spacer

ClustalW Results


Results of search
Number of sequences 6
Alignment score 114097
Sequence format Pearson
Sequence type nt
ClustalW version 1.83
JalView
Output file clustalw-20070603-20260006.output
Alignment file clustalw-20070603-20260006.aln
Guide tree file clustalw-20070603-20260006.dnd
Your input file clustalw-20070603-20260006.input

To save a result file right-click the file link in the above table and choose "Save Target As".
If you cannot see the JalView button, reload the page and check your browser settings to enable Java Applets.




Scores Table

SeqA Name            Len(nt)  SeqB Name            Len(nt)  Score
=================================================================
1    Mus             1890     2    Rattus          1348     86   
1    Mus             1890     3    P.troglodytes   1538     61   
1    Mus             1890     4    Pan             1290     72   
1    Mus             1890     5    Macaca          1455     67   
1    Mus             1890     6    Homo            1349     69   
2    Rattus          1348     3    P.troglodytes   1538     71   
2    Rattus          1348     4    Pan             1290     74   
2    Rattus          1348     5    Macaca          1455     73   
2    Rattus          1348     6    Homo            1349     71   
3    P.troglodytes   1538     4    Pan             1290     100  
3    P.troglodytes   1538     5    Macaca          1455     92   
3    P.troglodytes   1538     6    Homo            1349     98   
4    Pan             1290     5    Macaca          1455     95   
4    Pan             1290     6    Homo            1349     97   
5    Macaca          1455     6    Homo            1349     95   
=================================================================
PLEASE NOTE: Some scores may be missing from the above table if the alignment was done using multiple CPU mode. Please check the output.




Alignment

CLUSTAL W (1.83) multiple sequence alignment


P.troglodytes      ------------------------------------------------------------
Homo               ------------------------------------------------------------
Pan                ------------------------------------------------------------
Macaca             ------------------------------------------------------------
Mus                AACGCCCTGGTCATACAGGAGGGCTGTGGAAGTCTATCTGCTGTTCTGAAATGGCCTCAG 60
Rattus             ------------------------------------------------------------
                                                                               

P.troglodytes      ------------------------------------------------------------
Homo               ------------------------------------------------------------
Pan                ------------------------------------------------------------
Macaca             ------------------------------------------------------------
Mus                GCTTCAAGCCTTTCAGAGCCTCCTTGGCCTTCCCAAGGCTGGAATGACTTCTCTCTCTGG 120
Rattus             ------------------------------------------------------------
                                                                               

P.troglodytes      ------------------------------------------------------------
Homo               ------------------------------------------------------------
Pan                ------------------------------------------------------------
Macaca             ------------------------------------------------------------
Mus                GAGACAACACTCCATTCTGTAGGGGTGACGTCTGTAGGAAGATCACCGTTTGAAGAAGTG 180
Rattus             ------------------------------------------------------------
                                                                               

P.troglodytes      ------------------------------------------------------------
Homo               ------------------------------------------------------------
Pan                ------------------------------------------------------------
Macaca             ------------------------------------------------------------
Mus                CTGGTGGAAAGACAATTGTGGTCTAGAAAATTCCTGCAGATAATTTATAGGTGACATAAG 240
Rattus             ------------------------------------------------------------
                                                                               

P.troglodytes      ------------------------------------------------------------
Homo               ------------------------------------------------------------
Pan                ------------------------------------------------------------
Macaca             ------------------------------------------------------------
Mus                TAAGATTAAACTGAACACTCTTCGAGGAAACTAACACGATGAAGATTAGCAAGGTCGGAT 300
Rattus             ------------------------------------------------------------
                                                                               

P.troglodytes      -------------------------------------------GAACTCGCCGGGCCACA 17
Homo               ------------------------------------------------------------
Pan                ------------------------------------------------------------
Macaca             ------------------------------------------------------------
Mus                GGCCTGTGGGGCTGCAAGAAAACCAGACGCTGCTTGAAGGGAAGTGTCTGCTGACAGCGC 360
Rattus             ------------------------------------------------------------
                                                                               

