Job Title: Mus musculus Ghr

BLASTN 2.2.16 (Mar-25-2007)
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman 
(1997), "Gapped BLAST and PSI-BLAST: a new generation of 
protein database search programs", Nucleic Acids Res. 25:3389-3402.

RID: 67JJRFH2012


Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
           5,322,174 sequences; 20,779,759,870 total letters

If you have any problems or questions with the results of this search
please refer to the BLAST FAQs Taxonomy reports

Query=  Mus musculus Ghr
Length=1080


Distance tree of resultsNew  
Legend for links to other resources: UniGene GEO Gene Structure Map Viewer Sequences producing significant alignments: (Click headers to sort columns)
Accession Description Max score Total score Query coverage E value Max ident Links
NM_001048147.1
Mus musculus growth hormone receptor (Ghr), transcript variant 3, mRNA
19481948100%0.0100% UniGene infoGene info
NM_001048178.1
Mus musculus growth hormone receptor (Ghr), transcript variant 2, mRNA
1793179392%0.0100% UniGene infoGene info
BC024375.1
Mus musculus growth hormone receptor, mRNA (cDNA clone IMAGE:4976030), complete cds
1793179392%0.0100% UniGene infoGeoGene info
BC056645.1
Mus musculus cDNA clone IMAGE:5136530, containing frame-shift errors
1784178492%0.099% UniGene infoGeoGene info
M33324.1
Mouse high molecular weight growth hormone receptor/binding protein, complete cds
1638178991%0.0100% UniGene infoGeoGene info
M31680.1
Mouse low molecular weight growth hormone receptor/binding protein, complete cds
1638193298%0.0100% UniGene infoGeoGene info
AK143886.1
Mus musculus adult male kidney cDNA, RIKEN full-length enriched library, clone:F520003E12 product:growth hormone receptor, full insert sequence
1487148776%0.0100% UniGene infoGene info
NM_010284.2
Mus musculus growth hormone receptor (Ghr), transcript variant 1, mRNA
1483148376%0.0100% UniGene infoGeoGene info
AK143925.1
Mus musculus adult male kidney cDNA, RIKEN full-length enriched library, clone:F520015N09 product:growth hormone receptor, full insert sequence
1483148376%0.0100% UniGene infoGene info
BC075720.1
Mus musculus growth hormone receptor, mRNA (cDNA clone MGC:78163 IMAGE:5044060), complete cds
1478147876%0.099% UniGene infoGeoGene info
BC127501.1
Rattus norvegicus cDNA clone MGC:156665 IMAGE:8375548, complete cds
1323132392%0.089% UniGene info
BC103659.1
Rattus norvegicus growth hormone receptor, mRNA (cDNA clone IMAGE:7325614), complete cds
1323132392%0.089% UniGene infoGene info
BC086591.1
Rattus norvegicus growth hormone receptor, mRNA (cDNA clone IMAGE:7310431), complete cds
1323132392%0.089% UniGene infoGene info
S49003.1
short isoform growth hormone receptor [rats, mRNA, 1136 nt]
1303130390%0.089% Geo
NM_017094.1
Rattus norvegicus growth hormone receptor (Ghr), mRNA >gb|J04811.1|RATGHR Rat growth hormone receptor mRNA, complete cds
1173117383%0.088% UniGene infoGeoGene info
X16726.1
R.rattus RNA for GH receptor
1061106176%0.088%
AF395535.1
Ailuropoda melanoleuca growth hormone receptor precursor (GHR) mRNA, complete cds
720 72075%0.079%
