| Sbjct 360 TCCGGGTTGTGTACCGGCCAGAGCACGTCAGCTTTGAGGAGCTGCTCAAGGTCTTCTGGG 419 Query 1004 AGAATCACGACCCGACCCAAGGCATGCGCCAAGGCAATGACTTTGGTACACAGTACCGGT 1063 |||||||||||||||||||||| ||||||||||||||||||| ||| || ||||| || | Sbjct 420 AGAATCACGACCCGACCCAAGGGATGCGCCAAGGCAATGACTGTGGCACGCAGTATCGAT 479 Query 1064 CAGCAGTCTATCCCACATCCGCCGTGCAGATGGAAGCAGCCCTGAGATCCAAGGAAGAAT 1123 | || ||||||||||| |||||||||||||||||||| ||||||| ||||||||| || | Sbjct 480 CGGCGGTCTATCCCACCTCCGCCGTGCAGATGGAAGCTGCCCTGAAATCCAAGGAGGAGT 539 Query 1124 ACCAAAAGGTTCTTTCAAAGCATAACTTTGGCCCCATCACCACCGACATCCGAGAGGGAC 1183 |||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct 540 ACCAGAAGGTTCTTTCAAAGCATGGCTTTGGCCCCATCACCACCGACATCCGAGAGGGAC 599 Query 1184 AAGTGTTCTACTATGCCGAAGACTACCACCAGCAATACCTGAGCAAGAACCCAGACGGCT 1243 ||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||| Sbjct 600 AAGTGTTCTACTACGCCGAAGATTACCACCAGCAATACCTGAGCAAGAACCCAGACGGCT 659 Query 1244 ACTGTGGCCTCGGGGGTACTGGAGTTTCCTG-CCCGATGGCCATTAAAAAATAATTTCTC 1302 |||||||||| ||||| ||||| |||||||| ||| | |||||||||||| ||||||||| Sbjct 660 ACTGTGGCCTTGGGGGCACTGGGGTTTCCTGTCCC-ACGGCCATTAAAAAGTAATTTCTC 718 Query 1303 TCCACGAAGCTGTCCCTGAAGGTTCCATCAACACCATGATTGCTGGATGGAGTGGCACTG 1362 |||||||||||| ||||| ||||||||||||||||||||||||||||||||| |||||| Sbjct 719 TCCACGAAGCTGGCCCTGGAGGTTCCATCAACACCATGATTGCTGGATGGAGCAGCACTG 778 Query 1363 CTGTGATTCACATCTGTCACTTTATGCAA-AGCACACACACCACACGGACCTTTACATGA 1421 ||||||||| |||||||||||||||| || ||||||||| | |||||| | ||||||||| Sbjct 779 CTGTGATTCCCATCTGTCACTTTATG-AAGAGCACACAC-C-ACACGGGCATTTACATGA 835 Query 1422 ATCTGGTTGTTATTGGGGTTTGATTTCCAGAGAGTAGCATGACAAGGTGATACACTGTAA 1481 ||||||||||||| |||| |||||| |||| ||||| ||||| ||||||| | ||||| Sbjct 836 ATCTGGTTGTTATCCGGGTCTGATTTACAGAAAGTAGGATGACGAGGTGATGCGTTGTAA 895 Query 1482 TCTGCCTTCTGATCAGTCCGGG-TGGGGACA-AATCATGACATTTTAGTGGATTGTTTGG 1539 | || ||||||||||||| ||| |||||| | || |||| ||||||||||| ||||| Sbjct 896 TTTGTCTTCTGATCAGTC-GGGATGGGGATAGAA-CATG---TTTTAGTGGATCATTTGG 950 Score = 379 bits (205), Expect = 2e-101 Identities = 310/358 (86%), Gaps = 18/358 (5%) Strand=Plus/Plus Query 1540 ATCTGCTCAGA-CTGGAAGGATGCTGAGGGTTCTGAAGCAGGGGGATGGCCAGGAGAGCA 1598 ||||||| || | ||| ||||||| ||||||||||| ||||| | |||| |||||||| Sbjct 984 ATCTGCT-GGAGCCGGAGGGATGCTAAGGGTTCTGAAACAGGGAGCTGGCTGGGAGAGCA 1042 Query 1599 CAGG-GTACTGGGACCCCTTGGTCTGTGCTGACATACCTCACCCACTTCCCTGCCCTCGG 1657 | || | ||||||| | | | | | ||||||||||||| ||||| ||||||||||| | Sbjct 1043 C-GGAGCACTGGGA-CTC-TAG---G-GCTGACATACCTCGCCCACCTCCCTGCCCTCAG 1095 Query 1658 GTGCCCAATTCATTAGTGTCTACAGATC-CCATGAATCATTTGCC-AAATCGCTTTGCTC 1715 ||||| |||||||||||||||| || | ||| |||||| ||||| ||| | |||||||| Sbjct 1096 GTGCCTAATTCATTAGTGTCTA-GGAGCTCCACGAATCA-TTGCCGAAA-CACTTTGCTC 1152 Query 1716 TGCTGGCTCTAGATGTGTACTAGGGGTTTCTCT-CCCCCTCCATCCTCTC--TGCAGAGA 1772 ||||| ||||||| | || ||||||||||||| |||||||| ||||||| |||||||| Sbjct 1153 TGCTGCCTCTAGACGCATATTAGGGGTTTCTCTCCCCCCTCCGTCCTCTCTGTGCAGAGA 1212 Query 1773 AAAGACAGGAGTGACCTTAATGAATTCTAACATTCTGCTTACAGCTATGATAAAGCTTGT 1832 ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1213 AAAGACATGAGTGACCTTAATGAATTCTAACATTCTGCTTACAGCTATGATAAAGCTTGT 1272 Query 1833 TCTAATAAAAATCTGCAGTTTGGTAATaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 1890 |||||||||||||| | ||||||| ||||||||||||||||||||||||||||||||| Sbjct 1273 TCTAATAAAAATCTACGGTTTGGTGATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 1330 >gb|AY005464.1| UniGene infoGeoGene info Rattus norvegicus peptide methionine sulfoxide reductase mRNA, complete cds Length=702 Score = 1009 bits (546), Expect = 0.0 Identities = 652/704 (92%), Gaps = 4/704 (0%) Strand=Plus/Plus Query 595 ATGCTCTCCGCCTCTAGAAGGGCTCTCCAGCTCCTCTCTAGCGCCAACCCGGTACGGAGG 654 |||||||||||||| |||||| |||||||||||||||| ||| ||| ||||||||||| | Sbjct 1 ATGCTCTCCGCCTCCAGAAGGACTCTCCAGCTCCTCTCCAGCTCCATCCCGGTACGGATG 60 Query 655 ATGGGCGACTCAGCTTCGAAAGTCATCTCCGCAGAGGAAGCCTTGCCGGGACGCACCGAG 714 |||||||||||| ||||||| |||||| ||| |||||||| ||||| |||||||| ||| Sbjct 61 ATGGGCGACTCATCTTCGAAGGTCATCAGCGCGGAGGAAGCTTTGCCAGGACGCACAGAG 120 Query 715 CCGATCCCTGTAACAGCCAAACACCATGTCAGTGGCAACAGAACGGTTGAACCTTTCCCA 774 ||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 121 TCGATCCCCGTAGCAGCCAAACACCATGTCAGTGGCAACAGAACGGTTGAACCTTTCCCA 180 Query 775 GAGGGAACACAGATGGCTGTATTTGGAATGGGCTGCTTCTGGGGAGCTGAGCGCAAGTTC 834 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 181 GAGGGAACACAGATGGCTGTATTTGGAATGGGCTGCTTCTGGGGAGCTGAGCGCAAGTTC 240 Query 835 TGGGTCTTGAAAGGAGTGTACTCAACCCAAGTGGGCTTT-GCAGGAGGCCACACACGCAA 893 ||| |||||||||||||||| |||||||||||||| ||| ||||||||| |||||||||| Sbjct 241 TGGCTCTTGAAAGGAGTGTATTCAACCCAAGTGGG-TTTCGCAGGAGGCTACACACGCAA 299 Query 894 TCCCACCTACAAAGAGGTCTGCTCAGAAAAAACTGGCCACGCCGAAGTCGTCCGGGTTGT 953 ||||||||||||||||||||||||||||||||| || ||||| ||||||||||||||||| Sbjct 300 TCCCACCTACAAAGAGGTCTGCTCAGAAAAAACCGGTCACGCAGAAGTCGTCCGGGTTGT 359 Query 954 GTACCGGCCAGAGCACATCAGCTTTGAGGAACTGCTCAAGGTCTTCTGGGAGAATCACGA 1013 |||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| Sbjct 360 GTACCGGCCAGAGCACGTCAGCTTTGAGGAGCTGCTCAAGGTCTTCTGGGAGAATCACGA 419 Query 1014 CCCGACCCAAGGCATGCGCCAAGGCAATGACTTTGGTACACAGTACCGGTCAGCAGTCTA 1073 |||||||||||| ||||||||||||||||||| ||| || ||||| || || || ||||| Sbjct 420 CCCGACCCAAGGGATGCGCCAAGGCAATGACTGTGGCACGCAGTATCGATCGGCGGTCTA 479 Query 1074 TCCCACATCCGCCGTGCAGATGGAAGCAGCCCTGAGATCCAAGGAAGAATACCAAAAGGT 1133 |||||| |||||||||||||||||||| ||||||| ||||||||| || ||||| ||||| Sbjct 480 TCCCACCTCCGCCGTGCAGATGGAAGCTGCCCTGAAATCCAAGGAGGAGTACCAGAAGGT 539 Query 1134 TCTTTCAAAGCATAACTTTGGCCCCATCACCACCGACATCCGAGAGGGACAAGTGTTCTA 1193 ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| Sbjct 540 TCTTTCAAAGCATGGCTTTGGCCCCATCACCACCGACATCCGAGAGGGACAAGTGTTCTA 599 Query 1194 CTATGCCGAAGACTACCACCAGCAATACCTGAGCAAGAACCCAGACGGCTACTGTGGCCT 1253 ||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 600 CTACGCCGAAGATTACCACCAGCAATACCTGAGCAAGAACCCAGACGGCTACTGTGGCCT 659 Query 1254 CGGGGGTACTGGAGTTTCCTG-CCCGATGGCCATTAAAAAATAA 1296 ||||| ||||| |||||||| ||| | |||||||||||| ||| Sbjct 660 TGGGGGCACTGGGGTTTCCTGTCCC-ACGGCCATTAAAAAGTAA 702 >dbj|AK030278.1| UniGene infoGene info Mus musculus 11 days pregnant adult female ovary and uterus cDNA, RIKEN full-length enriched library, clone:5031404C24 product:methionine sulfoxide reductase A, full insert sequence Length=2558 Score = 734 bits (397), Expect = 0.0 Identities = 397/397 (100%), Gaps = 0/397 (0%) Strand=Plus/Plus Query 523 GTACTCTGGGAACTTTGTCCCTCAGAGACAGCCAGGCCTGGAGGTCTGCCCCGCGAGACG 582 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2 GTACTCTGGGAACTTTGTCCCTCAGAGACAGCCAGGCCTGGAGGTCTGCCCCGCGAGACG 61 Query 583 GACACGCCGCCCATGCTCTCCGCCTCTAGAAGGGCTCTCCAGCTCCTCTCTAGCGCCAAC 642 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 62 GACACGCCGCCCATGCTCTCCGCCTCTAGAAGGGCTCTCCAGCTCCTCTCTAGCGCCAAC 121 Query 643 CCGGTACGGAGGATGGGCGACTCAGCTTCGAAAGTCATCTCCGCAGAGGAAGCCTTGCCG 702 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 122 CCGGTACGGAGGATGGGCGACTCAGCTTCGAAAGTCATCTCCGCAGAGGAAGCCTTGCCG 181 Query 703 GGACGCACCGAGCCGATCCCTGTAACAGCCAAACACCATGTCAGTGGCAACAGAACGGTT 762 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 182 GGACGCACCGAGCCGATCCCTGTAACAGCCAAACACCATGTCAGTGGCAACAGAACGGTT 241 Query 763 GAACCTTTCCCAGAGGGAACACAGATGGCTGTATTTGGAATGGGCTGCTTCTGGGGAGCT 822 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 242 GAACCTTTCCCAGAGGGAACACAGATGGCTGTATTTGGAATGGGCTGCTTCTGGGGAGCT 301 Query 823 GAGCGCAAGTTCTGGGTCTTGAAAGGAGTGTACTCAACCCAAGTGGGCTTTGCAGGAGGC 882 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 302 GAGCGCAAGTTCTGGGTCTTGAAAGGAGTGTACTCAACCCAAGTGGGCTTTGCAGGAGGC 361 Query 883 CACACACGCAATCCCACCTACAAAGAGGTCTGCTCAG 919 ||||||||||||||||||||||||||||||||||||| Sbjct 362 CACACACGCAATCCCACCTACAAAGAGGTCTGCTCAG 398 >ref|XM_001138292.1| Gene info PREDICTED: Pan troglodytes similar to cytosolic methionine-S-sulfoxide reductase, transcript variant 7 (LOC739556), mRNA Length=1538 Score = 649 bits (351), Expect = 0.0 Identities = 564/666 (84%), Gaps = 18/666 (2%) Strand=Plus/Plus Query 651 GAGGATGGGCGACTCAGCTTCGAA-AGTCATC-TCCGCAGAGGAAGCCTTGCCGGGACGC 708 |||||||||| |||| || ||||| | || || || | |||| ||||||||||| || Sbjct 314 GAGGATGGGCAACTCGGCCTCGAACA-TCGTCAGCC-CCCAGGAGGCCTTGCCGGGCCGG 371 Query 709 ACCGAGCCGATCCCTGTAACAGCCAAACACCATGTCAGTGGCAACAGAACGGTTGAACCT 768 | || | || ||||||| | |||||||| ||||||| |||||||||||| || |||||| Sbjct 372 AAGGAACAGACCCCTGTAGCGGCCAAACATCATGTCAATGGCAACAGAACAGTCGAACCT 431 Query 769 TTCCCAGAGGGAACACAGATGGCTGTATTTGGAATGGGCTGCTTCTGGGGAGCTGAGCGC 828 |||||||||||||||||||||||||||||||||||||| || |||||||||||||| | Sbjct 432 TTCCCAGAGGGAACACAGATGGCTGTATTTGGAATGGGATGTTTCTGGGGAGCTGAAAGG 491 Query 829 AAGTTCTGGGTCTTGAAAGGAGTGTACTCAACCCAAGTGGGCTTTGCAGGAGGCCACACA 888 || ||||||||||||||||||||||| ||||| ||||| || |||||||||||| | || Sbjct 492 AAATTCTGGGTCTTGAAAGGAGTGTATTCAACTCAAGTTGGTTTTGCAGGAGGCTATACT 551 Query 889 CGCAA-TCCCACCTACAAAGAGGTCTGCTCAGAAAAAACTGGCCACGCCGAAGTCGTCCG 947 ||| ||| || || ||||| ||||||||||||||||||||||| || ||||||||||| Sbjct 552 T-CAAATCCTACTTATAAAGAAGTCTGCTCAGAAAAAACTGGCCATGCAGAAGTCGTCCG 610 Query 948 GGTTGTGTACCGGCCAGAGCACATCAGCTTTGAGGAACTGCTCAAGGTCTTCTGGGAGAA 1007 || ||||||| |||||| |||||||| |||||||||||||||||||||||||||||||| Sbjct 611 AGTGGTGTACCAGCCAGAACACATCAGTTTTGAGGAACTGCTCAAGGTCTTCTGGGAGAA 670 Query 1008 TCACGACCCGACCCAAGGCATGCGCCAAGGCAATGACTTTGGTACACAGTACCGGTCAGC 1067 |||||||||||||||||| |||||||| || || ||| ||| || |||||||| || || Sbjct 671 TCACGACCCGACCCAAGGTATGCGCCAGGGGAACGACCATGGCACTCAGTACCGCTCGGC 730 Query 1068 -AGTCTATCCC-ACATCCGCCGTGCAGATGGAAGCAGCCCTGAGATCCAAGGAAGAA-TA 1124 | |||| ||| || || ||| ||| ||||| ||||||||||| ||||| || ||| || Sbjct 731 CA-TCTA-CCCGACCTCTGCCAAGCAAATGGAGGCAGCCCTGAGCTCCAAAGA-GAACTA 787 Query 1125 CCAAAAGGTTCTTTCAAAGCATAACTTTGGCCCCATCACCACCGACATCCGAGAGGGACA 1184 |||||||||||||||| |||| ||| ||||||||||| ||||||||||| |||||||| Sbjct 788 CCAAAAGGTTCTTTCAGAGCACGGCTTCGGCCCCATCACTACCGACATCCGGGAGGGACA 847 Query 1185 -AGTGTTCTACTATGCCGAAGACTACCACCAGCAATACCTGAGCAAGAACCC-AGACGGC 1242 | | ||||||||||| ||||||||||||||||| ||||||||||||||||| | | ||| Sbjct 848 GACT-TTCTACTATGCGGAAGACTACCACCAGCAGTACCTGAGCAAGAACCCCA-ATGGC 905 Query 1243 TACTGTGGCCTCGGGGGTACTGGAGTTTCCTGCCC-GATGGCCATTAAAAAATAATTTCT 1301 ||||| ||||| ||||| || || || |||||||| | ||| ||||||||||||||||| Sbjct 906 TACTGCGGCCTTGGGGGCACCGGCGTGTCCTGCCCAG-TGGGTATTAAAAAATAATTTCT 964 Query 1302 CTCCAC 1307 | |||| Sbjct 965 CCCCAC 970 >ref|XM_001138036.1| Gene info PREDICTED: Pan troglodytes similar to cytosolic methionine-S-sulfoxide reductase, transcript variant 4 (LOC739556), mRNA Length=1290 Score = 649 bits (351), Expect = 0.0 Identities = 564/666 (84%), Gaps = 18/666 (2%) Strand=Plus/Plus Query 651 GAGGATGGGCGACTCAGCTTCGAA-AGTCATC-TCCGCAGAGGAAGCCTTGCCGGGACGC 708 |||||||||| |||| || ||||| | || || || | |||| ||||||||||| || Sbjct 66 GAGGATGGGCAACTCGGCCTCGAACA-TCGTCAGCC-CCCAGGAGGCCTTGCCGGGCCGG 123 Query 709 ACCGAGCCGATCCCTGTAACAGCCAAACACCATGTCAGTGGCAACAGAACGGTTGAACCT 768 | || | || ||||||| | |||||||| ||||||| |||||||||||| || |||||| Sbjct 124 AAGGAACAGACCCCTGTAGCGGCCAAACATCATGTCAATGGCAACAGAACAGTCGAACCT 183 Query 769 TTCCCAGAGGGAACACAGATGGCTGTATTTGGAATGGGCTGCTTCTGGGGAGCTGAGCGC 828 |||||||||||||||||||||||||||||||||||||| || |||||||||||||| | Sbjct 184 TTCCCAGAGGGAACACAGATGGCTGTATTTGGAATGGGATGTTTCTGGGGAGCTGAAAGG 243 Query 829 AAGTTCTGGGTCTTGAAAGGAGTGTACTCAACCCAAGTGGGCTTTGCAGGAGGCCACACA 888 || ||||||||||||||||||||||| ||||| ||||| || |||||||||||| | || Sbjct 244 AAATTCTGGGTCTTGAAAGGAGTGTATTCAACTCAAGTTGGTTTTGCAGGAGGCTATACT 303 Query 889 CGCAA-TCCCACCTACAAAGAGGTCTGCTCAGAAAAAACTGGCCACGCCGAAGTCGTCCG 947 ||| ||| || || ||||| ||||||||||||||||||||||| || ||||||||||| Sbjct 304 T-CAAATCCTACTTATAAAGAAGTCTGCTCAGAAAAAACTGGCCATGCAGAAGTCGTCCG 362 Query 948 