P.troglodytes      CCCCCTGTCCAGGGAAGGAACACGCCCCCGGTGAAAGCCGGTACGGCCCCGGCCTTGGGC 77
Homo               ------------------------------------------------------------
Pan                ------------------------------------------------------------
Macaca             ------------------------------------------------------------
Mus                ATGCGCATGCCTGGAGCTCAGCTTCGAGATCTTCCTATCTGTGGAGTAAGAAGTGAGTAC 420
Rattus             ------------------------------------------------------------
                                                                               

P.troglodytes      AACCTCGATTACGGGCGGCCGCCAGCCCCGCCAGCAGCGCCCCGCGCCCGCCCGCCGGCG 137
Homo               ------------------------------------------------------------
Pan                ------------------------------------------------------------
Macaca             ---------------------GTAAACTCCACAGAAGCGCCCAGCGCCCGCCCGC----G 35
Mus                ATCGCACCCGGAACCCTGGCTGCGGAGGTGGAGAAACGGCAGCAACTCTGACCTCCCGCG 480
Rattus             ------------------------------------------------------------
                                                                               

P.troglodytes      CCCCTGCCGCCCCCCGGTTCCGGCCGCGGACCCCACTCTCTGCCGTTCCGGCTGCGGCTC 197
Homo               --------------------------------------------GATCCGGCTGCGGCTC 16
Pan                ------------------------------------------------------------
Macaca             CCCCTGCCGCCCCCCAGTTCCGGCCGCGGACCCCACTCTCTGCAGTTCCGGCGGCGGCCC 95
Mus                GTGGCGCCCAGCCAGCATCAATTTTGGCCCGCGCGGCTTCACGTACTCTGGGAACTTTGT 540
Rattus             ------------------------------------------------------------
                                                                               

P.troglodytes      CGCTGCCGGTAGCGCCGTCCCCCGGGACCACCCTTCGG--CTGGCGC-CCTCCCATGCTT 254
Homo               CGCTGCCGGTAGCGCCGTCCCCCGGGACCACCCTTCGG--CTGGCGC-CCTCCCATGCTC 73
Pan                ------------------------------------------------------ATGCTT 6
Macaca             CGTAGCCGGTAGGGCCGTCCCCCGCGACCGCCCCTCGG--CTGGCGC-CCTCCCATGCTC 152
Mus                CCCTCAGAGACAGCCAGGCCTGGAGGTCTGCCCCGCGAGACGGACACGCCGCCCATGCTC 600
Rattus             --------------------------------------------CACGCTGTCCATGCTC 16
                                                                         ***** 

P.troglodytes      TCGGCCACCCGGAGGGCTTGGCAGCTCCACCTCCTCCTCCACAGCCTCTTTCCCGTCCAG 314
Homo               TCGGCCACCCGGAGGGCTTGCCAGCTCC---TCCTCCTCCACAGCCTCTTTCCCGTCCCG 130
Pan                TCGGCCACCCGGAGGGCTTGGCAGCTCCACCTCCTCCTCCACAGCCTCTTTCCCGTCCAG 66
Macaca             TCGGCCACCCGGAGGGCTTGCCAGCTCC---TCCTCCTCCACAGCCTCTTTCCCGTCCCG 209
Mus                TCCGCCTCTAGAAGGGCTCTCCAGCTCC---------TCTCTAGCGCCAACCCGGTACGG 651
Rattus             TCCGCCTCCAGAAGGACTCTCCAGCTCC---------TCTCCAGCTCCATCCCGGTACGG 67
                   ** *** *  * *** **   *******         **   ***  *   ** ** * *

P.troglodytes      AGGATGGGCAACTCGGCCTCGAACATCGTCAGCCCCCAGGAGGCCTTGCCGGGCCGGAAG 374
Homo               AGGATGGGCAACTCGGCCTCGAACATCGTCAGCCCCCAGGAGGCCTTGCCGGGCCGGAAG 190
Pan                AGGATGGGCAACTCGGCCTCGAACATCGTCAGCCCCCAGGAGGCCTTGCCGGGCCGGAAG 126
Macaca             AGGATGGGCAACTCGGCCTCGAGCATCGTCAGCCCCCAGGAGGCCTTGCCGGGCCGGAAG 269
Mus                AGGATGGGCGACTCAGCTTCGAAAGTCATCTCCGCAGAGGAAGCCTTGCCGGGACGCACC 711
Rattus             ATGATGGGCGACTCATCTTCGAAGGTCATCAGCGCGGAGGAAGCTTTGCCAGGACGCACA 127
                   * ******* ****  * ****   ** **  * *  **** ** ***** ** ** *  