NM_001082636.1
Oryctolagus cuniculus growth hormone receptor (GHR), mRNA >gb|AF015252.1|AF015252 Oryctolagus cuniculus growth hormone receptor mRNA, complete cds
720 72075%0.079% Gene info
AK233142.1
Sus scrofa mRNA, clone:LVRM10088G11, expressed in liver
699 69975%0.078% UniGene info
X54429.1
Porcine mRNA for growth hormone receptor
699 69975%0.078% UniGene infoGene info
EF041823.1
Sus scrofa breed BaMa mini-pig growth hormone receptor mRNA, complete cds
690 69075%0.078% UniGene info
NM_214254.2
Sus scrofa growth hormone receptor (GHR), mRNA >gb|DQ106869.1| Sus scrofa growth hormone receptor mRNA, complete cds
690 69075%0.078% UniGene infoGene info
NM_001003123.1
Canis lupus familiaris growth hormone receptor (GHR), mRNA >gb|AF133835.1|AF133835 Canis familiaris growth hormone receptor precursor (GHR) mRNA, complete cds
690 69075%0.078% UniGene infoGene info
XM_526938.2
PREDICTED: Pan troglodytes hypothetical LOC471560 (GHR), mRNA
675 67575%0.077% Gene info
NM_000163.2
Homo sapiens growth hormone receptor (GHR), mRNA
666 66675%0.077% UniGene infoGene info
X06562.1
Human mRNA for growth hormone receptor
666 66675%0.077% UniGene infoGeoGene info
AF150751.1
Papio hamadryas anubis growth hormone receptor mRNA, complete cds
657 65775%0.077%
U85396.1
Macaca mulatta growth hormone binding protein precursor (mgGHbp) mRNA, complete cds
648 64875%0.077% UniGene infoGene info
NM_001042667.1
Macaca mulatta growth hormone receptor (GHR), mRNA >gb|U84589.1|MMU84589 Macaca mulatta growth hormone receptor precursor (mkGHR) mRNA, complete cds
646 64675%0.077% UniGene infoGene info
AF339061.1
Saimiri boliviensis growth hormone receptor mRNA, complete cds
645 64575%0.077%
AF247665.1
Cavia porcellus growth hormone receptor (GHR) mRNA, complete cds
572 57275%7e-16075%
AF227186.1
Cavia porcellus growth hormone receptor (GHR) mRNA, complete cds
563 56375%4e-15775%
AF238492.1
Cavia porcellus growth hormone receptor mRNA, complete cds
545 54575%1e-15174%
AK053579.1
Mus musculus 0 day neonate eyeball cDNA, RIKEN full-length enriched library, clone:E130111P21 product:growth hormone receptor, full insert sequence
544 54427%3e-151100% UniGene infoGeoGene info
X70041.1
B.taurus mRNA for growth hormone receptor
466 65871%8e-12880% UniGene infoGene info
AY748827.1
Bos taurus growth hormone receptor mRNA, complete cds
462 65571%9e-12780% UniGene infoGene info
NM_176608.1
Bos taurus growth hormone receptor (GHR), mRNA >gb|AF044258.1| Bos taurus somatotropin receptor 1B precursor, mRNA, complete cds
462 65571%9e-12780% UniGene infoGene info
NM_001009323.1
Ovis aries growth hormone receptor (GHR), mRNA >gb|M82912.1|SHPGHRPPP Ovine growth hormone receptor prepropolypeptide, complete cds
462 64671%9e-12780% UniGene infoGene info
AY608917.1
Bubalus bubalis growth hormone receptor-like (GHR) mRNA, complete sequence
457 63771%4e-12580%
AF467545.1
Trichosurus vulpecula growth hormone receptor mRNA, partial cds
419 41943%1e-11379% UniGene info
NM_001032976.1
Monodelphis domestica growth hormone receptor (GHR), mRNA >gb|AF238491.1|AF238491 Monodelphis domestica growth hormone receptor (GHR) mRNA, complete cds