GGTTGTGTACCGGCCAGAGCACATCAGCTTTGAGGAACTGCTCAAGGTCTTCTGGGAGAA 1007 || ||||||| |||||| |||||||| |||||||||||||||||||||||||||||||| Sbjct 363 AGTGGTGTACCAGCCAGAACACATCAGTTTTGAGGAACTGCTCAAGGTCTTCTGGGAGAA 422 Query 1008 TCACGACCCGACCCAAGGCATGCGCCAAGGCAATGACTTTGGTACACAGTACCGGTCAGC 1067 |||||||||||||||||| |||||||| || || ||| ||| || |||||||| || || Sbjct 423 TCACGACCCGACCCAAGGTATGCGCCAGGGGAACGACCATGGCACTCAGTACCGCTCGGC 482 Query 1068 -AGTCTATCCC-ACATCCGCCGTGCAGATGGAAGCAGCCCTGAGATCCAAGGAAGAA-TA 1124 | |||| ||| || || ||| ||| ||||| ||||||||||| ||||| || ||| || Sbjct 483 CA-TCTA-CCCGACCTCTGCCAAGCAAATGGAGGCAGCCCTGAGCTCCAAAGA-GAACTA 539 Query 1125 CCAAAAGGTTCTTTCAAAGCATAACTTTGGCCCCATCACCACCGACATCCGAGAGGGACA 1184 |||||||||||||||| |||| ||| ||||||||||| ||||||||||| |||||||| Sbjct 540 CCAAAAGGTTCTTTCAGAGCACGGCTTCGGCCCCATCACTACCGACATCCGGGAGGGACA 599 Query 1185 -AGTGTTCTACTATGCCGAAGACTACCACCAGCAATACCTGAGCAAGAACCC-AGACGGC 1242 | | ||||||||||| ||||||||||||||||| ||||||||||||||||| | | ||| Sbjct 600 GACT-TTCTACTATGCGGAAGACTACCACCAGCAGTACCTGAGCAAGAACCCCA-ATGGC 657 Query 1243 TACTGTGGCCTCGGGGGTACTGGAGTTTCCTGCCC-GATGGCCATTAAAAAATAATTTCT 1301 ||||| ||||| ||||| || || || |||||||| | ||| ||||||||||||||||| Sbjct 658 TACTGCGGCCTTGGGGGCACCGGCGTGTCCTGCCCAG-TGGGTATTAAAAAATAATTTCT 716 Query 1302 CTCCAC 1307 | |||| Sbjct 717 CCCCAC 722 >dbj|AB220441.1| UniGene info Macaca fascicularis mRNA, clone QccE-19538: similar to Homo sapiens methionine sulfoxide reductase A (MSRA), NM_012331.2 Length=1455 Score = 649 bits (351), Expect = 0.0 Identities = 563/665 (84%), Gaps = 16/665 (2%) Strand=Plus/Plus Query 651 GAGGATGGGCGACTCAGCTTCGAAAGTCATC-TC--CGCAGAGGAAGCCTTGCCGGGACG 707 |||||||||| |||| || ||| || |||| || | | |||| ||||||||||| || Sbjct 209 GAGGATGGGCAACTCGGCCTCG--AG-CATCGTCAGCCCCCAGGAGGCCTTGCCGGGCCG 265 Query 708 CACCGAGCCGATCCCTGTAACAGCCAAACACCATGTCAGTGGCAACAGAACGGTTGAACC 767 | || | || ||||||| | |||||||| ||||||| |||||||||||| || ||||| Sbjct 266 GAAGGAACAGACCCCTGTAGCGGCCAAACATCATGTCAATGGCAACAGAACAGTCGAACC 325 Query 768 TTTCCCAGAGGGAACACAGATGGCTGTATTTGGAATGGGCTGCTTCTGGGGAGCTGAGCG 827 |||||||||||||||||||||||||||||||||||||||||| |||||||||||||| | Sbjct 326 TTTCCCAGAGGGAACACAGATGGCTGTATTTGGAATGGGCTGTTTCTGGGGAGCTGAAAG 385 Query 828 CAAGTTCTGGGTCTTGAAAGGAGTGTACTCAACCCAAGTGGGCTTTGCAGGAGGCCACAC 887 || |||||||||||||||||||| || ||||| ||||| || |||||||||||| | || Sbjct 386 GAAATTCTGGGTCTTGAAAGGAGTATATTCAACTCAAGTTGGTTTTGCAGGAGGCTATAC 445 Query 888 ACGCAA-TCCCACCTACAAAGAGGTCTGCTCAGAAAAAACTGGCCACGCCGAAGTCGTCC 946 ||| ||| || || ||||| ||||||||||||||||||||||| || |||||||||| Sbjct 446 TT-CAAATCCTACTTATAAAGAAGTCTGCTCAGAAAAAACTGGCCATGCAGAAGTCGTCC 504 Query 947 GGGTTGTGTACCGGCCAGAGCACATCAGCTTTGAGGAACTGCTCAAGGTCTTCTGGGAGA 1006 | || ||||||| |||||| |||||||| ||||||||||||||||||||||||||||||| Sbjct 505 GAGTGGTGTACCAGCCAGAACACATCAGTTTTGAGGAACTGCTCAAGGTCTTCTGGGAGA 564 Query 1007 ATCACGACCCGACCCAAGGCATGCGCCAAGGCAATGACTTTGGTACACAGTACCGGTCAG 1066 ||||||||||||||||||| |||||||| || || ||| ||| || |||||||| || | Sbjct 565 ATCACGACCCGACCCAAGGTATGCGCCAGGGGAACGACCATGGCACTCAGTACCGCTCGG 624 Query 1067 C-AGTCTATCCC-ACATCCGCCGTGCAGATGGAAGCAGCCCTGAGATCCAAGGAAGAATA 1124 | | |||| ||| || |||||| ||| ||||| || |||||||| ||||| || || || Sbjct 625 CCA-TCTA-CCCGACTTCCGCCAAGCAAATGGAGGCGGCCCTGAGCTCCAAAGAGGACTA 682 Query 1125 CCAAAAGGTTCTTTCAAAGCATAACTTTGGCCCCATCACCACCGACATCCGAGAGGGACA 1184 |||||||||||||||| |||| ||||||||||||||| ||||||||||| || ||||| Sbjct 683 CCAAAAGGTTCTTTCAGAGCACGGCTTTGGCCCCATCACTACCGACATCCGGGAAGGACA 742 Query 1185 -AGTGTTCTACTATGCCGAAGACTACCACCAGCAATACCTGAGCAAGAACCC-AGACGGC 1242 | | |||||||| || ||||||||||||||||| ||||||||||||||||| | ||||| Sbjct 743 GATT-TTCTACTACGCGGAAGACTACCACCAGCAGTACCTGAGCAAGAACCCCA-ACGGC 800 Query 1243 TACTGTGGCCTCGGGGGTACTGGAGTTTCCTGCCCGATGGCCATTAAAAAATAATTTCTC 1302 ||||| ||||| ||||| || || || |||||||| |||| |||||||||||||||||| Sbjct 801 TACTGCGGCCTTGGGGGCACCGGCGTGTCCTGCCCAATGGGTATTAAAAAATAATTTCTC 860 Query 1303 TCCAC 1307 |||| Sbjct 861 CCCAC 865 >gb|BC054033.1| UniGene infoGene info Homo sapiens methionine sulfoxide reductase A, mRNA (cDNA clone MGC:64957 IMAGE:6504055), complete cds Length=1496 Score = 638 bits (345), Expect = 3e-179 Identities = 562/666 (84%), Gaps = 18/666 (2%) Strand=Plus/Plus Query 651 GAGGATGGGCGACTCAGCTTCGAA-AGTCATC-TCCGCAGAGGAAGCCTTGCCGGGACGC 708 |||||||||| |||| || ||||| | || || || | |||| ||||||||||| || Sbjct 260 GAGGATGGGCAACTCGGCCTCGAACA-TCGTCAGCC-CCCAGGAGGCCTTGCCGGGCCGG 317 Query 709 ACCGAGCCGATCCCTGTAACAGCCAAACACCATGTCAGTGGCAACAGAACGGTTGAACCT 768 | || | || ||||||| | |||||||| ||||||| |||||||||||| || |||||| Sbjct 318 AAGGAACAGACCCCTGTAGCGGCCAAACATCATGTCAATGGCAACAGAACAGTCGAACCT 377 Query 769 TTCCCAGAGGGAACACAGATGGCTGTATTTGGAATGGGCTGCTTCTGGGGAGCTGAGCGC 828 |||||||||||||||||||||||||||||||||||||| || |||||||||||||| | Sbjct 378 TTCCCAGAGGGAACACAGATGGCTGTATTTGGAATGGGATGTTTCTGGGGAGCTGAAAGG 437 Query 829 AAGTTCTGGGTCTTGAAAGGAGTGTACTCAACCCAAGTGGGCTTTGCAGGAGGCCACACA 888 || ||||||||||||||||||||||| ||||| ||||| || |||||||||||| | || Sbjct 438 AAATTCTGGGTCTTGAAAGGAGTGTATTCAACTCAAGTTGGTTTTGCAGGAGGCTATACT 497 Query 889 CGCAA-TCCCACCTACAAAGAGGTCTGCTCAGAAAAAACTGGCCACGCCGAAGTCGTCCG 947 ||| ||| || || ||||| ||||||||||||||||||||||| || ||||||||||| Sbjct 498 T-CAAATCCTACTTATAAAGAAGTCTGCTCAGAAAAAACTGGCCATGCAGAAGTCGTCCG 556 Query 948 GGTTGTGTACCGGCCAGAGCACATCAGCTTTGAGGAACTGCTCAAGGTCTTCTGGGAGAA 1007 || ||||||| |||||| ||||| || |||||||||||||||||||||||||||||||| Sbjct 557 AGTGGTGTACCAGCCAGAACACATGAGTTTTGAGGAACTGCTCAAGGTCTTCTGGGAGAA 616 Query 1008 TCACGACCCGACCCAAGGCATGCGCCAAGGCAATGACTTTGGTACACAGTACCGGTCAGC 1067 |||||||||||||||||| |||||||| || || ||| ||| || |||||||| || || Sbjct 617 TCACGACCCGACCCAAGGTATGCGCCAGGGGAACGACCATGGCACTCAGTACCGCTCGGC 676 Query 1068 -AGTCTATCCC-ACATCCGCCGTGCAGATGGAAGCAGCCCTGAGATCCAAGGAAGAA-TA 1124 | |||| ||| || || ||| ||| ||||| ||||||||||| ||||| || ||| || Sbjct 677 CA-TCTA-CCCGACCTCTGCCAAGCAAATGGAGGCAGCCCTGAGCTCCAAAGA-GAACTA 733 Query 1125 CCAAAAGGTTCTTTCAAAGCATAACTTTGGCCCCATCACCACCGACATCCGAGAGGGACA 1184 |||||||||||||||| |||| ||| ||||||||||| ||||||||||| |||||||| Sbjct 734 CCAAAAGGTTCTTTCAGAGCACGGCTTCGGCCCCATCACTACCGACATCCGGGAGGGACA 793 Query 1185 -AGTGTTCTACTATGCCGAAGACTACCACCAGCAATACCTGAGCAAGAACCC-AGACGGC 1242 | | ||||||||||| ||||||||||||||||| ||||||||||||||||| | | ||| Sbjct 794 GACT-TTCTACTATGCGGAAGACTACCACCAGCAGTACCTGAGCAAGAACCCCA-ATGGC 851 Query 1243 TACTGTGGCCTCGGGGGTACTGGAGTTTCCTGCCC-GATGGCCATTAAAAAATAATTTCT 1301 ||||| ||||| ||||| || || || |||||||| | ||| |||||||||||||| || Sbjct 852 TACTGCGGCCTTGGGGGCACCGGCGTGTCCTGCCCAG-TGGGTATTAAAAAATAATTGCT 910 Query 1302 CTCCAC 1307 | |||| Sbjct 911 CCCCAC 916 >gb|AF086925.1| UniGene infoGene info Homo sapiens methionine sulfoxide reductase mRNA, complete cds Length=1349 Score = 638 bits (345), Expect = 3e-179 Identities = 562/666 (84%), Gaps = 18/666 (2%) Strand=Plus/Plus Query 651 GAGGATGGGCGACTCAGCTTCGAA-AGTCATC-TCCGCAGAGGAAGCCTTGCCGGGACGC 708 |||||||||| |||| || ||||| | || || || | |||| ||||||||||| || Sbjct 130 GAGGATGGGCAACTCGGCCTCGAACA-TCGTCAGCC-CCCAGGAGGCCTTGCCGGGCCGG 187 Query 709 ACCGAGCCGATCCCTGTAACAGCCAAACACCATGTCAGTGGCAACAGAACGGTTGAACCT 768 | || | || ||||||| | |||||||| ||||||| |||||||||||| || |||||| Sbjct 188 AAGGAACAGACCCCTGTAGCGGCCAAACATCATGTCAATGGCAACAGAACAGTCGAACCT 247 Query 769 TTCCCAGAGGGAACACAGATGGCTGTATTTGGAATGGGCTGCTTCTGGGGAGCTGAGCGC 828 |||||||||||||||||||||||||||||||||||||| || |||||||||||||| | Sbjct 248 TTCCCAGAGGGAACACAGATGGCTGTATTTGGAATGGGATGTTTCTGGGGAGCTGAAAGG 307 Query 829 AAGTTCTGGGTCTTGAAAGGAGTGTACTCAACCCAAGTGGGCTTTGCAGGAGGCCACACA 888 || ||||||||||||||||||||||| ||||| ||||| || |||||||||||| | || Sbjct 308 AAATTCTGGGTCTTGAAAGGAGTGTATTCAACTCAAGTTGGTTTTGCAGGAGGCTATACT 367 Query 889 CGCAA-TCCCACCTACAAAGAGGTCTGCTCAGAAAAAACTGGCCACGCCGAAGTCGTCCG 947 ||| ||| || || ||||| ||||||||||||||||||||||| || ||||||||||| Sbjct 368 T-CAAATCCTACTTATAAAGAAGTCTGCTCAGAAAAAACTGGCCATGCAGAAGTCGTCCG 426 Query 948 GGTTGTGTACCGGCCAGAGCACATCAGCTTTGAGGAACTGCTCAAGGTCTTCTGGGAGAA 1007 || ||||||| |||||| ||||| || |||||||||||||||||||||||||||||||| Sbjct 427 AGTGGTGTACCAGCCAGAACACATGAGTTTTGAGGAACTGCTCAAGGTCTTCTGGGAGAA 486 Query 1008 TCACGACCCGACCCAAGGCATGCGCCAAGGCAATGACTTTGGTACACAGTACCGGTCAGC 1067 |||||||||||||||||| |||||||| || || ||| ||| || |||||||| || || Sbjct 487 TCACGACCCGACCCAAGGTATGCGCCAGGGGAACGACCATGGCACTCAGTACCGCTCGGC 546 Query 1068 -AGTCTATCCC-ACATCCGCCGTGCAGATGGAAGCAGCCCTGAGATCCAAGGAAGAA-TA 1124 | |||| ||| || || ||| ||| ||||| ||||||||||| ||||| || ||| || Sbjct 547 CA-TCTA-CCCGACCTCTGCCAAGCAAATGGAGGCAGCCCTGAGCTCCAAAGA-GAACTA 603 Query 1125 CCAAAAGGTTCTTTCAAAGCATAACTTTGGCCCCATCACCACCGACATCCGAGAGGGACA 1184 |||||||||||||||| |||| ||| ||||||||||| ||||||||||| |||||||| Sbjct 604 CCAAAAGGTTCTTTCAGAGCACGGCTTCGGCCCCATCACTACCGACATCCGGGAGGGACA 663 Query 1185 -AGTGTTCTACTATGCCGAAGACTACCACCAGCAATACCTGAGCAAGAACCC-AGACGGC 1242 | | ||||||||||| ||||||||||||||||| ||||||||||||||||| | | ||| Sbjct 664 GACT-TTCTACTATGCGGAAGACTACCACCAGCAGTACCTGAGCAAGAACCCCA-ATGGC 721 Query 1243 TACTGTGGCCTCGGGGGTACTGGAGTTTCCTGCCC-GATGGCCATTAAAAAATAATTTCT 1301 ||||| ||||| ||||| || || || |||||||| | ||| |||||||||||||| || Sbjct 722 TACTGCGGCCTTGGGGGCACCGGCGTGTCCTGCCCAG-TGGGTATTAAAAAATAATTGCT 780 Query 1302 CTCCAC 1307 | |||| Sbjct 781 CCCCAC 786 >ref|NM_012331.2| UniGene infoGeoGene info Homo sapiens methionine sulfoxide reductase A (MSRA), mRNA Length=1502 Score = 638 bits (345), Expect = 3e-179 Identities = 562/666 (84%), Gaps = 18/666 (2%) Strand=Plus/Plus Query 651 GAGGATGGGCGACTCAGCTTCGAA-AGTCATC-TCCGCAGAGGAAGCCTTGCCGGGACGC 708 |||||||||| |||| || ||||| | || || || | |||| ||||||||||| || Sbjct 275 GAGGATGGGCAACTCGGCCTCGAACA-TCGTCAGCC-CCCAGGAGGCCTTGCCGGGCCGG 332 Query 709 ACCGAGCCGATCCCTGTAACAGCCAAACACCATGTCAGTGGCAACAGAACGGTTGAACCT 768 | || | || ||||||| | |||||||| ||||||| |||||||||||| || |||||| Sbjct 333 AAGGAACAGACCCCTGTAGCGGCCAAACATCATGTCAATGGCAACAGAACAGTCGAACCT 392 Query 769 TTCCCAGAGGGAACACAGATGGCTGTATTTGGAATGGGCTGCTTCTGGGGAGCTGAGCGC 828 |||||||||||||||||||||||||||||||||||||| || |||||||||||||| | Sbjct 393 TTCCCAGAGGGAACACAGATGGCTGTATTTGGAATGGGATGTTTCTGGGGAGCTGAAAGG 452 Query 829 AAGTTCTGGGTCTTGAAAGGAGTGTACTCAACCCAAGTGGGCTTTGCAGGAGGCCACACA 888 || ||||||||||||||||||||||| ||||| ||||| || |||||||||||| | || Sbjct 453 AAATTCTGGGTCTTGAAAGGAGTGTATTCAACTCAAGTTGGTTTTGCAGGAGGCTATACT 512 Query 889 CGCAA-TCCCACCTACAAAGAGGTCTGCTCAGAAAAAACTGGCCACGCCGAAGTCGTCCG 947 ||| ||| || || ||||| ||||||||||||||||||||||| || ||||||||||| Sbjct 513 T-CAAATCCTACTTATAAAGAAGTCTGCTCAGAAAAAACTGGCCATGCAGAAGTCGTCCG 571 Query 948 GGTTGTGTACCGGCCAGAGCACATCAGCTTTGAGGAACTGCTCAAGGTCTTCTGGGAGAA 1007 || ||||||| |||||| ||||| || |||||||||||||||||||||||||||||||| Sbjct 572 AGTGGTGTACCAGCCAGAACACATGAGTTTTGAGGAACTGCTCAAGGTCTTCTGGGAGAA 631 Query 1008 TCACGACCCGACCCAAGGCATGCGCCAAGGCAATGACTTTGGTACACAGTACCGGTCAGC 1067 |||||||||||||||||| |||||||| || || ||| ||| || |||||||| || || Sbjct 632 TCACGACCCGACCCAAGGTATGCGCCAGGGGAACGACCATGGCACTCAGTACCGCTCGGC 691 Query 1068 -AGTCTATCCC-ACATCCGCCGTGCAGATGGAAGCAGCCCTGAGATCCAAGGAAGAA-TA 1124 | |||| ||| || || ||| ||| ||||| ||||||||||| ||||| || ||| || Sbjct 692 CA-TCTA-CCCGACCTCTGCCAAGCAAATGGAGGCAGCCCTGAGCTCCAAAGA-GAACTA 748 Query 1125 CCAAAAGGTTCTTTCAAAGCATAACTTTGGCCCCATCACCACCGACATCCGAGAGGGACA 1184 |||||||||||||||| |||| ||| ||||||||||| ||||||||||| |||||||| Sbjct 749 CCAAAAGGTTCTTTCAGAGCACGGCTTCGGCCCCATCACTACCGACATCCGGGAGGGACA 808 Query 1185 -AGTGTTCTACTATGCCGAAGACTACCACCAGCAATACCTGAGCAAGAACCC-AGACGGC 1242 | | ||||||||||| ||||||||||||||||| ||||||||||||||||| | | ||| Sbjct 809 GACT-TTCTACTATGCGGAAGACTACCACCAGCAGTACCTGAGCAAGAACCCCA-ATGGC 866 Query 1243 TACTGTGGCCTCGGGGGTACTGGAGTTTCCTGCCC-GATGGCCATTAAAAAATAATTTCT 1301 ||||| ||||| ||||| || || || |||||||| | ||| |||||||||||||| || Sbjct 867 TACTGCGGCCTTGGGGGCACCGGCGTGTCCTGCCCAG-TGGGTATTAAAAAATAATTGCT 925 Query 1302 CTCCAC 1307 | |||| Sbjct 926 CCCCAC 931 >gb|AY958429.1| UniGene infoGene info Homo sapiens methionine sulfoxide reductase A1 mRNA, complete cds, alternatively spliced Length=1527 Score = 638 bits (345), Expect = 3e-179 Identities = 562/666 (84%), Gaps = 18/666 (2%) Strand=Plus/Plus Query 651 GAGGATGGGCGACTCAGCTTCGAA-AGTCATC-TCCGCAGAGGAAGCCTTGCCGGGACGC 708 |||||||||| |||| || ||||| | || || || | |||| ||||||||||| || Sbjct 311 GAGGATGGGCAACTCGGCCTCGAACA-TCGTCAGCC-CCCAGGAGGCCTTGCCGGGCCGG 368 Query 709 ACCGAGCCGATCCCTGTAACAGCCAAACACCATGTCAGTGGCAACAGAACGGTTGAACCT 768 | || | || ||||||| | |||||||| ||||||| |||||||||||| || |||||| Sbjct 369 AAGGAACAGACCCCTGTAGCGGCCAAACATCATGTCAATGGCAACAGAACAGTCGAACCT 428 Query 769 TTCCCAGAGGGAACACAGATGGCTGTATTTGGAATGGGCTGCTTCTGGGGAGCTGAGCGC 828 |||||||||||||||||||||||||||||||||||||| || |||||||||||||| | Sbjct 429 TTCCCAGAGGGAACACAGATGGCTGTATTTGGAATGGGATGTTTCTGGGGAGCTGAAAGG 488 Query 829 AAGTTCTGGGTCTTGAAAGGAGTGTACTCAACCCAAGTGGGCTTTGCAGGAGGCCACACA 888 || ||||||||||||||||||||||| ||||| ||||| || |||||||||||| | || Sbjct 489 AAATTCTGGGTCTTGAAAGGAGTGTATTCAACTCAAGTTGGTTTTGCAGGAGGCTATACT 548 Query 889 CGCAA-TCCCACCTACAAAGAGGTCTGCTCAGAAAAAACTGGCCACGCCGAAGTCGTCCG 947 ||| ||| || || ||||| ||||||||||||||||||||||| || ||||||||||| Sbjct 549 T-CAAATCCTACTTATAAAGAAGTCTGCTCAGAAAAAACTGGCCATGCAGAAGTCGTCCG 607 Query 948 GGTTGTGTACCGGCCAGAGCACATCAGCTTTGAGGAACTGCTCAAGGTCTTCTGGGAGAA 1007 || ||||||| |||||| ||||| || |||||||||||||||||||||||||||||||| Sbjct 608 AGTGGTGTACCAGCCAGAACACATGAGTTTTGAGGAACTGCTCAAGGTCTTCTGGGAGAA 667 Query 1008 TCACGACCCGACCCAAGGCATGCGCCAAGGCAATGACTTTGGTACACAGTACCGGTCAGC 1067 |||||||||||||||||| |||||||| || || ||| ||| || |||||||| || || Sbjct 668 TCACGACCCGACCCAAGGTATGCGCCAGGGGAACGACCATGGCACTCAGTACCGCTCGGC 727 Query 1068 -AGTCTATCCC-ACATCCGCCGTGCAGATGGAAGCAGCCCTGAGATCCAAGGAAGAA-TA 1124 | |||| ||| || || ||| ||| ||||| ||||||||||| ||||| || ||| || Sbjct 728 CA-TCTA-CCCGACCTCTGCCAAGCAAATGGAGGCAGCCCTGAGCTCCAAAGA-GAACTA 784 Query 1125 CCAAAAGGTTCTTTCAAAGCATAACTTTGGCCCCATCACCACCGACATCCGAGAGGGACA 1184 |||||||||||||||| |||| ||| ||||||||||| ||||||||||| |||||||| Sbjct 785 CCAAAAGGTTCTTTCAGAGCACGGCTTCGGCCCCATCACTACCGACATCCGGGAGGGACA 844 Query 1185 -AGTGTTCTACTATGCCGAAGACTACCACCAGCAATACCTGAGCAAGAACCC-AGACGGC 1242 | | ||||||||||| ||||||||||||||||| ||||||||||||||||| | | ||| Sbjct 845 GACT-TTCTACTATGCGGAAGACTACCACCAGCAGTACCTGAGCAAGAACCCCA-ATGGC 902 Query 1243 TACTGTGGCCTCGGGGGTACTGGAGTTTCCTGCCC-GATGGCCATTAAAAAATAATTTCT 1301 ||||| ||||| ||||| || || || |||||||| | ||| |||||||||||||| || Sbjct 903 TACTGCGGCCTTGGGGGCACCGGCGTGTCCTGCCCAG-TGGGTATTAAAAAATAATTGCT 961 Query 1302 CTCCAC 1307 | |||| Sbjct 962 CCCCAC 967 >emb|AJ242973.1|HSA242973 UniGene infoGeoGene info Homo sapiens mRNA for peptide methionine sulfoxide reductase (msrA gene) Length=1350 Score = 638 bits (345), Expect = 3e-179 Identities = 562/666 (84%), Gaps = 18/666 (2%) Strand=Plus/Plus Query 651 GAGGATGGGCGACTCAGCTTCGAA-AGTCATC-TCCGCAGAGGAAGCCTTGCCGGGACGC 708 |||||||||| |||| || ||||| | || || || | |||| ||||||||||| || Sbjct 275 GAGGATGGGCAACTCGGCCTCGAACA-TCGTCAGCC-CCCAGGAGGCCTTGCCGGGCCGG 332 Query 709 ACCGAGCCGATCCCTGTAACAGCCAAACACCATGTCAGTGGCAACAGAACGGTTGAACCT 768 | || | || ||||||| | |||||||| ||||||| |||||||||||| || |||||| Sbjct 333 AAGGAACAGACCCCTGTAGCGGCCAAACATCATGTCAATGGCAACAGAACAGTCGAACCT 392 Query 769 TTCCCAGAGGGAACACAGATGGCTGTATTTGGAATGGGCTGCTTCTGGGGAGCTGAGCGC 828 |||||||||||||||||||||||||||||||||||||| || |||||||||||||| | Sbjct 393 TTCCCAGAGGGAACACAGATGGCTGTATTTGGAATGGGATGTTTCTGGGGAGCTGAAAGG 452 Query 829 AAGTTCTGGGTCTTGAAAGGAGTGTACTCAACCCAAGTGGGCTTTGCAGGAGGCCACACA 888 || ||||||||||||||||||||||| ||||| ||||| || |||||||||||| | || Sbjct 453 AAATTCTGGGTCTTGAAAGGAGTGTATTCAACTCAAGTTGGTTTTGCAGGAGGCTATACT 512 Query 889 CGCAA-TCCCACCTACAAAGAGGTCTGCTCAGAAAAAACTGGCCACGCCGAAGTCGTCCG 947 ||| ||| || || ||||| ||||||||||||||||||||||| || ||||||||||| Sbjct 513 T-CAAATCCTACTTATAAAGAAGTCTGCTCAGAAAAAACTGGCCATGCAGAAGTCGTCCG 571 Query 948 GGTTGTGTACCGGCCAGAGCACATCAGCTTTGAGGAACTGCTCAAGGTCTTCTGGGAGAA 1007 || ||||||| |||||| ||||| || |||||||||||||||||||||||||||||||| Sbjct 572 AGTGGTGTACCAGCCAGAACACATGAGTTTTGAGGAACTGCTCAAGGTCTTCTGGGAGAA 631 Query 1008 TCACGACCCGACCCAAGGCATGCGCCAAGGCAATGACTTTGGTACACAGTACCGGTCAGC 1067 |||||||||||||||||| |||||||| || || ||| ||| || |||||||| || || Sbjct 632 TCACGACCCGACCCAAGGTATGCGCCAGGGGAACGACCATGGCACTCAGTACCGCTCGGC 691 Query 1068 -AGTCTATCCC-ACATCCGCCGTGCAGATGGAAGCAGCCCTGAGATCCAAGGAAGAA-TA 1124 | |||| ||| || || ||| ||| ||||| ||||||||||| ||||| || ||| || Sbjct 692 CA-TCTA-CCCGACCTCTGCCAAGCAAATGGAGGCAGCCCTGAGCTCCAAAGA-GAACTA 748 Query 1125 CCAAAAGGTTCTTTCAAAGCATAACTTTGGCCCCATCACCACCGACATCCGAGAGGGACA 1184 |||||||||||||||| |||| ||| ||||||||||| ||||||||||| |||||||| Sbjct 749 CCAAAAGGTTCTTTCAGAGCACGGCTTCGGCCCCATCACTACCGACATCCGGGAGGGACA 808 Query 1185 -AGTGTTCTACTATGCCGAAGACTACCACCAGCAATACCTGAGCAAGAACCC-AGACGGC 1242 | | ||||||||||| ||||||||||||||||| ||||||||||||||||| | | ||| Sbjct 809 GACT-TTCTACTATGCGGAAGACTACCACCAGCAGTACCTGAGCAAGAACCCCA-ATGGC 866 Query 1243 TACTGTGGCCTCGGGGGTACTGGAGTTTCCTGCCC-GATGGCCATTAAAAAATAATTTCT 1301 ||||| ||||| ||||| || || || |||||||| | ||| |||||||||||||| || Sbjct 867 TACTGCGGCCTTGGGGGCACCGGCGTGTCCTGCCCAG-TGGGTATTAAAAAATAATTGCT 925 Query 1302 CTCCAC 1307 | |||| Sbjct 926 CCCCAC 931 >ref|XM_001089893.1| UniGene infoGene info PREDICTED: Macaca mulatta similar to Peptide methionine sulfoxide reductase (Protein-methionine-S-oxide reductase) (PMSR) (Peptide Met(O) reductase), transcript variant 3 (MSRA), mRNA Length=1530 Score = 627 bits (339), Expect = 6e-176 Identities = 560/666 (84%), Gaps = 17/666 (2%) Strand=Plus/Plus Query 651 GAGGATGGGCGACTCAGCTTCGAAAGTCATC-TC--CGCAGAGGAAGCCTTGCCGGGACG 707 |||||||||| |||| || ||| || |||| || | | |||| ||||||||||| || Sbjct 306 GAGGATGGGCAACTCGGCCTCG--AG-CATCGTCAGCCCCCAGGAGGCCTTGCCGGGCCG 362 Query 708 CACCGAGCCGATCCCTGTAACAGCCAAACACCATGTCAGTGGCAACAGAACGGTTGAACC 767 | || | || ||||||| | |||||||| ||||||| |||||||||||| || ||||| Sbjct 363 GAAGGAACAGACCCCTGTAGCGGCCAAACATCATGTCAATGGCAACAGAACAGTCGAACC 422 Query 768 TTTCCCAGAGGGAACACAGATGGCTGTATTTGGAATGGGCTGCTTCTGGGGAGCTGAGCG 827 |||||||||||||||||||||||||||||||||||||||||| |||||||||||||| | Sbjct 423 TTTCCCAGAGGGAACACAGATGGCTGTATTTGGAATGGGCTGTTTCTGGGGAGCTGAAAG 482 Query 828 CAAGTTCTGGGTCTTGAAAGGAGTGTACTCAACCCAAGTGGGCTTTGCAGGAGGCCACAC 887 || |||||||||||||||||||| || ||||| ||||| || |||||||||||| | || Sbjct 483 GAAATTCTGGGTCTTGAAAGGAGTATATTCAACTCAAGTTGGTTTTGCAGGAGGCTATAC 542 Query 888 ACGCAA-TCCCACCTACAAAGAGGTCTGCTCAGAAAAAACTGGCCACGCCGAAGTCGTCC 946 ||| ||| || || ||||| ||||||||||||||||||||||| || |||||||||| Sbjct 543 TT-CAAATCCTACTTATAAAGAAGTCTGCTCAGAAAAAACTGGCCATGCAGAAGTCGTCC 601 Query 947 GGGTTGTGTACCGGCCAGAGCACATCAGCTTTGAGGAACTGCTCAAGGTCTTCTGGGAGA 1006 | || ||||||| |||||| |||||||| ||||||||||||||||||||||||||||||| Sbjct 602 GAGTGGTGTACCAGCCAGAACACATCAGTTTTGAGGAACTGCTCAAGGTCTTCTGGGAGA 661 Query 1007 ATCACGACCCGACCCAAGGCATGCGCCAAGGCAATGACTTTGGTACACAGTACCGGTCAG 1066 ||||||||||||||||||| |||||||| || || ||| ||| || |||||||| || | Sbjct 662 ATCACGACCCGACCCAAGGTATGCGCCAGGGGAACGACCATGGCACTCAGTACCGCTCGG 721 Query 1067 C-AGTCTATCCC-ACATCCGCCGTGCAGATGGAAGCAGCCCTGAGATCCAAGGAAGAATA 1124 | | |||| ||| || |||||| ||| ||||| || |||||||| ||||| || || || Sbjct 722 CCA-TCTA-CCCGACTTCCGCCAAGCAAATGGAGGCGGCCCTGAGCTCCAAAGAGGACTA 779 Query 1125 CCAAAAGGTTCTTTCAAAGCATAACTTTGGCCCCATCACCACCGACATCCGAGAGGGACA 1184 |||||||||||||||| |||| ||||||||||||||| || || ||||| || ||||| Sbjct 780 CCAAAAGGTTCTTTCAGAGCACGGCTTTGGCCCCATCACTACGGAGATCCGGGAAGGACA 839 Query 1185 -AGTGTTCTACTATGCCGAAGACTACCACCAGCAATACCTGAGCAAGAACCC-AGACGGC 1242 | | |||||||| || ||||||||||||||||| ||||||||||||||||| | |||| Sbjct 840 GATT-TTCTACTACGCGGAAGACTACCACCAGCAGTACCTGAGCAAGAACCCCA-ACGGA 897 Query 1243 TACTGTGGCCTCGGGGGTACTGGAGTTTCCTGCCCGATGGCCA-TTAAAAAATAATTTCT 1301 ||||| ||||| ||||| || || || |||||||| |||| | |||||||||||||||| Sbjct 898 TACTGCGGCCTTGGGGGCACCGGCGTGTCCTGCCCAATGGGTAATTAAAAAATAATTTCT 957 Query 1302 CTCCAC 1307 | |||| Sbjct 958 CCCCAC 963 >gb|AF183420.1|AF183420 UniGene infoGeoGene info Homo sapiens peptide methionine sulfoxide reductase mRNA, complete cds Length=1343 Score = 619 bits (335), Expect = 1e-173 Identities = 601/727 (82%), Gaps = 28/727 (3%) Strand=Plus/Plus Query 592 CCCATGCTCTCCGCCTCTAGAAGGGCTCT-CCAGCTCCTCTCTAG-CGCCAACCCGGTAC 649 ||||||||||| ||| | | |||||| | |||||| | | | || | | ||| || | Sbjct 64 CCCATGCTCTCGGCCACCCGGAGGGCT-TGCCAGCT-C-CAC-AGCCTCTTTCCC-GTCC 118 Query 650 GGAGGATGGGCGACTCAGCTTCGAA-AGTCATC-TCCGCAGAGGAAGCCTTGCCGGGACG 707 |||||||||| |||| || ||||| | || || || | |||| ||||||||||| || Sbjct 119 CGAGGATGGGCAACTCGGCCTCGAACA-TCGTCAGCC-CCCAGGAGGCCTTGCCGGGCCG 176 Query 708 CACCGAGCCGATCCCTGTAACAGCCAAACACCATGTCAGTGGCAACAGAACGGTTGAACC 767 | || | || ||||||| | |||||||| ||||||| |||||||||||| || ||||| Sbjct 177 GAAGGAACAGACCCCTGTAGCGGCCAAACATCATGTCAATGGCAACAGAACAGTCGAACC 236 Query 768 TTTCCCAGAGGGAACACAGATGGCTGTATTTGGAATGGGCTGCTTCTGGGGAGCTGAGCG 827 ||||||||||||||||||||||||||||||||||||||| || |||||||||||||| | Sbjct 237 TTTCCCAGAGGGAACACAGATGGCTGTATTTGGAATGGGATGTTTCTGGGGAGCTGAAAG 296 Query 828 CAAGTTCTGGGTCTTGAAAGGAGTGTACTCAACCCAAGTGGGCTTTGCAGGAGGCCACAC 887 || ||||||||||||||||||||||| ||||| ||||| || |||||||||||| | || Sbjct 297 GAAATTCTGGGTCTTGAAAGGAGTGTATTCAACTCAAGTTGGTTTTGCAGGAGGCTATAC 356 Query 888 ACGCAA-TCCCACCTACAAAGAGGTCTGCTCAGAAAAAACTGGCCACGCCGAAGTCGTCC 946 ||| ||| || || ||||| ||||||||||||||||||||||| || |||||||||| Sbjct 357 TT-CAAATCCTACTTATAAAGAAGTCTGCTCAGAAAAAACTGGCCATGCAGAAGTCGTCC 415 Query 947 GGGTTGTGTACCGGCCAGAGCACATCAGCTTTGAGGAACTGCTCAAGGTCTTCTGGGAGA 1006 | || ||||||| |||||| ||||| || |||||||||||| |||||| ||| ||||||| Sbjct 416 GAGTGGTGTACCAGCCAGAACACATGAGTTTTGAGGAACTG-TCAAGG-CTT-TGGGAGA 472 Query 1007 ATCACGACCCGACCCAAGGCATGCGCCAAGGCAATGACTTTGGTACACAGTACCGGTCAG 1066 ||||||||||||||||||| |||||||| || || ||| ||| || |||||||| || | Sbjct 473 ATCACGACCCGACCCAAGGTATGCGCCAGGGGAACGACCATGGCACTCAGTACCGTTCGG 532 Query 1067 C-AGTCTATCCC-ACATCCGCCGTGCAGATGGAAGCAGCCCTGAGATCCAAGGAAGAA-T 1123 | | |||| ||| || || ||| ||| ||||| ||||||||||| ||||| || ||| | Sbjct 533 CCA-TCTA-CCCGACCTCTGCCAAGCAAATGGAGGCAGCCCTGAGCTCCAAAGA-GAACT 589 Query 1124 ACCAAAAGGTTCTTTCAAAGCATAACTTTGGCCCCATCACCACCGACATCCGAGAGGGAC 1183 ||||||||||||||||| |||| ||| ||||||||||| ||||||||||| ||||||| Sbjct 590 ACCAAAAGGTTCTTTCAGAGCACGGCTTCGGCCCCATCACTACCGACATCCGGGAGGGAC 649 Query 1184 A-AGTGTTCTACTATGCCGAAGACTACCACCAGCAATACCTGAGCAAGAACCC-AGACGG 1241 | | | ||||||||||| ||||||||||||||||| ||||||||||||||||| | | || Sbjct 650 AGACT-TTCTACTATGCGGAAGACTACCACCAGCAGTACCTGAGCAAGAACCCCA-ATGG 707 Query 1242 CTACTGTGGCCTCGGGGGTACTGGAGTTTCCTGCCC-GATGGCCATTAAAAAATAATTTC 1300 |||||| ||||| ||||| || || || |||||||| | ||| |||||||||||||| | Sbjct 708 CTACTGCGGCCTTGGGGGCACCGGCGTGTCCTGCCCAG-TGGGTATTAAAAAATAATTGC 766 Query 1301 TCTCCAC 1307 || |||| Sbjct 767 TCCCCAC 773 >ref|XM_001138120.1| Gene info PREDICTED: Pan troglodytes similar to cytosolic methionine-S-sulfoxide reductase, transcript variant 5 (LOC739556), mRNA Length=1708 Score = 617 bits (334), Expect = 4e-173 Identities = 503/584 (86%), Gaps = 14/584 (2%) Strand=Plus/Plus Query 731 CCAAACACCATGTCAGTGGCAACAGAACGGTTGAACCTTTCCCAGAGGGAACACAGATGG 790 ||||||| ||||||| |||||||||||| || |||||||||||||||||||||||||||| Sbjct 564 CCAAACATCATGTCAATGGCAACAGAACAGTCGAACCTTTCCCAGAGGGAACACAGATGG 623 Query 791 CTGTATTTGGAATGGGCTGCTTCTGGGGAGCTGAGCGCAAGTTCTGGGTCTTGAAAGGAG 850 |||||||||||||||| || |||||||||||||| | || ||||||||||||||||||| Sbjct 624 CTGTATTTGGAATGGGATGTTTCTGGGGAGCTGAAAGGAAATTCTGGGTCTTGAAAGGAG 683 Query 851 TGTACTCAACCCAAGTGGGCTTTGCAGGAGGCCACACACGCAA-TCCCACCTACAAAGAG 909 |||| ||||| ||||| || |||||||||||| | || ||| ||| || || ||||| Sbjct 684 TGTATTCAACTCAAGTTGGTTTTGCAGGAGGCTATACTT-CAAATCCTACTTATAAAGAA 742 Query 910 GTCTGCTCAGAAAAAACTGGCCACGCCGAAGTCGTCCGGGTTGTGTACCGGCCAGAGCAC 