P.troglodytes      GAACAGACCCCTGTAGCGGCCAAACATCATGTCAATGGCAACAGAACAGTCGAACCTTTC 434
Homo               GAACAGACCCCTGTAGCGGCCAAACATCATGTCAATGGCAACAGAACAGTCGAACCTTTC 250
Pan                GAACAGACCCCTGTAGCGGCCAAACATCATGTCAATGGCAACAGAACAGTCGAACCTTTC 186
Macaca             GAACAGACCCCTGTAGCGGCCAAACATCATGTCAATGGCAACAGAACAGTCGAACCTTTC 329
Mus                GAGCCGATCCCTGTAACAGCCAAACACCATGTCAGTGGCAACAGAACGGTTGAACCTTTC 771
Rattus             GAGTCGATCCCCGTAGCAGCCAAACACCATGTCAGTGGCAACAGAACGGTTGAACCTTTC 187
                   **   ** *** *** * ******** ******* ************ ** *********

P.troglodytes      CCAGAGGGAACACAGATGGCTGTATTTGGAATGGGATGTTTCTGGGGAGCTGAAAGGAAA 494
Homo               CCAGAGGGAACACAGATGGCTGTATTTGGAATGGGATGTTTCTGGGGAGCTGAAAGGAAA 310
Pan                CCAGAGGGAACACAGATGGCTGTATTTGGAATGGGATGTTTCTGGGGAGCTGAAAGGAAA 246
Macaca             CCAGAGGGAACACAGATGGCTGTATTTGGAATGGGCTGTTTCTGGGGAGCTGAAAGGAAA 389
Mus                CCAGAGGGAACACAGATGGCTGTATTTGGAATGGGCTGCTTCTGGGGAGCTGAGCGCAAG 831
Rattus             CCAGAGGGAACACAGATGGCTGTATTTGGAATGGGCTGCTTCTGGGGAGCTGAGCGCAAG 247
                   *********************************** ** **************  * ** 

P.troglodytes      TTCTGGGTCTTGAAAGGAGTGTATTCAACTCAAGTTGGTTTTGCAGGAGGCTATACTTCA 554
Homo               TTCTGGGTCTTGAAAGGAGTGTATTCAACTCAAGTTGGTTTTGCAGGAGGCTATACTTCA 370
Pan                TTCTGGGTCTTGAAAGGAGTGTATTCAACTCAAGTTGGTTTTGCAGGAGGCTATACTTCA 306
Macaca             TTCTGGGTCTTGAAAGGAGTATATTCAACTCAAGTTGGTTTTGCAGGAGGCTATACTTCA 449
Mus                TTCTGGGTCTTGAAAGGAGTGTACTCAACCCAAGTGGGCTTTGCAGGAGGCCACACACGC 891
Rattus             TTCTGGCTCTTGAAAGGAGTGTATTCAACCCAAGTGGGTTTCGCAGGAGGCTACACACGC 307
                   ****** ************* ** ***** ***** ** ** ********* * **    

P.troglodytes      AATCCTACTTATAAAGAAGTCTGCTCAGAAAAAACTGGCCATGCAGAAGTCGTCCGAGTG 614
Homo               AATCCTACTTATAAAGAAGTCTGCTCAGAAAAAACTGGCCATGCAGAAGTCGTCCGAGTG 430
Pan                AATCCTACTTATAAAGAAGTCTGCTCAGAAAAAACTGGCCATGCAGAAGTCGTCCGAGTG 366
Macaca             AATCCTACTTATAAAGAAGTCTGCTCAGAAAAAACTGGCCATGCAGAAGTCGTCCGAGTG 509
Mus                AATCCCACCTACAAAGAGGTCTGCTCAGAAAAAACTGGCCACGCCGAAGTCGTCCGGGTT 951
Rattus             AATCCCACCTACAAAGAGGTCTGCTCAGAAAAAACCGGTCACGCAGAAGTCGTCCGGGTT 367
                   ***** ** ** ***** ***************** ** ** ** *********** ** 