405 47850%2e-10982% UniGene infoGene info
AC161799.5
Mus musculus chromosome 15, clone RP23-304B13, complete sequence
327197599%5e-86100%
AC121307.7
Mus musculus chromosome 15, clone RP24-209E20, complete sequence
327166283%5e-86100%
AF120486.1
Mus musculus growth hormone receptor/binding protein, exon 6
327 32716%5e-86100% Gene info
U15011.1
Mus musculus growth hormone receptor/binding protein gene, exon 6
327 32716%5e-86100% Gene info
U49268.1
Mus musculus growth hormone receptor/binding protein gene, exon 6
322 32216%2e-8499% Gene info
AF120485.1
Mus musculus growth hormone receptor/binding protein, exon 5
316 31616%9e-83100% Gene info
AF120487.1
Mus musculus growth hormone receptor/binding protein, exons 7 and 8A and complete cds, alternatively spliced
309 60630%1e-80100% Gene info
U43933.1
Mus musculus growth hormone receptor/binding protein gene, exons 7, 8 and 8A, and partial cds
309 60631%1e-80100% GeoGene info
U15013.1
Mus musculus growth hormone receptor/binding protein gene, exons 7 and 8a
304 60130%6e-79100% Gene info
AF211173.1
Pelodiscus sinensis japonicus liver growth hormone receptor mRNA, complete cds
300 34343%7e-7884%
NM_001001293.1
Gallus gallus growth hormone receptor (GHR), mRNA >gb|M74057.1|CHKGHRECEP Chicken growth hormone receptor mRNA, complete cds
286 33947%1e-7378% UniGene infoGene info
D84308.1
Columba livia mRNA for growth hormone receptor, complete cds
275 33450%3e-7079%
U20353.1
Columba livia growth hormone receptor (ghr) mRNA, complete cds
271 33049%3e-6979%
AK148440.1
Mus musculus B16 F10Y cells cDNA, RIKEN full-length enriched library, clone:G370148O21 product:unclassifiable, full insert sequence
268 26813%4e-68100% UniGene infoGene info
DQ138367.1
Gallus gallus growth hormone binding protein (GHBP) mRNA, complete cds, alternatively spliced
264 32136%5e-6779% UniGene infoGene info
U44722.1
Rattus norvegicus growth hormone receptor/binding protein (GHR/BP) gene, exons 7, 8A, and partial cds, alternatively spliced
246 44930%1e-6193% GeoGene info
AF120483.1
Mus musculus growth hormone receptor/binding protein, exon 4
237 23712%7e-5999% Gene info
U49267.1
Mus musculus growth hormone receptor/binding protein gene, exon 4, and partial cds
237 23712%7e-5999% Gene info
AB267378.1
Pelodiscus sinensis GHR mRNA for growth hormone receptor, partial cds
235 27828%2e-5884%
DQ530432.1
Anser anser growth hormone receptor mRNA, partial cds
224 22425%4e-5577%
DQ137140.1
Anas platyrhynchos growth hormone receptor protein mRNA, partial cds
219 21925%2e-5377%
AC093260.2
Homo sapiens chromosome 5 clone RP11-237B16, complete sequence
219 64159%2e-5386%
AC113368.3
Homo sapiens chromosome 5 clone RP11-116B13, complete sequence
219 64159%2e-5386%
AY958720.1
Pygathrix nemaeus growth hormone receptor (GHR) gene, exon 6 and partial cds
219 21916%2e-5386%
AY958719.1
Pygathrix roxellana growth hormone receptor (GHR) gene, exon 6 and partial cds
219 21916%2e-5386%
M28462.1
Human growth hormone receptor gene, exon 6
219 21916%2e-5386%
AB254885.1