969 ||||||||||||||||||||||| || ||||||||||| || ||||||| |||||| ||| Sbjct 743 GTCTGCTCAGAAAAAACTGGCCATGCAGAAGTCGTCCGAGTGGTGTACCAGCCAGAACAC 802 Query 970 ATCAGCTTTGAGGAACTGCTCAAGGTCTTCTGGGAGAATCACGACCCGACCCAAGGCATG 1029 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct 803 ATCAGTTTTGAGGAACTGCTCAAGGTCTTCTGGGAGAATCACGACCCGACCCAAGGTATG 862 Query 1030 CGCCAAGGCAATGACTTTGGTACACAGTACCGGTCAGC-AGTCTATCCC-ACATCCGCCG 1087 ||||| || || ||| ||| || |||||||| || || | |||| ||| || || ||| Sbjct 863 CGCCAGGGGAACGACCATGGCACTCAGTACCGCTCGGCCA-TCTA-CCCGACCTCTGCCA 920 Query 1088 TGCAGATGGAAGCAGCCCTGAGATCCAAGGAAGAA-TACCAAAAGGTTCTTTCAAAGCAT 1146 ||| ||||| ||||||||||| ||||| || ||| |||||||||||||||||| |||| Sbjct 921 AGCAAATGGAGGCAGCCCTGAGCTCCAAAGA-GAACTACCAAAAGGTTCTTTCAGAGCAC 979 Query 1147 AACTTTGGCCCCATCACCACCGACATCCGAGAGGGACA-AGTGTTCTACTATGCCGAAGA 1205 ||| ||||||||||| ||||||||||| |||||||| | | ||||||||||| ||||| Sbjct 980 GGCTTCGGCCCCATCACTACCGACATCCGGGAGGGACAGACT-TTCTACTATGCGGAAGA 1038 Query 1206 CTACCACCAGCAATACCTGAGCAAGAACCC-AGACGGCTACTGTGGCCTCGGGGGTACTG 1264 |||||||||||| ||||||||||||||||| | | |||||||| ||||| ||||| || | Sbjct 1039 CTACCACCAGCAGTACCTGAGCAAGAACCCCA-ATGGCTACTGCGGCCTTGGGGGCACCG 1097 Query 1265 GAGTTTCCTGCCC-GATGGCCATTAAAAAATAATTTCTCTCCAC 1307 | || |||||||| | ||| |||||||||||||||||| |||| Sbjct 1098 GCGTGTCCTGCCCAG-TGGGTATTAAAAAATAATTTCTCCCCAC 1140 >ref|XM_001138207.1| Gene info PREDICTED: Pan troglodytes similar to cytosolic methionine-S-sulfoxide reductase, transcript variant 6 (LOC739556), mRNA Length=1633 Score = 617 bits (334), Expect = 4e-173 Identities = 503/584 (86%), Gaps = 14/584 (2%) Strand=Plus/Plus Query 731 CCAAACACCATGTCAGTGGCAACAGAACGGTTGAACCTTTCCCAGAGGGAACACAGATGG 790 ||||||| ||||||| |||||||||||| || |||||||||||||||||||||||||||| Sbjct 489 CCAAACATCATGTCAATGGCAACAGAACAGTCGAACCTTTCCCAGAGGGAACACAGATGG 548 Query 791 CTGTATTTGGAATGGGCTGCTTCTGGGGAGCTGAGCGCAAGTTCTGGGTCTTGAAAGGAG 850 |||||||||||||||| || |||||||||||||| | || ||||||||||||||||||| Sbjct 549 CTGTATTTGGAATGGGATGTTTCTGGGGAGCTGAAAGGAAATTCTGGGTCTTGAAAGGAG 608 Query 851 TGTACTCAACCCAAGTGGGCTTTGCAGGAGGCCACACACGCAA-TCCCACCTACAAAGAG 909 |||| ||||| ||||| || |||||||||||| | || ||| ||| || || ||||| Sbjct 609 TGTATTCAACTCAAGTTGGTTTTGCAGGAGGCTATACTT-CAAATCCTACTTATAAAGAA 667 Query 910 GTCTGCTCAGAAAAAACTGGCCACGCCGAAGTCGTCCGGGTTGTGTACCGGCCAGAGCAC 969 ||||||||||||||||||||||| || ||||||||||| || ||||||| |||||| ||| Sbjct 668 GTCTGCTCAGAAAAAACTGGCCATGCAGAAGTCGTCCGAGTGGTGTACCAGCCAGAACAC 727 Query 970 ATCAGCTTTGAGGAACTGCTCAAGGTCTTCTGGGAGAATCACGACCCGACCCAAGGCATG 1029 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct 728 ATCAGTTTTGAGGAACTGCTCAAGGTCTTCTGGGAGAATCACGACCCGACCCAAGGTATG 787 Query 1030 CGCCAAGGCAATGACTTTGGTACACAGTACCGGTCAGC-AGTCTATCCC-ACATCCGCCG 1087 ||||| || || ||| ||| || |||||||| || || | |||| ||| || || ||| Sbjct 788 CGCCAGGGGAACGACCATGGCACTCAGTACCGCTCGGCCA-TCTA-CCCGACCTCTGCCA 845 Query 1088 TGCAGATGGAAGCAGCCCTGAGATCCAAGGAAGAA-TACCAAAAGGTTCTTTCAAAGCAT 1146 ||| ||||| ||||||||||| ||||| || ||| |||||||||||||||||| |||| Sbjct 846 AGCAAATGGAGGCAGCCCTGAGCTCCAAAGA-GAACTACCAAAAGGTTCTTTCAGAGCAC 904 Query 1147 AACTTTGGCCCCATCACCACCGACATCCGAGAGGGACA-AGTGTTCTACTATGCCGAAGA 1205 ||| ||||||||||| ||||||||||| |||||||| | | ||||||||||| ||||| Sbjct 905 GGCTTCGGCCCCATCACTACCGACATCCGGGAGGGACAGACT-TTCTACTATGCGGAAGA 963 Query 1206 CTACCACCAGCAATACCTGAGCAAGAACCC-AGACGGCTACTGTGGCCTCGGGGGTACTG 1264 |||||||||||| ||||||||||||||||| | | |||||||| ||||| ||||| || | Sbjct 964 CTACCACCAGCAGTACCTGAGCAAGAACCCCA-ATGGCTACTGCGGCCTTGGGGGCACCG 1022 Query 1265 GAGTTTCCTGCCC-GATGGCCATTAAAAAATAATTTCTCTCCAC 1307 | || |||||||| | ||| |||||||||||||||||| |||| Sbjct 1023 GCGTGTCCTGCCCAG-TGGGTATTAAAAAATAATTTCTCCCCAC 1065 >gb|BC047552.1| UniGene infoGene info Homo sapiens methionine sulfoxide reductase A, mRNA (cDNA clone IMAGE:5302099), with apparent retained intron Length=1722 Score = 606 bits (328), Expect = 8e-170 Identities = 501/584 (85%), Gaps = 14/584 (2%) Strand=Plus/Plus Query 731 CCAAACACCATGTCAGTGGCAACAGAACGGTTGAACCTTTCCCAGAGGGAACACAGATGG 790 ||||||| ||||||| |||||||||||| || |||||||||||||||||||||||||||| Sbjct 564 CCAAACATCATGTCAATGGCAACAGAACAGTCGAACCTTTCCCAGAGGGAACACAGATGG 623 Query 791 CTGTATTTGGAATGGGCTGCTTCTGGGGAGCTGAGCGCAAGTTCTGGGTCTTGAAAGGAG 850 |||||||||||||||| || |||||||||||||| | || ||||||||||||||||||| Sbjct 624 CTGTATTTGGAATGGGATGTTTCTGGGGAGCTGAAAGGAAATTCTGGGTCTTGAAAGGAG 683 Query 851 TGTACTCAACCCAAGTGGGCTTTGCAGGAGGCCACACACGCAA-TCCCACCTACAAAGAG 909 |||| ||||| ||||| || |||||||||||| | || ||| ||| || || ||||| Sbjct 684 TGTATTCAACTCAAGTTGGTTTTGCAGGAGGCTATACTT-CAAATCCTACTTATAAAGAA 742 Query 910 GTCTGCTCAGAAAAAACTGGCCACGCCGAAGTCGTCCGGGTTGTGTACCGGCCAGAGCAC 969 ||||||||||||||||||||||| || ||||||||||| || ||||||| |||||| ||| Sbjct 743 GTCTGCTCAGAAAAAACTGGCCATGCAGAAGTCGTCCGAGTGGTGTACCAGCCAGAACAC 802 Query 970 ATCAGCTTTGAGGAACTGCTCAAGGTCTTCTGGGAGAATCACGACCCGACCCAAGGCATG 1029 || || |||||||||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct 803 ATGAGTTTTGAGGAACTGCTCAAGGTCTTCTGGGAGAATCACGACCCGACCCAAGGTATG 862 Query 1030 CGCCAAGGCAATGACTTTGGTACACAGTACCGGTCAGC-AGTCTATCCC-ACATCCGCCG 1087 ||||| || || ||| ||| || |||||||| || || | |||| ||| || || ||| Sbjct 863 CGCCAGGGGAACGACCATGGCACTCAGTACCGCTCGGCCA-TCTA-CCCGACCTCTGCCA 920 Query 1088 TGCAGATGGAAGCAGCCCTGAGATCCAAGGAAGAA-TACCAAAAGGTTCTTTCAAAGCAT 1146 ||| ||||| ||||||||||| ||||| || ||| |||||||||||||||||| |||| Sbjct 921 AGCAAATGGAGGCAGCCCTGAGCTCCAAAGA-GAACTACCAAAAGGTTCTTTCAGAGCAC 979 Query 1147 AACTTTGGCCCCATCACCACCGACATCCGAGAGGGACA-AGTGTTCTACTATGCCGAAGA 1205 ||| ||||||||||| ||||||||||| |||||||| | | ||||||||||| ||||| Sbjct 980 GGCTTCGGCCCCATCACTACCGACATCCGGGAGGGACAGACT-TTCTACTATGCGGAAGA 1038 Query 1206 CTACCACCAGCAATACCTGAGCAAGAACCC-AGACGGCTACTGTGGCCTCGGGGGTACTG 1264 |||||||||||| ||||||||||||||||| | | |||||||| ||||| ||||| || | Sbjct 1039 CTACCACCAGCAGTACCTGAGCAAGAACCCCA-ATGGCTACTGCGGCCTTGGGGGCACCG 1097 Query 1265 GAGTTTCCTGCCC-GATGGCCATTAAAAAATAATTTCTCTCCAC 1307 | || |||||||| | ||| |||||||||||||| ||| |||| Sbjct 1098 GCGTGTCCTGCCCAG-TGGGTATTAAAAAATAATTGCTCCCCAC 1140 >gb|AY958431.1| UniGene infoGene info Homo sapiens methionine sulfoxide reductase A3 mRNA, complete cds, alternatively spliced Length=1631 Score = 606 bits (328), Expect = 8e-170 Identities = 501/584 (85%), Gaps = 14/584 (2%) Strand=Plus/Plus Query 731 CCAAACACCATGTCAGTGGCAACAGAACGGTTGAACCTTTCCCAGAGGGAACACAGATGG 790 ||||||| ||||||| |||||||||||| || |||||||||||||||||||||||||||| Sbjct 489 CCAAACATCATGTCAATGGCAACAGAACAGTCGAACCTTTCCCAGAGGGAACACAGATGG 548 Query 791 CTGTATTTGGAATGGGCTGCTTCTGGGGAGCTGAGCGCAAGTTCTGGGTCTTGAAAGGAG 850 |||||||||||||||| || |||||||||||||| | || ||||||||||||||||||| Sbjct 549 CTGTATTTGGAATGGGATGTTTCTGGGGAGCTGAAAGGAAATTCTGGGTCTTGAAAGGAG 608 Query 851 TGTACTCAACCCAAGTGGGCTTTGCAGGAGGCCACACACGCAA-TCCCACCTACAAAGAG 909 |||| ||||| ||||| || |||||||||||| | || ||| ||| || || ||||| Sbjct 609 TGTATTCAACTCAAGTTGGTTTTGCAGGAGGCTATACTT-CAAATCCTACTTATAAAGAA 667 Query 910 GTCTGCTCAGAAAAAACTGGCCACGCCGAAGTCGTCCGGGTTGTGTACCGGCCAGAGCAC 969 ||||||||||||||||||||||| || ||||||||||| || ||||||| |||||| ||| Sbjct 668 GTCTGCTCAGAAAAAACTGGCCATGCAGAAGTCGTCCGAGTGGTGTACCAGCCAGAACAC 727 Query 970 ATCAGCTTTGAGGAACTGCTCAAGGTCTTCTGGGAGAATCACGACCCGACCCAAGGCATG 1029 || || |||||||||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct 728 ATGAGTTTTGAGGAACTGCTCAAGGTCTTCTGGGAGAATCACGACCCGACCCAAGGTATG 787 Query 1030 CGCCAAGGCAATGACTTTGGTACACAGTACCGGTCAGC-AGTCTATCCC-ACATCCGCCG 1087 ||||| || || ||| ||| || |||||||| || || | |||| ||| || || ||| Sbjct 788 CGCCAGGGGAACGACCATGGCACTCAGTACCGCTCGGCCA-TCTA-CCCGACCTCTGCCA 845 Query 1088 TGCAGATGGAAGCAGCCCTGAGATCCAAGGAAGAA-TACCAAAAGGTTCTTTCAAAGCAT 1146 ||| ||||| ||||||||||| ||||| || ||| |||||||||||||||||| |||| Sbjct 846 AGCAAATGGAGGCAGCCCTGAGCTCCAAAGA-GAACTACCAAAAGGTTCTTTCAGAGCAC 904 Query 1147 AACTTTGGCCCCATCACCACCGACATCCGAGAGGGACA-AGTGTTCTACTATGCCGAAGA 1205 ||| ||||||||||| ||||||||||| |||||||| | | ||||||||||| ||||| Sbjct 905 GGCTTCGGCCCCATCACTACCGACATCCGGGAGGGACAGACT-TTCTACTATGCGGAAGA 963 Query 1206 CTACCACCAGCAATACCTGAGCAAGAACCC-AGACGGCTACTGTGGCCTCGGGGGTACTG 1264 |||||||||||| ||||||||||||||||| | | |||||||| ||||| ||||| || | Sbjct 964 CTACCACCAGCAGTACCTGAGCAAGAACCCCA-ATGGCTACTGCGGCCTTGGGGGCACCG 1022 Query 1265 GAGTTTCCTGCCC-GATGGCCATTAAAAAATAATTTCTCTCCAC 1307 | || |||||||| | ||| |||||||||||||| ||| |||| Sbjct 1023 GCGTGTCCTGCCCAG-TGGGTATTAAAAAATAATTGCTCCCCAC 1065 >gb|AY958430.1| UniGene infoGene info Homo sapiens methionine sulfoxide reductase A2 mRNA, complete cds, alternatively spliced Length=1706 Score = 606 bits (328), Expect = 8e-170 Identities = 501/584 (85%), Gaps = 14/584 (2%) Strand=Plus/Plus Query 731 CCAAACACCATGTCAGTGGCAACAGAACGGTTGAACCTTTCCCAGAGGGAACACAGATGG 790 ||||||| ||||||| |||||||||||| || |||||||||||||||||||||||||||| Sbjct 564 CCAAACATCATGTCAATGGCAACAGAACAGTCGAACCTTTCCCAGAGGGAACACAGATGG 623 Query 791 CTGTATTTGGAATGGGCTGCTTCTGGGGAGCTGAGCGCAAGTTCTGGGTCTTGAAAGGAG 850 |||||||||||||||| || |||||||||||||| | || ||||||||||||||||||| Sbjct 624 CTGTATTTGGAATGGGATGTTTCTGGGGAGCTGAAAGGAAATTCTGGGTCTTGAAAGGAG 683 Query 851 TGTACTCAACCCAAGTGGGCTTTGCAGGAGGCCACACACGCAA-TCCCACCTACAAAGAG 909 |||| ||||| ||||| || |||||||||||| | || ||| ||| || || ||||| Sbjct 684 TGTATTCAACTCAAGTTGGTTTTGCAGGAGGCTATACTT-CAAATCCTACTTATAAAGAA 742 Query 910 GTCTGCTCAGAAAAAACTGGCCACGCCGAAGTCGTCCGGGTTGTGTACCGGCCAGAGCAC 969 ||||||||||||||||||||||| || ||||||||||| || ||||||| |||||| ||| Sbjct 743 GTCTGCTCAGAAAAAACTGGCCATGCAGAAGTCGTCCGAGTGGTGTACCAGCCAGAACAC 802 Query 970 ATCAGCTTTGAGGAACTGCTCAAGGTCTTCTGGGAGAATCACGACCCGACCCAAGGCATG 1029 || || |||||||||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct 803 ATGAGTTTTGAGGAACTGCTCAAGGTCTTCTGGGAGAATCACGACCCGACCCAAGGTATG 862 Query 1030 CGCCAAGGCAATGACTTTGGTACACAGTACCGGTCAGC-AGTCTATCCC-ACATCCGCCG 1087 ||||| || || ||| ||| || |||||||| || || | |||| ||| || || ||| Sbjct 863 CGCCAGGGGAACGACCATGGCACTCAGTACCGCTCGGCCA-TCTA-CCCGACCTCTGCCA 920 Query 1088 TGCAGATGGAAGCAGCCCTGAGATCCAAGGAAGAA-TACCAAAAGGTTCTTTCAAAGCAT 1146 ||| ||||| ||||||||||| ||||| || ||| |||||||||||||||||| |||| Sbjct 921 AGCAAATGGAGGCAGCCCTGAGCTCCAAAGA-GAACTACCAAAAGGTTCTTTCAGAGCAC 979 Query 1147 AACTTTGGCCCCATCACCACCGACATCCGAGAGGGACA-AGTGTTCTACTATGCCGAAGA 1205 ||| ||||||||||| ||||||||||| |||||||| | | ||||||||||| ||||| Sbjct 980 GGCTTCGGCCCCATCACTACCGACATCCGGGAGGGACAGACT-TTCTACTATGCGGAAGA 1038 Query 1206 CTACCACCAGCAATACCTGAGCAAGAACCC-AGACGGCTACTGTGGCCTCGGGGGTACTG 1264 |||||||||||| ||||||||||||||||| | | |||||||| ||||| ||||| || | Sbjct 1039 CTACCACCAGCAGTACCTGAGCAAGAACCCCA-ATGGCTACTGCGGCCTTGGGGGCACCG 1097 Query 1265 GAGTTTCCTGCCC-GATGGCCATTAAAAAATAATTTCTCTCCAC 1307 | || |||||||| | ||| |||||||||||||| ||| |||| Sbjct 1098 GCGTGTCCTGCCCAG-TGGGTATTAAAAAATAATTGCTCCCCAC 1140 >gb|AY690665.1| UniGene infoGene info Homo sapiens cytosolic methionine-S-sulfoxide reductase (MSRA) mRNA, complete cds, alternatively spliced Length=1157 Score = 606 bits (328), Expect = 8e-170 Identities = 501/584 (85%), Gaps = 14/584 (2%) Strand=Plus/Plus Query 731 CCAAACACCATGTCAGTGGCAACAGAACGGTTGAACCTTTCCCAGAGGGAACACAGATGG 790 ||||||| ||||||| |||||||||||| || |||||||||||||||||||||||||||| Sbjct 160 CCAAACATCATGTCAATGGCAACAGAACAGTCGAACCTTTCCCAGAGGGAACACAGATGG 219 Query 791 CTGTATTTGGAATGGGCTGCTTCTGGGGAGCTGAGCGCAAGTTCTGGGTCTTGAAAGGAG 850 |||||||||||||||| || |||||||||||||| | || ||||||||||||||||||| Sbjct 220 CTGTATTTGGAATGGGATGTTTCTGGGGAGCTGAAAGGAAATTCTGGGTCTTGAAAGGAG 279 Query 851 TGTACTCAACCCAAGTGGGCTTTGCAGGAGGCCACACACGCAA-TCCCACCTACAAAGAG 909 |||| ||||| ||||| || |||||||||||| | || ||| ||| || || ||||| Sbjct 280 TGTATTCAACTCAAGTTGGTTTTGCAGGAGGCTATACTT-CAAATCCTACTTATAAAGAA 338 Query 910 GTCTGCTCAGAAAAAACTGGCCACGCCGAAGTCGTCCGGGTTGTGTACCGGCCAGAGCAC 969 ||||||||||||||||||||||| || ||||||||||| || ||||||| |||||| ||| Sbjct 339 