P.troglodytes      GTGTACCAGCCAGAACACATCAGTTTTGAGGAACTGCTCAAGGTCTTCTGGGAGAATCAC 674
Homo               GTGTACCAGCCAGAACACATGAGTTTTGAGGAACTGCTCAAGGTCTTCTGGGAGAATCAC 490
Pan                GTGTACCAGCCAGAACACATCAGTTTTGAGGAACTGCTCAAGGTCTTCTGGGAGAATCAC 426
Macaca             GTGTACCAGCCAGAACACATCAGTTTTGAGGAACTGCTCAAGGTCTTCTGGGAGAATCAC 569
Mus                GTGTACCGGCCAGAGCACATCAGCTTTGAGGAACTGCTCAAGGTCTTCTGGGAGAATCAC 1011
Rattus             GTGTACCGGCCAGAGCACGTCAGCTTTGAGGAGCTGCTCAAGGTCTTCTGGGAGAATCAC 427
                   ******* ****** *** * ** ******** ***************************

P.troglodytes      GACCCGACCCAAGGTATGCGCCAGGGGAACGACCATGGCACTCAGTACCGCTCGGCCATC 734
Homo               GACCCGACCCAAGGTATGCGCCAGGGGAACGACCATGGCACTCAGTACCGCTCGGCCATC 550
Pan                GACCCGACCCAAGGTATGCGCCAGGGGAACGACCATGGCACTCAGTACCGCTCGGCCATC 486
Macaca             GACCCGACCCAAGGTATGCGCCAGGGGAACGACCATGGCACTCAGTACCGCTCGGCCATC 629
Mus                GACCCGACCCAAGGCATGCGCCAAGGCAATGACTTTGGTACACAGTACCGGTCAGCAGTC 1071
Rattus             GACCCGACCCAAGGGATGCGCCAAGGCAATGACTGTGGCACGCAGTATCGATCGGCGGTC 487
                   ************** ******** ** ** ***  *** ** ***** ** ** **  **

P.troglodytes      TACCCGACCTCTGCCAAGCAAATGGAGGCAGCCCTGAGCTCCAAAGAGAACTACCAAAAG 794
Homo               TACCCGACCTCTGCCAAGCAAATGGAGGCAGCCCTGAGCTCCAAAGAGAACTACCAAAAG 610
Pan                TACCCGACCTCTGCCAAGCAAATGGAGGCAGCCCTGAGCTCCAAAGAGAACTACCAAAAG 546
Macaca             TACCCGACTTCCGCCAAGCAAATGGAGGCGGCCCTGAGCTCCAAAGAGGACTACCAAAAG 689
Mus                TATCCCACATCCGCCGTGCAGATGGAAGCAGCCCTGAGATCCAAGGAAGAATACCAAAAG 1131
Rattus             TATCCCACCTCCGCCGTGCAGATGGAAGCTGCCCTGAAATCCAAGGAGGAGTACCAGAAG 547
                   ** ** ** ** ***  *** ***** ** *******  ***** **  * ***** ***

P.troglodytes      GTTCTTTCAGAGCACGGCTTCGGCCCCATCACTACCGACATCCGGGAGGGACAGACTTTC 854
Homo               GTTCTTTCAGAGCACGGCTTCGGCCCCATCACTACCGACATCCGGGAGGGACAGACTTTC 670
Pan                GTTCTTTCAGAGCACGGCTTCGGCCCCATCACTACCGACATCCGGGAGGGACAGACTTTC 606
Macaca             GTTCTTTCAGAGCACGGCTTTGGCCCCATCACTACCGACATCCGGGAAGGACAGATTTTC 749
Mus                GTTCTTTCAAAGCATAACTTTGGCCCCATCACCACCGACATCCGAGAGGGACAAGTGTTC 1191
Rattus             GTTCTTTCAAAGCATGGCTTTGGCCCCATCACCACCGACATCCGAGAGGGACAAGTGTTC 607
                   ********* ****   *** *********** *********** ** *****    ***