Eudromia elegans GHR mRNA for growth hormone receptor, partial cds, 5'portion
217 29136%6e-5377%
AB254869.1
Struthio camelus GHR mRNA for growth hormone receptor, partial cds, 5'portion
217 27435%6e-5377%
AY958718.1
Pithecia pithecia growth hormone receptor (GHR) gene, exon 6 and partial cds
214 21416%8e-5286%
AY579204.1
Homo sapiens growth hormone receptor variant gene, exon 9 and partial cds
214 21416%8e-5286% Gene info
AY958717.1
Alouatta seniculus growth hormone receptor (GHR) gene, exon 6 and partial cds
201 20116%5e-4884%
AY958716.1
Pygathrix nemaeus growth hormone receptor (GHR) gene, exon 5 and partial cds
196 19615%2e-4685%
AY958715.1
Pygathrix roxellana growth hormone receptor (GHR) gene, exon 5 and partial cds
196 19615%2e-4685%
EF207442.2
Bos indicus growth hormone receptor (GHR) gene, complete cds
187 64164%1e-4382%
AM161140.1
Bos taurus GHR gene for growth hormone receptor, exons 2-10, Finnish Ayrshire Breed
187 63764%1e-4382% Gene info
M28461.1
Human growth hormone receptor gene, exon 5
187 18715%1e-4384%
AF097588.1
Equus caballus growth hormone receptor precursor (GHR) gene, partial cds
185 18513%4e-4388%
DQ179242.1
Capra hircus growth hormone receptor gene, exon 6
183 18316%1e-4282%
EF030077.1
Capra hircus breed Gaddi growth hormone receptor variant B (GHR) gene, exon 6 and partial cds
181 18116%5e-4281%
EF030087.1
Capra hircus breed Jakhrana growth hormone receptor variant A (GHR) gene, exon 6 and partial cds
179 17915%2e-4183%
EF207441.2
Bubalus bubalis growth hormone receptor (GHR) gene, complete cds
178 63264%6e-4183%
EF030088.1
Capra hircus breed Jakhrana growth hormone receptor variant B (GHR) gene, exon 6 and partial cds
178 17816%6e-4181%
AY958714.1
Pithecia pithecia growth hormone receptor (GHR) gene, exon 5 and partial cds
178 17815%6e-4183%
EF030089.1
Capra hircus breed Jakhrana growth hormone receptor variant C (GHR) gene, exon 6 and partial cds
176 17616%2e-4081%
EF030074.1
Ovis aries breed Gaddi growth hormone receptor variant C (GHR) gene, exon 6 and partial cds
176 17616%2e-4081%
EF030067.1
Ovis aries breed Gurej growth hormone receptor variant H (GHR) gene, exon 6 and partial cds
174 17416%7e-4080%
EF030090.1
Capra hircus breed Jakhrana growth hormone receptor variant D (GHR) gene, exon 6 and partial cds
172 17216%2e-3980%
EF030085.1
Capra hircus breed Marwari growth hormone receptor variant E (GHR) gene, exon 6 and partial cds
172 17215%2e-3983%
EF030084.1
Capra hircus breed Marwari growth hormone receptor variant D (GHR) gene, exon 6 and partial cds
172 17215%2e-3983%
EF030083.1
Capra hircus breed Marwari growth hormone receptor variant C (GHR) gene, exon 6 and partial cds
172 17215%2e-3982%
EF030079.1
Capra hircus breed Gaddi growth hormone receptor variant D (GHR) gene, exon 6 and partial cds
172 17216%2e-3980%
EF030078.1
Capra hircus breed Gaddi growth hormone receptor variant C (GHR) gene, exon 6 and partial cds
172 17216%2e-3980%
EF030073.1
Ovis aries breed Gaddi growth hormone receptor variant B (GHR) gene, exon 6 and partial cds
172 17215%2e-3982%
EF030072.1