GTCTGCTCAGAAAAAACTGGCCATGCAGAAGTCGTCCGAGTGGTGTACCAGCCAGAACAC 398 Query 970 ATCAGCTTTGAGGAACTGCTCAAGGTCTTCTGGGAGAATCACGACCCGACCCAAGGCATG 1029 || || |||||||||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct 399 ATGAGTTTTGAGGAACTGCTCAAGGTCTTCTGGGAGAATCACGACCCGACCCAAGGTATG 458 Query 1030 CGCCAAGGCAATGACTTTGGTACACAGTACCGGTCAGC-AGTCTATCCC-ACATCCGCCG 1087 ||||| || || ||| ||| || |||||||| || || | |||| ||| || || ||| Sbjct 459 CGCCAGGGGAACGACCATGGCACTCAGTACCGCTCGGCCA-TCTA-CCCGACCTCTGCCA 516 Query 1088 TGCAGATGGAAGCAGCCCTGAGATCCAAGGAAGAA-TACCAAAAGGTTCTTTCAAAGCAT 1146 ||| ||||| ||||||||||| ||||| || ||| |||||||||||||||||| |||| Sbjct 517 AGCAAATGGAGGCAGCCCTGAGCTCCAAAGA-GAACTACCAAAAGGTTCTTTCAGAGCAC 575 Query 1147 AACTTTGGCCCCATCACCACCGACATCCGAGAGGGACA-AGTGTTCTACTATGCCGAAGA 1205 ||| ||||||||||| ||||||||||| |||||||| | | ||||||||||| ||||| Sbjct 576 GGCTTCGGCCCCATCACTACCGACATCCGGGAGGGACAGACT-TTCTACTATGCGGAAGA 634 Query 1206 CTACCACCAGCAATACCTGAGCAAGAACCC-AGACGGCTACTGTGGCCTCGGGGGTACTG 1264 |||||||||||| ||||||||||||||||| | | |||||||| ||||| ||||| || | Sbjct 635 CTACCACCAGCAGTACCTGAGCAAGAACCCCA-ATGGCTACTGCGGCCTTGGGGGCACCG 693 Query 1265 GAGTTTCCTGCCC-GATGGCCATTAAAAAATAATTTCTCTCCAC 1307 | || |||||||| | ||| |||||||||||||| ||| |||| Sbjct 694 GCGTGTCCTGCCCAG-TGGGTATTAAAAAATAATTGCTCCCCAC 736 >ref|XM_001089777.1| UniGene infoGene info PREDICTED: Macaca mulatta similar to Peptide methionine sulfoxide reductase (Protein-methionine-S-oxide reductase) (PMSR) (Peptide Met(O) reductase), transcript variant 2 (MSRA), mRNA Length=1632 Score = 601 bits (325), Expect = 4e-168 Identities = 499/583 (85%), Gaps = 11/583 (1%) Strand=Plus/Plus Query 731 CCAAACACCATGTCAGTGGCAACAGAACGGTTGAACCTTTCCCAGAGGGAACACAGATGG 790 ||||||| ||||||| |||||||||||| || |||||||||||||||||||||||||||| Sbjct 488 CCAAACATCATGTCAATGGCAACAGAACAGTCGAACCTTTCCCAGAGGGAACACAGATGG 547 Query 791 CTGTATTTGGAATGGGCTGCTTCTGGGGAGCTGAGCGCAAGTTCTGGGTCTTGAAAGGAG 850 ||||||||||||||||||| |||||||||||||| | || ||||||||||||||||||| Sbjct 548 CTGTATTTGGAATGGGCTGTTTCTGGGGAGCTGAAAGGAAATTCTGGGTCTTGAAAGGAG 607 Query 851 TGTACTCAACCCAAGTGGGCTTTGCAGGAGGCCACACACGCAA-TCCCACCTACAAAGAG 909 | || ||||| ||||| || |||||||||||| | || ||| ||| || || ||||| Sbjct 608 TATATTCAACTCAAGTTGGTTTTGCAGGAGGCTATACTT-CAAATCCTACTTATAAAGAA 666 Query 910 GTCTGCTCAGAAAAAACTGGCCACGCCGAAGTCGTCCGGGTTGTGTACCGGCCAGAGCAC 969 ||||||||||||||||||||||| || ||||||||||| || ||||||| |||||| ||| Sbjct 667 GTCTGCTCAGAAAAAACTGGCCATGCAGAAGTCGTCCGAGTGGTGTACCAGCCAGAACAC 726 Query 970 ATCAGCTTTGAGGAACTGCTCAAGGTCTTCTGGGAGAATCACGACCCGACCCAAGGCATG 1029 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct 727 ATCAGTTTTGAGGAACTGCTCAAGGTCTTCTGGGAGAATCACGACCCGACCCAAGGTATG 786 Query 1030 CGCCAAGGCAATGACTTTGGTACACAGTACCGGTCAGC-AGTCTATCCC-ACATCCGCCG 1087 ||||| || || ||| ||| || |||||||| || || | |||| ||| || |||||| Sbjct 787 CGCCAGGGGAACGACCATGGCACTCAGTACCGCTCGGCCA-TCTA-CCCGACTTCCGCCA 844 Query 1088 TGCAGATGGAAGCAGCCCTGAGATCCAAGGAAGAATACCAAAAGGTTCTTTCAAAGCATA 1147 ||| ||||| || |||||||| ||||| || || |||||||||||||||||| |||| Sbjct 845 AGCAAATGGAGGCGGCCCTGAGCTCCAAAGAGGACTACCAAAAGGTTCTTTCAGAGCACG 904 Query 1148 ACTTTGGCCCCATCACCACCGACATCCGAGAGGGACA-AGTGTTCTACTATGCCGAAGAC 1206 ||||||||||||||| || || ||||| || ||||| | | |||||||| || |||||| Sbjct 905 GCTTTGGCCCCATCACTACGGAGATCCGGGAAGGACAGATT-TTCTACTACGCGGAAGAC 963 Query 1207 TACCACCAGCAATACCTGAGCAAGAACCC-AGACGGCTACTGTGGCCTCGGGGGTACTGG 1265 ||||||||||| ||||||||||||||||| | |||| ||||| ||||| ||||| || || Sbjct 964 TACCACCAGCAGTACCTGAGCAAGAACCCCA-ACGGATACTGCGGCCTTGGGGGCACCGG 1022 Query 1266 AGTTTCCTGCCCGATGGCCA-TTAAAAAATAATTTCTCTCCAC 1307 || |||||||| |||| | ||||||||||||||||| |||| Sbjct 1023 CGTGTCCTGCCCAATGGGTAATTAAAAAATAATTTCTCCCCAC 1065 >gb|BC102980.1| UniGene infoGene info Bos taurus methionine sulfoxide reductase A, mRNA (cDNA clone MGC:128238 IMAGE:7985018), complete cds Length=1377 Score = 595 bits (322), Expect = 2e-166 Identities = 599/731 (81%), Gaps = 26/731 (3%) Strand=Plus/Plus Query 589 CCGCCCATGCTCTCCGCCTCTAGAAGGGCTCTCCAGCTCCTCTC-TAGCGC-CAACCCGG 646 ||| |||||||||| ||| | || ||||| |||||||| || || ||| | | ||| Sbjct 56 CCGTCCATGCTCTCGGCCACCAGGAGGGCCCTCCAGCT-CTTTCACAGC-CTCTTCCCCA 113 Query 647 TACGGAGGATGGGCGACTCAGCTTCG-AAAG-TCATC-TCCGCAGAGGAAGCCTTGCCGG 703 | | ||| ||||| ||||| || || ||| || || || | ||||||||||||||| Sbjct 114 TCCCGAGAATGGGTGACTCCGC--CGCCAAGATCGTCAGCC-CCCAGGAAGCCTTGCCGG 170 Query 704 GACGCACCGAGCCGATCCCT-GTAACAGCCAAACACCATGTCAGTGGCAACAGAACGGTT 762 | || | ||||| | | | ||| | |||||||| ||||||| |||||||||||| ||| Sbjct 171 GCCGGAAGGAGCCCCT-CGTCGTAGCGGCCAAACATCATGTCAATGGCAACAGAACAGTT 229 Query 763 GAACCTTTCCCAGAGGGAACACAGATGGCTGTATTTGGAATGGGCTGCTTCTGGGGAGCT 822 ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct 230 GAACCTTTCCCAGAGGGAACACAGATGGCTGTATTTGGAATGGGCTGTTTCTGGGGAGCT 289 Query 823 GAGCGCAAGTTCTGGGTCTTGAAAGGAGTGTACTCAACCCAAGTGGGCTTTGCAGGAGGC 882 || | || |||||| | ||||||| || || ||||| ||||| || |||||||||||| Sbjct 290 GAAAGGAAATTCTGGACCCTGAAAGGTGTATATTCAACTCAAGTTGGTTTTGCAGGAGGC 349 Query 883 CACACACGCAATCCCACCTACAAAGAGGTCTGCTCAGAAAAAACTGGCCACGCCGAAGTC 942 | || | |||||| || || ||||| |||||||||| ||||||||||||||| ||||| Sbjct 350 TATACTCCCAATCCTACTTATAAAGAAGTCTGCTCAGGAAAAACTGGCCACGCAGAAGTA 409 Query 943 GTCCGGGTTGTGTACCGGCCAGAGCACATCAGCTTTGAGGAACTGCTCAAGGTCTTCTGG 1002 |||||||| |||| || |||||| |||||||||||||||||||||||||||||||||||| Sbjct 410 GTCCGGGTGGTGTTCCAGCCAGAACACATCAGCTTTGAGGAACTGCTCAAGGTCTTCTGG 469 Query 1003 GAGAATCACGACCCGACCCAAGGCATGCGCCAAGGCAATGACTTTGG-TACACAGTACCG 1061 |||||||| ||||||||||||||||||||||||||||||||| || | | |||||||| Sbjct 470 GAGAATCATGACCCGACCCAAGGCATGCGCCAAGGCAATGACCACGGCT-CTCAGTACCG 528 Query 1062 GTCAGC-AGTCTATCCC-ACATCCGCCGTGCA-GATGGAAGCAGCCCTGA-GATCCAAGG 1117 ||||| | |||| ||| || || |||| ||| | ||| |||||||||| | ||||||| Sbjct 529 CTCAGCCA-TCTA-CCCGACCTCTGCCGAGCACG-TGGGGGCAGCCCTGAAG-TCCAAGG 584 Query 1118 AAGAATACCAAAAGGTTCTTTCAAAGCATAACTTT-GGCCCCATCACCACCGACATCCGA 1176 | || ||||| |||||||| || ||||| ||| |||| |||||||| |||||||| Sbjct 585 AGGACTACCAGAAGGTTCTGTCGGAGCATGG-TTTCGGCCTGATCACCACGGACATCCGG 643 Query 1177 GAGGGACAAGTGTTCTACTATGCCGAAGACTACCACCAGCAATACCTGAGCAAGAACCCA 1236 ||||||||| || |||||||| ||||| ||||||||||| |||||||||||| |||| Sbjct 644 GAGGGACAAACCTTTTACTATGCGGAAGATTACCACCAGCAGTACCTGAGCAAGGACCCC 703 Query 1237 GACGGCTACTGTGGCCTCGGGGGTACTGGAGTTTCCTG-CCCGATGGCCATTAAAAAATA 1295 ||||| ||||| ||||||||||| || ||||| || || ||| ||| |||||||| || Sbjct 704 GACGGGTACTGCGGCCTCGGGGGCACCGGAGTGTCTTGTCCCC-TGGGTATTAAAAAGTA 762 Query 1296 ATTTCTCTCCA 1306 ||||||| ||| Sbjct 763 ATTTCTCCCCA 773 >gb|AC134898.4| Download subject sequence spanning the HSP Mus musculus BAC clone RP23-478H2 from chromosome 14, complete sequence Length=213348 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 590 bits (319), Expect = 8e-165 Identities = 319/319 (100%), Gaps = 0/319 (0%) Strand=Plus/Plus Query 412 AGTGAGTACATCGCACCCGGAACCCTGGCTGCGGAGGTGGAGAAACGGCAGCAACTCTGA 471 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 179277 AGTGAGTACATCGCACCCGGAACCCTGGCTGCGGAGGTGGAGAAACGGCAGCAACTCTGA 179336 Query 472 CCTCCCGCGGTGGCGCCCAGCCAGCATCAATTTTGGCCCGCGCGGCTTCACGTACTCTGG 531 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 179337 CCTCCCGCGGTGGCGCCCAGCCAGCATCAATTTTGGCCCGCGCGGCTTCACGTACTCTGG 179396 Query 532 GAACTTTGTCCCTCAGAGACAGCCAGGCCTGGAGGTCTGCCCCGCGAGACGGACACGCCG 591 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 179397 GAACTTTGTCCCTCAGAGACAGCCAGGCCTGGAGGTCTGCCCCGCGAGACGGACACGCCG 179456 Query 592 CCCATGCTCTCCGCCTCTAGAAGGGCTCTCCAGCTCCTCTCTAGCGCCAACCCGGTACGG 651 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 179457 CCCATGCTCTCCGCCTCTAGAAGGGCTCTCCAGCTCCTCTCTAGCGCCAACCCGGTACGG 179516 Query 652 AGGATGGGCGACTCAGCTTCGAAAGTCATCTCCGCAGAGGAAGCCTTGCCGGGACGCACC 711 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 179517 AGGATGGGCGACTCAGCTTCGAAAGTCATCTCCGCAGAGGAAGCCTTGCCGGGACGCACC 179576 Query 712 GAGCCGATCCCTGTAACAG 730 ||||||||||||||||||| Sbjct 179577 GAGCCGATCCCTGTAACAG 179595 Score = 255 bits (138), Expect = 3e-64 Identities = 141/142 (99%), Gaps = 1/142 (0%) Strand=Plus/Plus Query 22 GGCTGTGGAAGTCTATCTGCTGTTCTGAAATGGCCTCAGGCTTCAAGCCTTTCAGAGCCT 81 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 165411 GGCTGTGGAAGTCTATCTGCTGTTCTGAAATGGCCTCAGGCTTCAAGCCTTTCAGAGCCT 165470 Query 82 CCTTGGCCTTCCCAAGGCTGGAATGACTTCTCTCTCTGGGAGACAACACTCCATTCTGTA 141 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 165471 CCTTGGCCTTCCCAAGGCTGGAATGACTTCTCTCTCTGGGAGACAACACTCCATTCTGTA 165530 Query 142 GGGGTGACGTCTGTAGG-AAGA 162 ||||||||||||||||| |||| Sbjct 165531 GGGGTGACGTCTGTAGGTAAGA 165552 Score = 195 bits (105), Expect = 8e-46 Identities = 107/108 (99%), Gaps = 0/108 (0%) Strand=Plus/Plus Query 152 CTGTAGGAAGATCACCGTTTGAAGAAGTGCTGGTGGAAAGACAATTGTGGTCTAGAAAAT 211 ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 166736 CTGAAGGAAGATCACCGTTTGAAGAAGTGCTGGTGGAAAGACAATTGTGGTCTAGAAAAT 166795 Query 212 TCCTGCAGATAATTTATAGGTGACATAAGTAAGATTAAACTGAACACT 259 |||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 166796 TCCTGCAGATAATTTATAGGTGACATAAGTAAGATTAAACTGAACACT 166843 Score = 148 bits (80), Expect = 6e-32 Identities = 80/80 (100%), Gaps = 0/80 (0%) Strand=Plus/Plus Query 260 CTTCGAGGAAACTAACACGATGAAGATTAGCAAGGTCGGATGGCCTGTGGGGCTGCAAGA 319 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 167830 CTTCGAGGAAACTAACACGATGAAGATTAGCAAGGTCGGATGGCCTGTGGGGCTGCAAGA 167889 Query 320 AAACCAGACGCTGCTTGAAG 339 |||||||||||||||||||| Sbjct 167890 AAACCAGACGCTGCTTGAAG 167909 Score = 139 bits (75), Expect = 4e-29 Identities = 75/75 (100%), Gaps = 0/75 (0%) Strand=Plus/Plus Query 339 GGGAAGTGTCTGCTGACAGCGCATGCGCATGCCTGGAGCTCAGCTTCGAGATCTTCCTAT 398 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 169267 GGGAAGTGTCTGCTGACAGCGCATGCGCATGCCTGGAGCTCAGCTTCGAGATCTTCCTAT 169326 Query 399 CTGTGGAGTAAGAAG 413 ||||||||||||||| Sbjct 169327 CTGTGGAGTAAGAAG 169341 >ref|XM_845008.1| UniGene infoGene info PREDICTED: Canis familiaris similar to Peptide methionine sulfoxide reductase (Protein-methionine-S-oxide reductase) (PMSR) (Peptide Met(O) reductase) (LOC608103), mRNA Length=1301 Score = 588 bits (318), Expect = 3e-164 Identities = 495/581 (85%), Gaps = 10/581 (1%) Strand=Plus/Plus Query 731 CCAAACACCATGTCAGTGGCAACAGAACGGTTGAACCTTTCCCAGAGGGAACACAGATGG 790 ||||||| |||| || |||||| ||||| ||||||||||||||||||||||||||||||| Sbjct 173 CCAAACATCATGCCAATGGCAATAGAACAGTTGAACCTTTCCCAGAGGGAACACAGATGG 232 Query 791 CTGTATTTGGAATGGGCTGCTTCTGGGGAGCTGAGCGCAAGTTCTGGGTCTTGAAAGGAG 850 ||||||||||||||||||| ||||||||||||||||| || |||||| | |||||||| Sbjct 233 CTGTATTTGGAATGGGCTGTTTCTGGGGAGCTGAGCGGAAATTCTGGACCAAGAAAGGAG 292 Query 851 TGTACTCAACCCAAGTGGGCTT-TGCAGGAGGCCACACA-CGCAATCCCACCTACAAAGA 908 | || ||||| ||||| || || |||||||||| | || | |||||| || || || || Sbjct 293 TATATTCAACTCAAGTTGG-TTATGCAGGAGGCTATACTTC-CAATCCTACTTATAAGGA 350 Query 909 GGTCTGCTCAGAAAAAACTGGCCACGCCGAAGTCGTCCGGGTTGTGTACCGGCCAGAGCA 968 ||||| |||| ||| ||||||||||| ||||| ||||| || ||||||| |||||| || Sbjct 351 AGTCTGTTCAGGAAACACTGGCCACGCAGAAGTAGTCCGAGTGGTGTACCAGCCAGAACA 410 Query 969 CATCAGCTTTGAGGAACTGCTCAAGGTCTTCTGGGAGAATCACGACCCGACCCAAGGCAT 1028 |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct 411 CATCAGCTTTGAGGAACTGCTCAAGGTCTTCTGGGAGAATCATGACCCGACCCAAGGCAT 470 Query 1029 GCGCCAAGGCAATGACTTTGGTACACAGTACCGGTCAGC-AGTCTATCCCACATCCGCCG 1087 ||||||||||||||||| ||| || |||||||| ||||| | ||||||| || || ||| Sbjct 471 GCGCCAAGGCAATGACTATGGCACTCAGTACCGCTCAGCCA-TCTATCCAACCTCTACCG 529 Query 1088 TGCAGATGGAAG-CAGCCCTGAGATCCAAGGAAGAATACCAAAAGGTTCTTTCAAAGCAT 1146 ||| ||||| | | |||||||| ||||| ||||| ||||| |||||||||||| |||| Sbjct 530 AGCACATGGAGGTC-GCCCTGAGGTCCAAAGAAGACTACCAGAAGGTTCTTTCAGAGCAC 588 Query 1147 AACTTTGGCCCCATCACCACCGACATCCGAGAGGGACAAG-TGTTCTACTATGCCGAAGA 1205 || ||||| ||||| ||||||||||| |||||||||| | |||||||| || || || Sbjct 