P.troglodytes      TACTATGCGGAAGACTACCACCAGCAGTACCTGAGCAAGAACCCCAATGGCTACTGCGGC 914
Homo               TACTATGCGGAAGACTACCACCAGCAGTACCTGAGCAAGAACCCCAATGGCTACTGCGGC 730
Pan                TACTATGCGGAAGACTACCACCAGCAGTACCTGAGCAAGAACCCCAATGGCTACTGCGGC 666
Macaca             TACTACGCGGAAGACTACCACCAGCAGTACCTGAGCAAGAACCCCAACGGCTACTGCGGC 809
Mus                TACTATGCCGAAGACTACCACCAGCAATACCTGAGCAAGAACCCAGACGGCTACTGTGGC 1251
Rattus             TACTACGCCGAAGATTACCACCAGCAATACCTGAGCAAGAACCCAGACGGCTACTGTGGC 667
                   ***** ** ***** *********** *****************  * ******** ***

P.troglodytes      CTTGGGGGCACCGGCGTGTCCTGCCCAGTGGGTATTAAAAAATAATTTCTCCCCACATGG 974
Homo               CTTGGGGGCACCGGCGTGTCCTGCCCAGTGGGTATTAAAAAATAATTGCTCCCCACATGG 790
Pan                CTTGGGGGCACCGGCGTGTCCTGCCCAGTGGGTATTAAAAAATAATTTCTCCCCACATGG 726
Macaca             CTTGGGGGCACCGGCGTGTCCTGCCCAATGGGTATTAAAAAATAATTTCTCCCCACATAG 869
Mus                CTCGGGGGTACTGGAGTTTCCTGCCCGATGGCCATTAAAAAATAATTTCTCTCCACGAAG 1311
Rattus             CTTGGGGGCACTGGGGTTTCCTGTCCCACGGCCATTAAAAAGTAATTTCTCTCCACGAAG 727
                   ** ***** ** ** ** ***** **   **  ******** ***** *** ****   *

P.troglodytes      TGGGCCTTTGAGGTTCCAGTAAAAATGCTTTCAACAAATTGGGCAATGCTTGTGTGATTC 1034
Homo               TGGGCCTTTGAGGTTCCAGTAAAAATGCTTTCAACAAATTGGGCAATGCTTGTGTGATTC 850
Pan                TGGGCCTTTGAGGTTCCAGTAAAAATGCTTTCAACAAATTGGGCAATGCTTGTGTGATTC 786
Macaca             TGGGCCTTTGCGGTTCCAGTAAAAATGCTTTCAACACATTGGGCAGTGTTCGTGTGATTC 929
Mus                CTGTCCCTGAAGGTTCCATCAACACCATGATTGCTGGATGGAGTGGCACTGCTGTGATTC 1371
Rattus             CTGGCCCTGGAGGTTCCATCAACACCATGATTGCTGGATGGAGCAGCACTGCTGTGATTC 787
                     * ** *   *******  ** *      *      ** * *      *  ********

P.troglodytes      ACAATCGTGGCATT---TAAAGTGCACAAAGTACAAAGGAATTTATACAGATTGTGTT-- 1089
Homo               ACAATCGTGGCATT---TAAAGTGCACAAAGTACAAAGGAATTTATACAGATTGGGTT-- 905
Pan                ACAATCGTGGCATT---TAAAGTGCACAAAGTACAAAGGAATTTATACAGATTGTGTT-- 841
Macaca             ACAATCATGGCATT---TGAAGTGCACAAAGTACAAAGGAATTTATAGAGATCTGGTT-- 984
Mus                ACATCTGTCACTTTATGCAAAGCACACACACCACACGGACCTTTACATGAATCTGGTTGT 1431
Rattus             CCATCTGTCACTTTATGAAGAGCACACAC--CACACGGGCATTTACATGAATCTGGTTGT 845
                    **    *  * **      **  ****    ***  *   **** *   **   ***  

P.troglodytes      TACCGAAGTATAATCTATAGGAGGCGCGATGGCAAGTTGATAAAATGTGACCTATCTCCT 1149
Homo               TACCGAAGTATAATCTATAGGAGGCGCGATGGCAAGTTGATAAAATGTGACTTATCTCCT 965
Pan                TACCGAAGTATAATCTATAGGAGGCGCGATGGCAAGTTGATAAAATGTGACCTATCTCCT 901
Macaca             T-CTGAAGTATAATCTACAGGAGACACGATGGCAAGTTGATAAAATGTGATTTATCTCCT 1043
Mus                TATTGGGGTTTGATTTCCAGAGAGTAGCATGACAAGGTGATACACTGTAATCTGCCTTCT 1491
Rattus             TATCCGGGTCTGATTTACAGAAAGTAGGATGACGAGGTGATGCGTTGTAATTTGTCTTCT 905
                   *      ** * ** *  **        *** * ** ****    *** *  *  ** **

P.troglodytes      AATAAGTTATGGTGGGAGTGGAGCTGTGCAGTTTCCTGTGTCTTCTGGGGTCTGAGTGAA 1209
Homo               AATAAGTTATGGTGGGAGTGGAGCTGTGCGGTTTCCTGTGTCTTCTGGGGTCTGAGTGAA 1025
Pan                AATAAGTTATGGTGGGAGTGGAGCTGTGCAGTTTCCTGTGTCTTCTGGGGTCTGAGTGAA 961
Macaca             AATAAGTTACGGTGGGAGCAGAGCTGTGCAGTTTCCTGCGTCATCTGGGGTCTGAGTGAA 1103
Mus                GATCAGTCCGGGTGGGGACAAATCATGACATTTTAGTGGATTGTTTGG------------ 1539
Rattus             GATCAGTCGGGATGGGGATAGAACATG---TTTTAGTGGATCATTTGGGGTCTAAATGAA 962
                    ** ***   * ****     * *       ***  **  *  * ***            

P.troglodytes      GATAGCAGGGATGCTGT----GTTCACCCTTCTTGGTAGAA-GCTAAGG--CGTGAGCTG 1262
Homo               GATAGCAGGGATGCTGT----GTTCACCCTTCTTGGTAGAA-GCTAAGG--TGTGAGCTG 1078
Pan                GATAGCAGGGATGCTGT----GTTCACCCTTCTTGGTAGAA-GCTAAGG--CGTGAGCTG 1014
Macaca             GATATCGGGGATGCTGT----GTTCACCCTTCTTGGTAGAA-GCTAAGG--CATGAGCTG 1156
Mus                ---------------------ATCTGCTCAGACTGGAAGGATGCTGAGGGTTCTGAAGCA 1578
Rattus             GATAACGAATATCCTGTGTCCATCTGCTGGAGCCGGAGGGATGCTAAGGGTTCTGAAACA 1022
                                         *   *       **  * * *** ***    ***    

P.troglodytes      GGAGGTTGCTGGACAGGATGGGGAACCCCAGAAGTCCTTTATCTGTGCT------CTCTG 1316
Homo               GGAGGTTGCTGGACAGGATGGGGGACCCCAGAAGTCCTTTATCTGTGCT------CTCTG 1132
Pan                GGAGGTTGCTGGACAGGATGGGGAACCCCAGAAGTCCTTTATCTGTGCT------CTCTG 1068
Macaca             GGAGGTTGCTGGACAGGGCGGGGGACCCCAGAAGTCCTTTATCTGTGCT------CTCTG 1210
Mus                GGGGGATGGCCAGGAGAGCACAGGGTACTGGGACCCCTTGGTCTGTGCTGACATACCTCA 1638
Rattus             GGGAGCTGGCTGGGAGAGCACGGAGCACTGGGACTCTA------GGGCTGACATACCTCG 1076
                   **  * **      **      *    *  * *  *        * ***      *    

P.troglodytes      CCCGC--CAGTGCCTTA-------CAATTTGCAAACGTGTATAGCCTCAATGACTCATTT 1367
Homo               CCCGC--CAGTGCCTTA-------CAATTTGCAAACGTGTATAGCTTCAGTGACTCATTC 1183
Pan                CCCGC--CAGTGCCTTA-------CAATTTGCAAACGTGTATAGCCTCAATGACTCATTT 1119
Macaca             CCCAC--CAGTGCCTTA-------CAAGTTGCAAACATGTATAGCCTCAATGACTCATTC 1261
Mus                CCCACTTCCCTGCCCTCGGGTGCCCAATTCATTAGTGTCTACAGATCCCATGAATCATTT 1698
Rattus             CCCACCTCCCTGCCCTCAGGTGCCTAATTCATTAGTGTCTAGGAGCTCCACGAATCATT- 1135
                   *** *  *  **** *         ** *    *   * **      *   ** ***** 