589 GGCTATGGCCTGATCACGACCGACATCCGGGAGGGACAAGCT-TTCTACTACGCAGAGGA 647 Query 1206 CTACCACCAGCAATACCTGAGCAAGAACCCAGACGGCTACTGTGGCCTCGGGGGTACTGG 1265 ||||||||||| ||||||||||||||||| ||||| |||||||||||||| || || || Sbjct 648 TTACCACCAGCAGTACCTGAGCAAGAACCCCGACGGATACTGTGGCCTCGGTGGCACCGG 707 Query 1266 AGTTTCCTGCCCGATGGCCATTAAAAAATAATTTCTCTCCA 1306 ||| ||||| ||| ||| |||||||| |||| |||| ||| Sbjct 708 AGTGTCCTGTCCGCTGGGTATTAAAAAGTAATGTCTCCCCA 748 >gb|BT021044.1| UniGene infoGene info Bos taurus methionine sulfoxide reductase A (MSRA), mRNA, complete cds Length=1350 Score = 584 bits (316), Expect = 4e-163 Identities = 597/731 (81%), Gaps = 26/731 (3%) Strand=Plus/Plus Query 589 CCGCCCATGCTCTCCGCCTCTAGAAGGGCTCTCCAGCTCCTCTC-TAGCGC-CAACCCGG 646 ||| |||||||||| ||| | || ||||| |||||||| || || ||| | | ||| Sbjct 44 CCGTCCATGCTCTCGGCCACCAGGAGGGCCCTCCAGCT-CTTTCACAGC-CTCTTCCCCA 101 Query 647 TACGGAGGATGGGCGACTCAGCTTCG-AAAG-TCATC-TCCGCAGAGGAAGCCTTGCCGG 703 | | ||| ||||| ||||| || || ||| || || || | ||||||||||||||| Sbjct 102 TCCCGAGAATGGGTGACTCCGC--CGCCAAGATCGTCAGCC-CCCAGGAAGCCTTGCCGG 158 Query 704 GACGCACCGAGCCGATCCCT-GTAACAGCCAAACACCATGTCAGTGGCAACAGAACGGTT 762 | || | ||||| | | | ||| | |||||||| ||||||| |||||||||||| ||| Sbjct 159 GCCGGAAGGAGCCCCT-CGTCGTAGCGGCCAAACATCATGTCAATGGCAACAGAACAGTT 217 Query 763 GAACCTTTCCCAGAGGGAACACAGATGGCTGTATTTGGAATGGGCTGCTTCTGGGGAGCT 822 ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct 218 GAACCTTTCCCAGAGGGAACACAGATGGCTGTATTTGGAATGGGCTGTTTCTGGGGAGCT 277 Query 823 GAGCGCAAGTTCTGGGTCTTGAAAGGAGTGTACTCAACCCAAGTGGGCTTTGCAGGAGGC 882 || | || |||||| | ||||||| || || ||||| ||||| || |||||||||||| Sbjct 278 GAAAGGAAATTCTGGACCCTGAAAGGTGTATATTCAACTCAAGTTGGTTTTGCAGGAGGC 337 Query 883 CACACACGCAATCCCACCTACAAAGAGGTCTGCTCAGAAAAAACTGGCCACGCCGAAGTC 942 | || | |||||| || || ||||| |||||||||| |||||||||||| || ||||| Sbjct 338 TATACTCCCAATCCTACTTATAAAGAAGTCTGCTCAGGAAAAACTGGCCATGCAGAAGTA 397 Query 943 GTCCGGGTTGTGTACCGGCCAGAGCACATCAGCTTTGAGGAACTGCTCAAGGTCTTCTGG 1002 |||||||| |||| || |||||| | |||||||||||||||||||||||||||||||||| Sbjct 398 GTCCGGGTGGTGTTCCAGCCAGAACGCATCAGCTTTGAGGAACTGCTCAAGGTCTTCTGG 457 Query 1003 GAGAATCACGACCCGACCCAAGGCATGCGCCAAGGCAATGACTTTGG-TACACAGTACCG 1061 |||||||| ||||||||||||||||||||||||||||||||| || | | |||||||| Sbjct 458 GAGAATCATGACCCGACCCAAGGCATGCGCCAAGGCAATGACCACGGCT-CTCAGTACCG 516 Query 1062 GTCAGC-AGTCTATCCC-ACATCCGCCGTGCA-GATGGAAGCAGCCCTGA-GATCCAAGG 1117 ||||| | |||| ||| || || |||| ||| | ||| |||||||||| | ||||||| Sbjct 517 CTCAGCCA-TCTA-CCCGACCTCTGCCGAGCACG-TGGGGGCAGCCCTGAAG-TCCAAGG 572 Query 1118 AAGAATACCAAAAGGTTCTTTCAAAGCATAACTTT-GGCCCCATCACCACCGACATCCGA 1176 | || ||||| |||||||| || ||||| ||| |||| |||||||| |||||||| Sbjct 573 AGGACTACCAGAAGGTTCTGTCGGAGCATGG-TTTCGGCCTGATCACCACGGACATCCGG 631 Query 1177 GAGGGACAAGTGTTCTACTATGCCGAAGACTACCACCAGCAATACCTGAGCAAGAACCCA 1236 ||||||||| || |||||||| ||||| ||||||||||| |||||||||||| |||| Sbjct 632 GAGGGACAAACCTTTTACTATGCGGAAGATTACCACCAGCAGTACCTGAGCAAGGACCCC 691 Query 1237 GACGGCTACTGTGGCCTCGGGGGTACTGGAGTTTCCTG-CCCGATGGCCATTAAAAAATA 1295 ||||| ||||| ||||||||||| || ||||| || || ||| ||| |||||||| || Sbjct 692 GACGGGTACTGCGGCCTCGGGGGCACCGGAGTGTCTTGTCCCC-TGGGTATTAAAAAGTA 750 Query 1296 ATTTCTCTCCA 1306 ||||||| ||| Sbjct 751 ATTTCTCCCCA 761 >ref|NM_174114.2| UniGene infoGene info Bos taurus methionine sulfoxide reductase A (MSRA), mRNA gb|U37150.1|BTU37150 UniGene infoGene info Bos taurus peptide methionine sulfoxide reductase (msrA) mRNA, complete cds Length=1370 Score = 584 bits (316), Expect = 4e-163 Identities = 597/731 (81%), Gaps = 26/731 (3%) Strand=Plus/Plus Query 589 CCGCCCATGCTCTCCGCCTCTAGAAGGGCTCTCCAGCTCCTCTC-TAGCGC-CAACCCGG 646 ||| |||||||||| | | | || ||||| |||||||| || || ||| | | ||| Sbjct 59 CCGTCCATGCTCTCGGTCACCAGGAGGGCCCTCCAGCT-CTTTCACAGC-CTCTTCCCCA 116 Query 647 TACGGAGGATGGGCGACTCAGCTTCG-AAAG-TCATC--TCCGCAGAGGAAGCCTTGCCG 702 | | ||| ||||| ||||| || || ||| || || ||| | |||||||||||||| Sbjct 117 TCCCGAGAATGGGTGACTCCGC--CGCCAAGATCGTCAGTCC-C-CAGGAAGCCTTGCCG 172 Query 703 GGACGCACCGAGCCGATCCCT-GTAACAGCCAAACACCATGTCAGTGGCAACAGAACGGT 761 || || | ||||| | | | ||| | |||||||| ||||||| |||||||||||| || Sbjct 173 GGCCGGAAGGAGCCCCT-CGTCGTAGCGGCCAAACATCATGTCAATGGCAACAGAACAGT 231 Query 762 TGAACCTTTCCCAGAGGGAACACAGATGGCTGTATTTGGAATGGGCTGCTTCTGGGGAGC 821 |||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| Sbjct 232 TGAACCTTTCCCAGAGGGGACACAGATGGCTGTATTTGGAATGGGCTGTTTCTGGGGAGC 291 Query 822 TGAGCGCAAGTTCTGGGTCTTGAAAGGAGTGTACTCAACCCAAGTGGGCTTTGCAGGAGG 881 ||| | || |||||| | ||||||| || || ||||| ||||| || ||||||||||| Sbjct 292 TGAAAGGAAATTCTGGACCCTGAAAGGTGTATATTCAACTCAAGTTGGTTTTGCAGGAGG 351 Query 882 CCACACACGCAATCCCACCTACAAAGAGGTCTGCTCAGAAAAAACTGGCCACGCCGAAGT 941 | | || | |||||| || || ||||| |||||||||| ||||||||||||||| ||||| Sbjct 352 CTATACTCCCAATCCTACTTATAAAGAAGTCTGCTCAGGAAAAACTGGCCACGCAGAAGT 411 Query 942 CGTCCGGGTTGTGTACCGGCCAGAGCACATCAGCTTTGAGGAACTGCTCAAGGTCTTCTG 1001 |||||||| |||| || |||||| ||||||||||||||||||||||||||||||||||| Sbjct 412 AGTCCGGGTGGTGTTCCAGCCAGAACACATCAGCTTTGAGGAACTGCTCAAGGTCTTCTG 471 Query 1002 GGAGAATCACGACCCGACCCAAGGCATGCGCCAAGGCAATGACTTTGG-TACACAGTACC 1060 ||||||||| ||||||||||||||||||||||||||||||||| || | | ||||||| Sbjct 472 GGAGAATCATGACCCGACCCAAGGCATGCGCCAAGGCAATGACCACGGCT-CTCAGTACC 530 Query 1061 GGTCAGC-AGTCTATCCC-ACATCCGCCGTGCA-GATGGAAGCAGCCCTGA-GATCCAAG 1116 | ||||| | |||| ||| || || |||| ||| | ||| |||||||||| | |||||| Sbjct 531 GCTCAGCCA-TCTA-CCCGACCTCTGCCGAGCACG-TGGGGGCAGCCCTGAAG-TCCAAG 586 Query 1117 GAAGAATACCAAAAGGTTCTTTCAAAGCATAACTTTGGCCCCATCACCACCGACATCCGA 1176 || || ||||| |||||||| || ||||| ||||| | |||||||| |||||||| Sbjct 587 GAGGACTACCAGAAGGTTCTGTCGGAGCATGGTTTTGGGCTGATCACCACGGACATCCGG 646 Query 1177 GAGGGACAAGTGTTCTACTATGCCGAAGACTACCACCAGCAATACCTGAGCAAGAACCCA 1236 ||||||||| || |||||||| ||||| ||||||||||| |||||||||||| |||| Sbjct 647 GAGGGACAAACCTTTTACTATGCGGAAGATTACCACCAGCAGTACCTGAGCAAGGACCCC 706 Query 1237 GACGGCTACTGTGGCCTCGGGGGTACTGGAGTTTCCTG-CCCGATGGCCATTAAAAAATA 1295 ||||| ||||| ||||||||||| || ||||| || || ||| ||| |||||||| || Sbjct 707 GACGGGTACTGCGGCCTCGGGGGCACCGGAGTGTCTTGTCCCC-TGGGTATTAAAAAGTA 765 Query 1296 ATTTCTCTCCA 1306 ||||||| ||| Sbjct 766 ATTTCTCCCCA 776 >dbj|AK233412.1| UniGene info Sus scrofa mRNA, clone:LVRM10142H04, expressed in liver Length=1626 Score = 556 bits (301), Expect = 8e-155 Identities = 489/581 (84%), Gaps = 8/581 (1%) Strand=Plus/Plus Query 731 CCAAACACCATGTCAGTGGCAACAGAACGGTTGAACCTTTCCCAGAGGGAACACAGATGG 790 |||| || || |||| |||||||||||| ||||||||||||||||||||||||||||||| Sbjct 441 CCAAGCATCACGTCAATGGCAACAGAACAGTTGAACCTTTCCCAGAGGGAACACAGATGG 500 Query 791 CTGTATTTGGAATGGGCTGCTTCTGGGGAGCTGAGCGCAAGTTCTGGGTCTTGAAAGGAG 850 || ||||||| |||||||| |||||||||||||| | || |||||| | ||||||||| Sbjct 501 CTCTATTTGGCATGGGCTGTTTCTGGGGAGCTGAAAGGAAATTCTGGACCCTGAAAGGAG 560 Query 851 TGTACTCAACCCAAGTGGGCTTTGCAGGAGGCCACACACGCAATCCCACCTACAAAGAGG 910 | || ||||| ||||| || |||||||| ||| |||| | |||||| ||||| ||||| | Sbjct 561 TATATTCAACTCAAGTTGGTTTTGCAGGGGGCTACACTCCCAATCCTACCTATAAAGAAG 620 Query 911 TCTGCTCAGAAAAAACTGGCCACGCCGAAGTCGTCCGGGTTGTGTACCGGCCAGAGCACA 970 ||||||||| || ||||||||| || ||||| ||||| || ||||||| |||||| |||| Sbjct 621 TCTGCTCAGGAAGAACTGGCCATGCAGAAGTAGTCCGAGTGGTGTACCAGCCAGAACACA 680 Query 971 TCAGCTTTGAGGAACTGCTCAAGGTCTTCTGGGAGAATCACGACCCGACCCAAGGCATGC 1030 |||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| Sbjct 681 TCAGCTTTGAGGAACTGCTCAAGGTCTTCTGGGAGAATCATGACCCGACCCAAGGCTTGC 740 Query 1031 GCCAAGGCAATGACTTTGGTACACAGTACCGGTCAGC-AGTCTATCCCA-CATCCGCCGT 1088 |||||||| | ||| ||| | |||||||| || || | |||| |||| | ||||| | Sbjct 741 GCCAAGGCCAGGACCACGGTTCTCAGTACCGCTCTGCCA-TCTA-CCCAACCTCCGCGGA 798 Query 1089 GCAGATGGAAGCAGCCCTGAGATCCAAGGAAGAATACCAAAAGGTTCTTTCAAAGCATAA 1148 ||| ||||| ||||||||||| ||||| || || ||||| |||||||| || |||| Sbjct 799 GCACATGGAGGCAGCCCTGAGGTCCAAAGAGGACTACCAGAAGGTTCTGTCTGAGCACGG 858 Query 1149 CTTTGGCCCCATCACCACCGACATCCGAGAGGGACAAGTGTT-CTACTATGCCGAAGACT 1207 ||| |||| |||||||||||||||||| |||||||| | || |||||| || || || | Sbjct 859 CTTCGGCCTCATCACCACCGACATCCGGGAGGGACA-GCCTTTCTACTACGCGGAGGATT 917 Query 1208 ACCACCAGCAATACCTGAGCAAGAACCCAGACGGCTACTGTGGCCTCGGGGGTACTGGAG 1267 |||||||||| |||||||||||||||||||| || ||||| ||||||||||| ||||| | Sbjct 918 ACCACCAGCAGTACCTGAGCAAGAACCCAGATGGGTACTGCGGCCTCGGGGGCACTGGCG 977 Query 1268 TTTCCTGCCCGA-TGGCCATTAAAAAATAATTTCTCTCCAC 1307 | ||||||| | ||| |||| ||||||||||||| |||| Sbjct 978 TGGCCTGCCC-ACTGGGAATTAGAAAATAATTTCTCCCCAC 1017 >dbj|AK233136.1| UniGene info Sus scrofa mRNA, clone:LVRM10087F01, expressed in liver Length=1523 Score = 556 bits (301), Expect = 8e-155 Identities = 520/626 (83%), Gaps = 14/626 (2%) Strand=Plus/Plus Query 689 AGGAAGCCTTGCCGGGACGCACCGAGCCGATCCCT-GTAACA-GCCAAACACCATGTCAG 746 |||| |||||||| || || | |||||||| | || | | ||||| || || |||| Sbjct 296 AGGAGGCCTTGCCAGGCCGGAAGGAGCCGAT-GGTCGT-AGAGGCCAAGCATCACGTCAA 353 Query 747 TGGCAACAGAACGGTTGAACCTTTCCCAGAGGGAACACAGATGGCTGTATTTGGAATGGG 806 |||||||||||| ||||||||||||||||||||||||||||||||| ||||||| ||||| Sbjct 354 TGGCAACAGAACAGTTGAACCTTTCCCAGAGGGAACACAGATGGCTCTATTTGGCATGGG 413 Query 807 CTGCTTCTGGGGAGCTGAGCGCAAGTTCTGGGTCTTGAAAGGAGTGTACTCAACCCAAG- 865 ||| |||||||||||||| | || |||||| | |||||||||| || ||||| |||| Sbjct 414 CTGTTTCTGGGGAGCTGAAAGGAAATTCTGGACCCTGAAAGGAGTATATTCAACTCAAGC 473 Query 866 TGGGCTTTGCAGGAGGCCACACACGCAATCCCACCTACAAAGAGGTCTGCTCAGAAAAAA 925 ||| |||||||| ||| |||| | |||||| ||||| ||||| |||||||||| || || Sbjct 474 TGGT-TTTGCAGGGGGCTACACTCCCAATCCTACCTATAAAGAAGTCTGCTCAGGAAGAA 532 Query 926 CTGGCCACGCCGAAGTCGTCCGGGTTGTGTACCGGCCAGAGCACATCAGCTTTGAGGAAC 985 ||||||| || ||||| ||||| || ||||||| |||||| ||||||||||||||||||| Sbjct 533 CTGGCCATGCAGAAGTAGTCCGAGTGGTGTACCAGCCAGAACACATCAGCTTTGAGGAAC 592 Query 986 TGCTCAAGGTCTTCTGGGAGAATCACGACCCGACCCAAGGCATGCGCCAAGGCAATGACT 1045 ||||||||||||||||||||||||| ||||||||||||||| ||||||||||| | ||| Sbjct 593 TGCTCAAGGTCTTCTGGGAGAATCATGACCCGACCCAAGGCTTGCGCCAAGGCCAGGACC 652 Query 1046 TTGGTACACAGTACCGGTCAGC-AGTCTATCCCA-CATCCGCCGTGCAGATGGAAGCAGC 1103 ||| | |||||||| || || | |||| |||| | ||||| | ||| ||||| ||||| Sbjct 653 ACGGTTCTCAGTACCGCTCTGCCA-TCTA-CCCAACCTCCGCGGAGCACATGGAGGCAGC 710 Query 1104 CCTGAGATCCAAGGAAGAATACCAAAAGGTTCTTTCAAAGCATAACTTTGGCCCCATCAC 1163 |||||| ||||| || || ||||| |||||||| || |||| ||| |||| |||||| Sbjct 711 CCTGAGGTCCAAAGAGGACTACCAGAAGGTTCTGTCTGAGCACGGCTTCGGCCTCATCAC 770 Query 1164 CACCGACATCCGAGAGGGACAAGTGTT-CTACTATGCCGAAGACTACCACCAGCAATACC 1222 |||||||||||| |||||||| | || |||||| || || || ||||||||||| |||| Sbjct 771 CACCGACATCCGGGAGGGACA-GCCTTTCTACTACGCGGAGGATTACCACCAGCAGTACC 829 Query 1223 TGAGCAAGAACCCAGACGGCTACTGTGGCCTCGGGGGTACTGGAGTTTCCTGCCCGA-TG 1281 |||||||||||||||| || ||||| ||||||||||| ||||| || ||||||| | || Sbjct 830 TGAGCAAGAACCCAGATGGGTACTGCGGCCTCGGGGGCACTGGCGTGGCCTGCCC-ACTG 888 Query 1282 GCCATTAAAAAATAATTTCTCTCCAC 1307 | |||| ||||||||||||| |||| Sbjct 889 GGAATTAGAAAATAATTTCTCCCCAC 914 >ref|XM_001137694.1| Gene info PREDICTED: Pan troglodytes similar to cytosolic methionine-S-sulfoxide reductase, transcript variant 1 (LOC739556), mRNA Length=677 Score = 468 bits (253), Expect = 4e-128 Identities = 411/487 (84%), Gaps = 12/487 (2%) Strand=Plus/Plus Query 651 GAGGATGGGCGACTCAGCTTCGAA-AGTCATC-TCCGCAGAGGAAGCCTTGCCGGGACGC 708 |||||||||| |||| || ||||| | || || || | |||| ||||||||||| || Sbjct 82 GAGGATGGGCAACTCGGCCTCGAACA-TCGTCAGCC-CCCAGGAGGCCTTGCCGGGCCGG 139 Query 709 ACCGAGCCGATCCCTGTAACAGCCAAACACCATGTCAGTGGCAACAGAACGGTTGAACCT 768 | || | || ||||||| | |||||||| ||||||| |||||||||||| || |||||| Sbjct 140 AAGGAACAGACCCCTGTAGCGGCCAAACATCATGTCAATGGCAACAGAACAGTCGAACCT 199 Query 769 TTCCCAGAGGGAACACAGATGGCTGTATTTGGAATGGGCTGCTTCTGGGGAGCTGAGCGC 828 |||||||||||||||||||||||||||||||||||||| || |||||||||||||| | Sbjct 200 TTCCCAGAGGGAACACAGATGGCTGTATTTGGAATGGGATGTTTCTGGGGAGCTGAAAGG 