P.troglodytes      GCTGAAATCCTTGGCTTTACCAAATCTAGACATGCATAAGGTGCTTTCTCTCCCTTTTCA 1427
Homo               GCTGAAATCCTTCGCTTTACCAAATCTAGACATACATAAGGGACTTTCTCTCCCTTTTCA 1243
Pan                GCTGAAATCCTTGGCTTTACCAAATCTAGACATGCATAAGGTGCTTTCTCTCCCTTTTCA 1179
Macaca             ACTGAAATCCTTCGCTTTACCAAATCTAGACATGCATAGGG-GCTTTCTCTTCCTTTTCA 1320
Mus                GCCAAATCGCTTTGCTCTGCTGGCTCTAGATGTGTACTAGG-GGTTTCTCTCCCCC-TCC 1756
Rattus             GCCGAAACACTTTGCTCTGCTGCCTCTAGACGCATATTAGG-GGTTTCTCTCCCCCCTCC 1194
                    *  **   *** *** * *    ******     *   **   ******* **   ** 

P.troglodytes      GCCCTCTCTGTGCAGAGAAAAGATGTGAGTCCGCTTGATGAATCCTAATGCTTTGCTTAG 1487
Homo               GCCCTCTCTGTGCAGAGAAAAGATGTGAGTCCGCTTGATGAATTCTAATGCTTTGCTTAG 1303
Pan                GCCCTCTCTGTGCAGAGAAAAGATGTGAGTCCGCTTGATGAATCCTAATGCTTTGCTTAG 1239
Macaca             GCCCTCTCTGTGCAGAGAAAAAATGTGAGTCTGCTTGATGAATTCTAATGCTTTGCTTAG 1380
Mus                ATCCTCTCTG--CAGAGAAAAGACAGGAGTGACCTTAATGAATTCTAACATTCTGCTTAC 1814
Rattus             GTCCTCTCTGTGCAGAGAAAAGACATGAGTGACCTTAATGAATTCTAACATTCTGCTTAC 1254
                     ********  ********* *   ****   *** ****** ****   * ****** 

P.troglodytes      AGCTATGAGAAATGTTTGTTTTAATAAAAACCTACAGTCCAATAATGCCAG--------- 1538
Homo               AGCTATGAGAAATGTTTGTTTTAATAAAAACCTACAGTCCAATAAA-------------- 1349
Pan                AGCTATGAGAAATGTTTGTTTTAATAAAAACCTACAGTCCAATAATGCCAG--------- 1290
Macaca             AGCTATGAGAAATGTTTGGTTTAATAAAAACCTACAGTCCAATAATGCAAAAAAAAAAAA 1440
Mus                AGCTATGATAAA-GCTTGTTCTAATAAAAATCTGCAGTTTGGTAATAAAAAAAAAAAAAA 1873
Rattus             AGCTATGATAAA-GCTTGTTCTAATAAAAATCTACGGTTTGGTGATAAAAAAAAAAAAAA 1313
                   ******** *** * *** * ********* ** * **    * *               

P.troglodytes      -----------------------------------
Homo               -----------------------------------
Pan                -----------------------------------
Macaca             AAAAAAAAAAAAAAA-------------------- 1455
Mus                AAAAAAAAAAAAAAAAA------------------ 1890
Rattus             AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 1348
                                                      
PLEASE NOTE: Showing colors on large alignments is slow.




Guide Tree

(
(
(
(
Mus:0.08953,
Rattus:0.04178)
:0.20240,
Macaca:0.02511)
:0.02154,
Pan:-0.01056)
:0.01361,
P.troglodytes:0.01009,
Homo:0.00474);


Cladogram

Right-click on the above tree to see display options.
Problems printing? Read how to print a Phylogram or Cladogram.
spacer
spacer