259 Query 829 AAGTTCTGGGTCTTGAAAGGAGTGTACTCAACCCAAGTGGGCTTTGCAGGAGGCCACACA 888 || ||||||||||||||||||||||| ||||| ||||| || |||||||||||| | || Sbjct 260 AAATTCTGGGTCTTGAAAGGAGTGTATTCAACTCAAGTTGGTTTTGCAGGAGGCTATACT 319 Query 889 CGCAA-TCCCACCTACAAAGAGGTCTGCTCAGAAAAAACTGGCCACGCCGAAGTCGTCCG 947 ||| ||| || || ||||| ||||||||||||||||||||||| || ||||||||||| Sbjct 320 T-CAAATCCTACTTATAAAGAAGTCTGCTCAGAAAAAACTGGCCATGCAGAAGTCGTCCG 378 Query 948 GGTTGTGTACCGGCCAGAGCACATCAGCTTTGAGGAACTGCTCAAGGTCTTCTGGGAGAA 1007 || ||||||| |||||| |||||||| |||||||||||||||||||||||||||||||| Sbjct 379 AGTGGTGTACCAGCCAGAACACATCAGTTTTGAGGAACTGCTCAAGGTCTTCTGGGAGAA 438 Query 1008 TCACGACCCGACCCAAGGCATGCGCCAAGGCAATGACTTTGGTACACAGTACCGGTCAGC 1067 |||||||||||||||||| |||||||| || || ||| ||| || |||||||| || || Sbjct 439 TCACGACCCGACCCAAGGTATGCGCCAGGGGAACGACCATGGCACTCAGTACCGCTCGGC 498 Query 1068 -AGTCTATCCC-ACATCCGCCGTGCAGATGGAAGCAGCCCTGAGATCCAAGGAAGAA-TA 1124 | |||| ||| || || ||| ||| ||||| ||||||||||| ||||| || ||| || Sbjct 499 CA-TCTA-CCCGACCTCTGCCAAGCAAATGGAGGCAGCCCTGAGCTCCAAAGA-GAACTA 555 Query 1125 CCAAAAG 1131 ||||||| Sbjct 556 CCAAAAG 562 >ref|XM_001137955.1| Gene info PREDICTED: Pan troglodytes similar to cytosolic methionine-S-sulfoxide reductase, transcript variant 3 (LOC739556), mRNA Length=1333 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 403 bits (218), Expect = 1e-108 Identities = 338/395 (85%), Gaps = 12/395 (3%) Strand=Plus/Plus Query 919 GAAAAAACTGGCCACGCCGAAGTCGTCCGGGTTGTGTACCGGCCAGAGCACATCAGCTTT 978 |||||||||||||| || ||||||||||| || ||||||| |||||| |||||||| ||| Sbjct 377 GAAAAAACTGGCCATGCAGAAGTCGTCCGAGTGGTGTACCAGCCAGAACACATCAGTTTT 436 Query 979 GAGGAACTGCTCAAGGTCTTCTGGGAGAATCACGACCCGACCCAAGGCATGCGCCAAGGC 1038 ||||||||||||||||||||||||||||||||||||||||||||||| |||||||| || Sbjct 437 GAGGAACTGCTCAAGGTCTTCTGGGAGAATCACGACCCGACCCAAGGTATGCGCCAGGGG 496 Query 1039 AATGACTTTGGTACACAGTACCGGTCAGC-AGTCTATCCC-ACATCCGCCGTGCAGATGG 1096 || ||| ||| || |||||||| || || | |||| ||| || || ||| ||| |||| Sbjct 497 AACGACCATGGCACTCAGTACCGCTCGGCCA-TCTA-CCCGACCTCTGCCAAGCAAATGG 554 Query 1097 AAGCAGCCCTGAGATCCAAGGAAGAA-TACCAAAAGGTTCTTTCAAAGCATAACTTTGGC 1155 | ||||||||||| ||||| || ||| |||||||||||||||||| |||| ||| ||| Sbjct 555 AGGCAGCCCTGAGCTCCAAAGA-GAACTACCAAAAGGTTCTTTCAGAGCACGGCTTCGGC 613 Query 1156 CCCATCACCACCGACATCCGAGAGGGACA-AGTGTTCTACTATGCCGAAGACTACCACCA 1214 |||||||| ||||||||||| |||||||| | | ||||||||||| |||||||||||||| Sbjct 614 CCCATCACTACCGACATCCGGGAGGGACAGACT-TTCTACTATGCGGAAGACTACCACCA 672 Query 1215 GCAATACCTGAGCAAGAACCC-AGACGGCTACTGTGGCCTCGGGGGTACTGGAGTTTCCT 1273 ||| ||||||||||||||||| | | |||||||| ||||| ||||| || || || |||| Sbjct 673 GCAGTACCTGAGCAAGAACCCCA-ATGGCTACTGCGGCCTTGGGGGCACCGGCGTGTCCT 731 Query 1274 GCCC-GATGGCCATTAAAAAATAATTTCTCTCCAC 1307 |||| | ||| |||||||||||||||||| |||| Sbjct 732 GCCCAG-TGGGTATTAAAAAATAATTTCTCCCCAC 765 Score = 137 bits (74), Expect = 1e-28 Identities = 126/151 (83%), Gaps = 4/151 (2%) Strand=Plus/Plus Query 651 GAGGATGGGCGACTCAGCTTCGAA-AGTCATC-TCCGCAGAGGAAGCCTTGCCGGGACGC 708 |||||||||| |||| || ||||| | || || || | |||| ||||||||||| || Sbjct 229 GAGGATGGGCAACTCGGCCTCGAACA-TCGTCAGCC-CCCAGGAGGCCTTGCCGGGCCGG 286 Query 709 ACCGAGCCGATCCCTGTAACAGCCAAACACCATGTCAGTGGCAACAGAACGGTTGAACCT 768 | || | || ||||||| | |||||||| ||||||| |||||||||||| || |||||| Sbjct 287 AAGGAACAGACCCCTGTAGCGGCCAAACATCATGTCAATGGCAACAGAACAGTCGAACCT 346 Query 769 TTCCCAGAGGGAACACAGATGGCTGTATTTG 799 ||||||||||||||||||||||||||||||| Sbjct 347 TTCCCAGAGGGAACACAGATGGCTGTATTTG 377 >ref|XM_001137861.1| Gene info PREDICTED: Pan troglodytes similar to cytosolic methionine-S-sulfoxide reductase, transcript variant 2 (LOC739556), mRNA Length=1116 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 403 bits (218), Expect = 1e-108 Identities = 338/395 (85%), Gaps = 12/395 (3%) Strand=Plus/Plus Query 919 GAAAAAACTGGCCACGCCGAAGTCGTCCGGGTTGTGTACCGGCCAGAGCACATCAGCTTT 978 |||||||||||||| || ||||||||||| || ||||||| |||||| |||||||| ||| Sbjct 160 GAAAAAACTGGCCATGCAGAAGTCGTCCGAGTGGTGTACCAGCCAGAACACATCAGTTTT 219 Query 979 GAGGAACTGCTCAAGGTCTTCTGGGAGAATCACGACCCGACCCAAGGCATGCGCCAAGGC 1038 ||||||||||||||||||||||||||||||||||||||||||||||| |||||||| || Sbjct 220 GAGGAACTGCTCAAGGTCTTCTGGGAGAATCACGACCCGACCCAAGGTATGCGCCAGGGG 279 Query 1039 AATGACTTTGGTACACAGTACCGGTCAGC-AGTCTATCCC-ACATCCGCCGTGCAGATGG 1096 || ||| ||| || |||||||| || || | |||| ||| || || ||| ||| |||| Sbjct 280 AACGACCATGGCACTCAGTACCGCTCGGCCA-TCTA-CCCGACCTCTGCCAAGCAAATGG 337 Query 1097 AAGCAGCCCTGAGATCCAAGGAAGAA-TACCAAAAGGTTCTTTCAAAGCATAACTTTGGC 1155 | ||||||||||| ||||| || ||| |||||||||||||||||| |||| ||| ||| Sbjct 338 AGGCAGCCCTGAGCTCCAAAGA-GAACTACCAAAAGGTTCTTTCAGAGCACGGCTTCGGC 396 Query 1156 CCCATCACCACCGACATCCGAGAGGGACA-AGTGTTCTACTATGCCGAAGACTACCACCA 1214 |||||||| ||||||||||| |||||||| | | ||||||||||| |||||||||||||| Sbjct 397 CCCATCACTACCGACATCCGGGAGGGACAGACT-TTCTACTATGCGGAAGACTACCACCA 455 Query 1215 GCAATACCTGAGCAAGAACCC-AGACGGCTACTGTGGCCTCGGGGGTACTGGAGTTTCCT 1273 ||| ||||||||||||||||| | | |||||||| ||||| ||||| || || || |||| Sbjct 456 GCAGTACCTGAGCAAGAACCCCA-ATGGCTACTGCGGCCTTGGGGGCACCGGCGTGTCCT 514 Query 1274 GCCC-GATGGCCATTAAAAAATAATTTCTCTCCAC 1307 |||| | ||| |||||||||||||||||| |||| Sbjct 515 GCCCAG-TGGGTATTAAAAAATAATTTCTCCCCAC 548 Score = 137 bits (74), Expect = 1e-28 Identities = 126/151 (83%), Gaps = 4/151 (2%) Strand=Plus/Plus Query 651 GAGGATGGGCGACTCAGCTTCGAA-AGTCATC-TCCGCAGAGGAAGCCTTGCCGGGACGC 708 |||||||||| |||| || ||||| | || || || | |||| ||||||||||| || Sbjct 12 GAGGATGGGCAACTCGGCCTCGAACA-TCGTCAGCC-CCCAGGAGGCCTTGCCGGGCCGG 69 Query 709 ACCGAGCCGATCCCTGTAACAGCCAAACACCATGTCAGTGGCAACAGAACGGTTGAACCT 768 | || | || ||||||| | |||||||| ||||||| |||||||||||| || |||||| Sbjct 70 AAGGAACAGACCCCTGTAGCGGCCAAACATCATGTCAATGGCAACAGAACAGTCGAACCT 129 Query 769 TTCCCAGAGGGAACACAGATGGCTGTATTTG 799 ||||||||||||||||||||||||||||||| Sbjct 130 TTCCCAGAGGGAACACAGATGGCTGTATTTG 160 >gb|EF191679.1| UniGene info Taeniopygia guttata clone 0069P0006G11 methionine sulfoxide reductase A variant 2-like mRNA, complete sequence Length=1387 Score = 401 bits (217), Expect = 4e-108 Identities = 451/562 (80%), Gaps = 24/562 (4%) Strand=Plus/Plus Query 733 AAACACCATGTCAGTGGCAACAGAACGGTTGAACCTTTCCCAGAGGGAACACAGATGGCT 792 ||||| ||||||| ||| ||||||| |||||||||||||||||||||||||||||||||| Sbjct 176 AAACATCATGTCAATGGGAACAGAATGGTTGAACCTTTCCCAGAGGGAACACAGATGGCT 235 Query 793 GTATTTGGAATGGGCTGCTTCTGGGGAGCTGAGCGCAAGTTCTGG-GTCTTGAAAGGAGT 851 | ||||| |||||||| ||||||||||| ||| | ||||||||| | | ||||||||| Sbjct 236 CTGTTTGGTATGGGCTGTTTCTGGGGAGCCGAGAGGAAGTTCTGGAGGCA-GAAAGGAGT 294 Query 852 GTACTCAACCCAAGTGGGCTT-TGCAGGAGGCCACACACGCAATCCC-ACCTACAAAGAG 909 || || || |||||||| || ||||||||| || || | ||| ||| |||||||||||| Sbjct 295 CTATTCCACTCAAGTGGG-TTATGCAGGAGGACATACCC-CAAACCCTACCTACAAAGAG 352 Query 910 GTCTGCTCAGAAAAAACTGGCCACGCCGAAGTCGTCCGGGTTGTGTACCG-GCCAGAGCA 968 |||||||||| | |||||| ||| | || | ||||||||| |||| | | |||| | | Sbjct 353 GTCTGCTCAGGCAGAACTGGGCACACTGAGGCCGTCCGGGTGGTGTTC-GAGCCACAAAA 411 Query 969 CATCAGCTTTGAGGAACTGCTCAAGGTCTTCTGGGAGAATCACGACCCGACCCAAGGCAT 1028 ||||||||||||| |||||||||||||||||||||||||||| |||||||| ||||| || Sbjct 412 CATCAGCTTTGAGCAACTGCTCAAGGTCTTCTGGGAGAATCATGACCCGACACAAGGGAT 471 Query 1029 GCGCCAAGGCAATGACTTTGGTACACAGTACCGGTCAGC-AGTCTATC-CCACATCCGCC 1086 ||| || || || ||| | || || ||||| || || || | |||| | || ||| | Sbjct 472 GCGGCAGGGGAACGACGTCGGCACTCAGTATCGCTCGGCCA-TCTA-CACCTTTTCC-CA 528 Query 1087 GTG--CAGATGGAAGCAGCCCTGAGATCCAAGGAAGAATACCAAAAGGTTCTTT-CAAAG 1143 | | |||||||| || ||||||||||||||||||||||| || ||||| || | || Sbjct 529 G-GAACAGATGGAGGCTGCCCTGAGATCCAAGGAAGAATATCAGAAGGTG-TTGACGGAG 586 Query 1144 CATAA-CTTTGGCCCCATCACCACCGACATCCGAGAGGGACAAGTGTTCTACTATGCCGA 1202 | | |||||||||||||||||| || ||||| |||| | | || || || ||||| Sbjct 587 GA-AGGCTTTGGCCCCATCACCACGGAGATCCGGGAGGCTCCTGAATTTTATTACGCCGA 645 Query 1203 AGACTACCACCAGCAATACCTGAGCAAGAACCCAGA-CGGCTACTGTGGCCTCGG-GGGT 1260 || || |||||||| ||||| ||||||||||| | ||| ||||| ||||| || ||| Sbjct 646 GGAATATCACCAGCAGTACCTCAGCAAGAACCCCGGGCGG-TACTGCGGCCTGGGAGGG- 703 Query 1261 ACTGGAGTTTCCTGCCCGATGG 1282 || || ||||||||||| |||| Sbjct 704 ACGGGGGTTTCCTGCCCCATGG 725 >ref|XM_001089547.1| UniGene infoGene info PREDICTED: Macaca mulatta similar to Peptide methionine sulfoxide reductase (Protein-methionine-S-oxide reductase) (PMSR) (Peptide Met(O) reductase), transcript variant 1 (MSRA), mRNA Length=1116 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 387 bits (209), Expect = 1e-103 Identities = 334/394 (84%), Gaps = 9/394 (2%) Strand=Plus/Plus Query 919 GAAAAAACTGGCCACGCCGAAGTCGTCCGGGTTGTGTACCGGCCAGAGCACATCAGCTTT 978 |||||||||||||| || ||||||||||| || ||||||| |||||| |||||||| ||| Sbjct 160 GAAAAAACTGGCCATGCAGAAGTCGTCCGAGTGGTGTACCAGCCAGAACACATCAGTTTT 219 Query 979 GAGGAACTGCTCAAGGTCTTCTGGGAGAATCACGACCCGACCCAAGGCATGCGCCAAGGC 1038 ||||||||||||||||||||||||||||||||||||||||||||||| |||||||| || Sbjct 220 GAGGAACTGCTCAAGGTCTTCTGGGAGAATCACGACCCGACCCAAGGTATGCGCCAGGGG 279 Query 1039 AATGACTTTGGTACACAGTACCGGTCAGC-AGTCTATCCC-ACATCCGCCGTGCAGATGG 1096 || ||| ||| || |||||||| || || | |||| ||| || |||||| ||| |||| Sbjct 280 AACGACCATGGCACTCAGTACCGCTCGGCCA-TCTA-CCCGACTTCCGCCAAGCAAATGG 337 Query 1097 AAGCAGCCCTGAGATCCAAGGAAGAATACCAAAAGGTTCTTTCAAAGCATAACTTTGGCC 1156 | || |||||||| ||||| || || |||||||||||||||||| |||| |||||||| Sbjct 338 AGGCGGCCCTGAGCTCCAAAGAGGACTACCAAAAGGTTCTTTCAGAGCACGGCTTTGGCC 397 Query 1157 CCATCACCACCGACATCCGAGAGGGACA-AGTGTTCTACTATGCCGAAGACTACCACCAG 1215 ||||||| || || ||||| || ||||| | | |||||||| || ||||||||||||||| Sbjct 398 CCATCACTACGGAGATCCGGGAAGGACAGATT-TTCTACTACGCGGAAGACTACCACCAG 456 Query 1216 CAATACCTGAGCAAGAACCC-AGACGGCTACTGTGGCCTCGGGGGTACTGGAGTTTCCTG 1274 || ||||||||||||||||| | |||| ||||| ||||| ||||| || || || ||||| Sbjct 457 CAGTACCTGAGCAAGAACCCCA-ACGGATACTGCGGCCTTGGGGGCACCGGCGTGTCCTG 515 Query 1275 CCCGATGGCCA-TTAAAAAATAATTTCTCTCCAC 1307 ||| |||| | ||||||||||||||||| |||| Sbjct 516 CCCAATGGGTAATTAAAAAATAATTTCTCCCCAC 549 Score = 132 bits (71), Expect = 6e-27 Identities = 126/152 (82%), Gaps = 6/152 (3%) Strand=Plus/Plus Query 651 GAGGATGGGCGACTCAGCTTCGAAAGTCATC-TC--CGCAGAGGAAGCCTTGCCGGGACG 707 |||||||||| |||| || ||| || |||| || | | |||| ||||||||||| || Sbjct 12 GAGGATGGGCAACTCGGCCTCG--AG-CATCGTCAGCCCCCAGGAGGCCTTGCCGGGCCG 68 Query 708 CACCGAGCCGATCCCTGTAACAGCCAAACACCATGTCAGTGGCAACAGAACGGTTGAACC 767 | || | || ||||||| | |||||||| ||||||| |||||||||||| || ||||| Sbjct 69 GAAGGAACAGACCCCTGTAGCGGCCAAACATCATGTCAATGGCAACAGAACAGTCGAACC 128 Query 768 TTTCCCAGAGGGAACACAGATGGCTGTATTTG 799 |||||||||||||||||||||||||||||||| Sbjct 129 TTTCCCAGAGGGAACACAGATGGCTGTATTTG 160 >ref|XM_001381994.1| Gene info PREDICTED: Monodelphis domestica similar to peptide methionine sulfoxide reductase (LOC100033156), mRNA Length=696 Score = 340 bits (184), Expect = 9e-90 Identities = 451/578 (78%), Gaps = 26/578 (4%) Strand=Plus/Plus Query 732 CAAACACCATGTCAGTGGCAAC-AGAACGGTTGAACCTTTCCCAGAGGGAACACAGATGG 790 |||||| ||||||| ||| ||| || || || |||||||||||||||||||||||||||| Sbjct 132 CAAACATCATGTCAATGG-AACTAGGACTGTCGAACCTTTCCCAGAGGGAACACAGATGG 190 Query 791 CTGTATTTGGAATGGGCTGCTTCTGGGGAGCTGAGCGCAAGTTCTGGGTCTTGAAAGGAG 850 || |||||| |||||| || ||||||||||| ||||| || || ||| |||| | |||| Sbjct 191 CTCTATTTGCAATGGGATGTTTCTGGGGAGCAGAGCGGAAATTTTGGAACTTGGAGGGAG 250 Query 851 TGTACTCAACCCAAGTGGGCTTTGCAGGAGGCCACACACGCAATCCCACCT-ACAAAGAG 909 |||| ||||| ||||| |||| ||| |||||| || ||| |||| || | |||||| Sbjct 251 TGTATTCAACTCAAGTTGGCTATGCTGGAGGCTTTACTT-CAAACCCAACTTATAAAGAG 309 Query 910 GTCTGCTCAGAAAAAACTGGCCACGCCGAAG-TCGTCCGGGTTGTGTACCGGCCAGAGCA 968 ||||||||||| |||||||| || || ||| | ||||| |||||||||| |||||| || Sbjct 310 GTCTGCTCAGAGAAAACTGGGCATGCAGAAACT-GTCCGAGTTGTGTACCAGCCAGAACA 368 Query 969 CATCAGCTTTGAGGAACTGCTCAAGGTCTTCTGGGAGAATCACGACCCGACCCAAGGCAT 1028 |||||| ||||||||||| ||||||||||||||||||||||| |||||||| ||||| || Sbjct 369 CATCAGTTTTGAGGAACTACTCAAGGTCTTCTGGGAGAATCATGACCCGACACAAGGAAT 428 Query 1029 GCGCCAAGGCAATGACTTTGGTACAC-AGTACCGGTCAGC-AGTCTATCCCA-CATCCGC 1085 ||| || || ||||||||||| || | | ||||| || || | ||| ||||| | | | | Sbjct 429 GCGTCAGGGTAATGACTTTGGCACCCGA-TACCGTTCTGCTA-TCT-TCCCAAC-TACTC 484 Query 1086 C-GTGCAGATGGAAGCAGCCCTG-AGATCCAAGGAAGAATACCAAAAGGTTCTTTCA-AA 1142 | | |||| ||||| || || || || || || | || || ||||| || || || Sbjct 485 CAGAACAGAACGAAGCGGCTCTTCAG-TCTAAAGAGGCTTATCAGAAGGTCCTCACAGAA 543 Query 1143 -GCATAACTTTGGCCCCATCACCACCGACATCCGAGAGGGACAAGTGTTCTACTATGCCG 1201 | | || ||| | ||||| || || |||| ||| || ||| ||||| || || | Sbjct 544 AG--TGGCTATGGAACAATCACAACTGATATCCAAGAAGGCCAACAATTCTATTACGCTG 601 Query 1202 AAGACTACCACCAGCAATACCTGAGCAAGAA-CCCAGACGGCTACTGTGGCCTCGGG-GG 1259 |||| ||||| || || ||| |||||||||| |||| | || ||||| ||||| ||| || Sbjct 602 AAGATTACCATCAACAGTACTTGAGCAAGAATCCCA-ATGGATACTGCGGCCT-GGGAGG 659 Query 1260 TACTGGAGTTTCCTGCCCGAT-GGCCATTAAAAAATAA 1296 || ||||| |||||||| || ||| ||||| || ||| Sbjct 660 CACAGGAGTCTCCTGCCCCATTGGC-ATTAACAACTAA 696 >gb|BC133683.1| Mus musculus cDNA clone IMAGE:40110461 Length=198 Score = 331 bits (179), Expect = 5e-87 Identities = 179/179 (100%), Gaps = 0/179 (0%) Strand=Plus/Plus Query 1571 CTGAAGCAGGGGGATGGCCAGGAGAGCACAGGGTACTGGGACCCCTTGGTCTGTGCTGAC 1630 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 11 CTGAAGCAGGGGGATGGCCAGGAGAGCACAGGGTACTGGGACCCCTTGGTCTGTGCTGAC 70 Query 1631 ATACCTCACCCACTTCCCTGCCCTCGGGTGCCCAATTCATTAGTGTCTACAGATCCCATG 1690 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 71 ATACCTCACCCACTTCCCTGCCCTCGGGTGCCCAATTCATTAGTGTCTACAGATCCCATG 130 Query 1691 AATCATTTGCCAAATCGCTTTGCTCTGCTGGCTCTAGATGTGTACTAGGGGTTTCTCTC 1749 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 131 AATCATTTGCCAAATCGCTTTGCTCTGCTGGCTCTAGATGTGTACTAGGGGTTTCTCTC 189 >ref|XM_420035.2| UniGene infoGene info PREDICTED: Gallus gallus similar to cytosolic methionine-S-sulfoxide reductase (LOC422027), mRNA Length=1303 Score = 228 bits (123), Expect = 7e-56 Identities = 286/363 (78%), Gaps = 18/363 (4%) Strand=Plus/Plus Query 924 AACTGGCCACGCCGAAGTCGTCCGGGTTGTGTACCGGCCAGAGCACATCAGCTTTGAGGA 983 |||||||||| | || || || || || || || | |||||| |||||||||||||| | Sbjct 249 AACTGGCCACACAGAGGTTGTACGAGTGGTATATCAGCCAGAAAACATCAGCTTTGAGAA 308 Query 984 ACTGCTCAAGGTCTTCTGGGAGAATCACGACCCGACCCAAGGCATGCGCCAAGGCAATGA 1043 ||||||||||||||||||||||||||| |||||||| ||||| ||||| ||||| ||||| Sbjct 309 ACTGCTCAAGGTCTTCTGGGAGAATCATGACCCGACACAAGGAATGCGGCAAGGTAATGA 368 Query 1044 CTTTGGTACACAGTACCGGTCAGC-AGTCTATC-CCACATCCGCC-GTGCAGATGGAAGC 1100 |||||| || ||||| || ||||| | |||| | || ||| | | ||||||||||| Sbjct 369 CTTTGGCACTCAGTATCGCTCAGCCA-TCTA-CACCTTTTCC-CAAGAACAGATGGAAGC 425 Query 1101 AGCCCTGAGATCCAAGGAAGAATACCAAAAGGTTCTTTCAAAGCATAA-C--TTT-GGCC 1156 ||| ||| ||| ||||||||||| |||||||| || | || | || | ||| || Sbjct 426 TGCCTTGAAATCTAAGGAAGAATATCAAAAGGTA-TTG-ACAG-A-AAGCGGTTTTGGTG 481 Query 1157 CCATCACCACCGACATCCGAGAGGGACAAGTGTTCTACTATGCCGAAGACTACCACCAGC 1216 ||||||| || || ||||| |||| | | ||| || || || ||||| ||||| |||| Sbjct 482 CCATCACAACAGAAATCCGGGAGGCTCCGGAGTTTTATTACGCTGAAGATTACCATCAGC 541 Query 1217 AATACCTGAGCAAGAACCC-AGACGGCTACTGTGGCCTCGGGGGTACTGG-AGTTTCCTG 1274 ||||||| ||||||||||| | | || ||||| ||||||||||| || || | ||||||| Sbjct 542 AATACCTCAGCAAGAACCCCA-ATGGATACTGCGGCCTCGGGGGAACGGGGA-TTTCCTG 599 Query 1275 CCC 1277 ||| Sbjct 600 CCC 602 >gb|AC154332.2| Download subject sequence spanning the HSP Mus musculus BAC clone RP23-259P17 from chromosome 14, complete sequence Length=208155 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 224 bits (121), Expect = 1e-54 Identities = 121/121 (100%), Gaps = 0/121 (0%) Strand=Plus/Plus Query 799 GGAATGGGCTGCTTCTGGGGAGCTGAGCGCAAGTTCTGGGTCTTGAAAGGAGTGTACTCA 858 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 122595 GGAATGGGCTGCTTCTGGGGAGCTGAGCGCAAGTTCTGGGTCTTGAAAGGAGTGTACTCA 122654 Query 859 ACCCAAGTGGGCTTTGCAGGAGGCCACACACGCAATCCCACCTACAAAGAGGTCTGCTCA 918 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 122655 ACCCAAGTGGGCTTTGCAGGAGGCCACACACGCAATCCCACCTACAAAGAGGTCTGCTCA 122714 Query 919 G 919 | Sbjct 122715 G 122715 Score = 206 bits (111), Expect = 3e-49 Identities = 111/111 (100%), Gaps = 0/111 (0%) Strand=Plus/Plus Query 1023 AGGCATGCGCCAAGGCAATGACTTTGGTACACAGTACCGGTCAGCAGTCTATCCCACATC 1082 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 197243 AGGCATGCGCCAAGGCAATGACTTTGGTACACAGTACCGGTCAGCAGTCTATCCCACATC 197302 Query 1083 CGCCGTGCAGATGGAAGCAGCCCTGAGATCCAAGGAAGAATACCAAAAGGT 1133 ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 197303 CGCCGTGCAGATGGAAGCAGCCCTGAGATCCAAGGAAGAATACCAAAAGGT 197353 Score = 200 bits (108), Expect = 2e-47 Identities = 108/108 (100%), Gaps = 0/108 (0%) Strand=Plus/Plus Query 918 AGAAAAAACTGGCCACGCCGAAGTCGTCCGGGTTGTGTACCGGCCAGAGCACATCAGCTT 977 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 173844 AGAAAAAACTGGCCACGCCGAAGTCGTCCGGGTTGTGTACCGGCCAGAGCACATCAGCTT 173903 Query 978 TGAGGAACTGCTCAAGGTCTTCTGGGAGAATCACGACCCGACCCAAGG 1025 |||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 173904 TGAGGAACTGCTCAAGGTCTTCTGGGAGAATCACGACCCGACCCAAGG 173951 Score = 135 bits (73), Expect = 5e-28 Identities = 73/73 (100%), Gaps = 0/73 (0%) Strand=Plus/Plus Query 728 CAGCCAAACACCATGTCAGTGGCAACAGAACGGTTGAACCTTTCCCAGAGGGAACACAGA 787 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 94021 CAGCCAAACACCATGTCAGTGGCAACAGAACGGTTGAACCTTTCCCAGAGGGAACACAGA 94080 Query 788 TGGCTGTATTTGG 800 ||||||||||||| Sbjct 94081 TGGCTGTATTTGG 94093 >gb|AF153342.6| Download subject sequence spanning the HSP Homo sapiens chromosome 8 clone GS1-265m2 map 8p23, complete sequence Length=83803 Score = 156 bits (84), Expect = 4e-34 Identities = 100/108 (92%), Gaps = 0/108 (0%) Strand=Plus/Plus Query 918 AGAAAAAACTGGCCACGCCGAAGTCGTCCGGGTTGTGTACCGGCCAGAGCACATCAGCTT 977 ||||||||||||||| || ||||||||||| || ||||||| |||||| ||||| || || Sbjct 72602 AGAAAAAACTGGCCATGCAGAAGTCGTCCGAGTGGTGTACCAGCCAGAACACATGAGTTT 72661 Query 978 TGAGGAACTGCTCAAGGTCTTCTGGGAGAATCACGACCCGACCCAAGG 1025 |||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 72662 TGAGGAACTGCTCAAGGTCTTCTGGGAGAATCACGACCCGACCCAAGG 72709 >gb|AC112673.7| Download subject sequence spanning the HSP Homo sapiens chromosome 8, clone RP11-212F11, complete sequence Length=167547 Score = 156 bits (84), Expect = 4e-34 Identities = 100/108 (92%), Gaps = 0/108 (0%) Strand=Plus/Minus Query 918 AGAAAAAACTGGCCACGCCGAAGTCGTCCGGGTTGTGTACCGGCCAGAGCACATCAGCTT 977 ||||||||||||||| || ||||||||||| || ||||||| |||||| ||||| || || Sbjct 133802 AGAAAAAACTGGCCATGCAGAAGTCGTCCGAGTGGTGTACCAGCCAGAACACATGAGTTT 133743 Query 978 TGAGGAACTGCTCAAGGTCTTCTGGGAGAATCACGACCCGACCCAAGG 1025 |||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 133742 TGAGGAACTGCTCAAGGTCTTCTGGGAGAATCACGACCCGACCCAAGG 133695 >gb|AY958432.1| GeoDownload subject sequence spanning the HSP Homo sapiens methionine sulfoxide reductase gene, complete cds, alternatively spliced Length=379048 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Features in this part of subject sequence: methionine sulfoxide reductase A1 methionine sulfoxide reductase A3 Score = 156 bits (84), Expect = 4e-34 Identities = 100/108 (92%), Gaps = 0/108 (0%) Strand=Plus/Plus Query 918 AGAAAAAACTGGCCACGCCGAAGTCGTCCGGGTTGTGTACCGGCCAGAGCACATCAGCTT 977 ||||||||||||||| || ||||||||||| || ||||||| |||||| ||||| || || Sbjct 249625 AGAAAAAACTGGCCATGCAGAAGTCGTCCGAGTGGTGTACCAGCCAGAACACATGAGTTT 249684 Query 978 TGAGGAACTGCTCAAGGTCTTCTGGGAGAATCACGACCCGACCCAAGG 1025 |||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 249685 TGAGGAACTGCTCAAGGTCTTCTGGGAGAATCACGACCCGACCCAAGG 249732 Features in this part of subject sequence: methionine sulfoxide reductase A1 methionine sulfoxide reductase A3 Score = 111 bits (60), Expect = 8e-21 Identities = 68/72 (94%), Gaps = 0/72 (0%) Strand=Plus/Plus Query 729 AGCCAAACACCATGTCAGTGGCAACAGAACGGTTGAACCTTTCCCAGAGGGAACACAGAT 788 ||||||||| ||||||| |||||||||||| || |||||||||||||||||||||||||| Sbjct 155575 AGCCAAACATCATGTCAATGGCAACAGAACAGTCGAACCTTTCCCAGAGGGAACACAGAT 155634 Query 789 GGCTGTATTTGG 800 |||||||||||| Sbjct 155635 GGCTGTATTTGG 155646 >ref|XM_001256201.1| UniGene infoGene info PREDICTED: Bos taurus similar to Chain A, Crystal Structure Of Bovine Peptide Methionine Sulfoxide Reductase (LOC789448), partial mRNA Length=105 Score = 154 bits (83), Expect = 1e-33 Identities = 97/104 (93%), Gaps = 0/104 (0%) Strand=Plus/Plus Query 921 AAAAACTGGCCACGCCGAAGTCGTCCGGGTTGTGTACCGGCCAGAGCACATCAGCTTTGA 980 ||||||||||||||| ||||| |||||||| |||| || |||||| |||||||||||||| Sbjct 2 AAAAACTGGCCACGCAGAAGTAGTCCGGGTGGTGTTCCAGCCAGAACACATCAGCTTTGA 61 Query 981 GGAACTGCTCAAGGTCTTCTGGGAGAATCACGACCCGACCCAAG 1024 |||||||||||||||||||||||||||||| ||||||||||||| Sbjct 62 GGAACTGCTCAAGGTCTTCTGGGAGAATCATGACCCGACCCAAG 105 >gb|AC023385.10| Download subject sequence spanning the HSP Homo sapiens chromosome 8, clone RP11-675P19, complete sequence Length=167118 Score = 111 bits (60), Expect = 8e-21 Identities = 68/72 (94%), Gaps = 0/72 (0%) Strand=Plus/Plus Query 729 AGCCAAACACCATGTCAGTGGCAACAGAACGGTTGAACCTTTCCCAGAGGGAACACAGAT 788 ||||||||| ||||||| |||||||||||| || |||||||||||||||||||||||||| Sbjct 159696 AGCCAAACATCATGTCAATGGCAACAGAACAGTCGAACCTTTCCCAGAGGGAACACAGAT 159755 Query 789 GGCTGTATTTGG 800 |||||||||||| Sbjct 159756 GGCTGTATTTGG 159767 >gb|AC079200.6| Download subject sequence spanning the HSP Homo sapiens chromosome 8, clone RP11-1058B24, complete sequence Length=117978 Score = 111 bits (60), Expect = 8e-21 Identities = 68/72 (94%), Gaps = 0/72 (0%) Strand=Plus/Minus Query 729 AGCCAAACACCATGTCAGTGGCAACAGAACGGTTGAACCTTTCCCAGAGGGAACACAGAT 788 ||||||||| ||||||| |||||||||||| || |||||||||||||||||||||||||| Sbjct 78443 AGCCAAACATCATGTCAATGGCAACAGAACAGTCGAACCTTTCCCAGAGGGAACACAGAT 78384 Query 789 GGCTGTATTTGG 800 |||||||||||| Sbjct 78383 GGCTGTATTTGG 78372 >gb|CP000712.1| Download subject sequence spanning the HSP Pseudomonas putida F1, complete genome Length=5959964 Score = 76.8 bits (41), Expect = 3e-10 Identities = 133/175 (76%), Gaps = 15/175 (8%) Strand=Plus/Minus Query 895 CCC-ACCTACAAAGAGGTCTGCTCAGAAAAAACTGGCCACGCCGAAGTCGTCCGGGTTGT 953 ||| |||||| |||| |||||||| | ||||||||| ||||||| || | ||| || Sbjct 412633 CCCTACCTACGAAGAAGTCTGCTCGGGCCTGACTGGCCACACCGAAGTGGTGCTGGTGGT 412574 Query 954 GTACCGGCCAGAGCAC-A--TCAGCTTTGAG-GAACTGCT--CAAGGTCTTCTGGGAGAA 1007 || | | || || || | ||||| | | |||||||| ||| | ||||||||| Sbjct 412573 GT-TC-GACA-AGGACAAGGTCAGC-TACCGCGAACTGCTGGCAA--TGTTCTGGGAG-C 412521 Query 1008 T-CACGACCCGACCCAAGGCATGCGCCAAGGCAATGACTTTGGTACACAGTACCG 1061 | ||| |||||||||||||||||||||||||||| ||| | || || |||||||| Sbjct 412520 TGCACAACCCGACCCAAGGCATGCGCCAAGGCAACGACATCGGCACCCAGTACCG 412466
  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS,environmental 
samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Jun 2, 2007  5:48 PM
  Number of letters in database: -698,956,079
  Number of sequences in database:  5,319,389
Lambda     K      H
    1.33    0.621     1.12 
Gapped
Lambda     K      H
    1.33    0.621     1.12 
Matrix: blastn matrix:1 -2
Gap Penalties: Existence: 0, Extension: 0
Number of Sequences: 5319389
Number of Hits to DB: 3964849
Number of extensions: 0
Number of successful extensions: 0
Number of sequences better than 10: 0
Number of HSP's better than 10 without gapping: 0
Number of HSP's gapped: 0
Number of HSP's successfully gapped: 0
Length of query: 1890
Length of database: 20775880397
Length adjustment: 33
Effective length of query: 1857
Effective length of database: 20600340560
Effective search space: 38254832419920
Effective search space used: 38254832419920
A: 0
X1: 15 (28.8 bits)
X2: 32 (59.1 bits)
X3: 54 (99.7 bits)
S1: 15 (28.8 bits)
S2: 23 (43.6 bits)