Ovis aries breed Gaddi growth hormone receptor variant A (GHR) gene, exon 6 and partial cds
172 17215%2e-3982%
EF030069.1
Ovis aries breed Karnah growth hormone receptor variant A (GHR) gene, exon 6 and partial cds
172 17215%2e-3983%
EF030075.1
Ovis aries breed Gaddi growth hormone receptor variant D (GHR) gene, exon 6 and partial cds
170 17016%8e-3980%
EF030086.1
Capra hircus breed Marwari growth hormone receptor variant F (GHR) gene, exon 6 and partial cds
169 16915%3e-3882%
EF030080.1
Capra hircus breed Gaddi growth hormone receptor variant E (GHR) gene, exon 6 and partial cds
169 16916%3e-3880%
EF030076.1
Capra hircus breed Gaddi growth hormone receptor variant A (GHR) gene, exon 6 and partial cds
169 16916%3e-3880%
Alignments
>ref|NM_001048147.1| UniGene infoGene info Mus musculus growth hormone receptor (Ghr), transcript variant 3, mRNA Length=1080 Score = 1948 bits (2160), Expect = 0.0 Identities = 1080/1080 (100%), Gaps = 0/1080 (0%) Strand=Plus/Plus Query 1 CGCACCAAGAAATAACCAGGAAACGTCTACAAAATTTCAACCCTAGCTTCTCTACCAGAT 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1 CGCACCAAGAAATAACCAGGAAACGTCTACAAAATTTCAACCCTAGCTTCTCTACCAGAT 60 Query 61 TTTAACTAAACGAGATCTTCTTGCAAAGGTCTCAGGTATGGATCTTTGTCAGGTCTTCTT 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 61 TTTAACTAAACGAGATCTTCTTGCAAAGGTCTCAGGTATGGATCTTTGTCAGGTCTTCTT 120 Query 121 AACCTTGGCACTGGCAGTCACCAGCAGCACATTTTCTGGAAGTGAGGCTACACCAGCTAC 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 121 AACCTTGGCACTGGCAGTCACCAGCAGCACATTTTCTGGAAGTGAGGCTACACCAGCTAC 180 Query 181 TCTTGGCAAAGCTTCCCCAGTTCTGCAAAGAATCAATCCAAGCCTGGGGACAAGTTCTTC 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 181 TCTTGGCAAAGCTTCCCCAGTTCTGCAAAGAATCAATCCAAGCCTGGGGACAAGTTCTTC 240 Query 241 TGGAAAGCCTCGATTCACCAAGTGTCGTTCCCCTGAACTGGAGACATTTTCATGCTACTG 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 241 TGGAAAGCCTCGATTCACCAAGTGTCGTTCCCCTGAACTGGAGACATTTTCATGCTACTG 300 Query 301 GACAGAAGGAGATAATCCTGATTTAAAGACCCCAGGATCTATTCAGCTGTACTATGCTAA 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 301 GACAGAAGGAGATAATCCTGATTTAAAGACCCCAGGATCTATTCAGCTGTACTATGCTAA 360 Query 361 AAGGGAAAGCCAACGACAAGCTGCAAGAATTGCTCATGAATGGACCCAGGAATGGAAAGA 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 361 AAGGGAAAGCCAACGACAAGCTGCAAGAATTGCTCATGAATGGACCCAGGAATGGAAAGA 420 Query 421 ATGCCCTGATTATGTCTCTGCTGGAAAAAACAGCTGTTACTTCAACTCATCATATACCTC 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 421 ATGCCCTGATTATGTCTCTGCTGGAAAAAACAGCTGTTACTTCAACTCATCATATACCTC 480 Query 481 CATTTGGATACCCTACTGCATCAAGCTAACTACAAATGGTGATTTGCTGGACCAAAAATG 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 481 CATTTGGATACCCTACTGCATCAAGCTAACTACAAATGGTGATTTGCTGGACCAAAAATG 540 Query 541 TTTCACTGTTGACGAAATAGTGCAACCTGATCCACCCATTGGCCTCAACTGGACTTTACT 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 541 TTTCACTGTTGACGAAATAGTGCAACCTGATCCACCCATTGGCCTCAACTGGACTTTACT 600 Query 601 AAACATTAGTTTGACCGGGATTCGTGGAGACATCCAAGTGAGTTGGCAACCACCACCCAA 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 601 AAACATTAGTTTGACCGGGATTCGTGGAGACATCCAAGTGAGTTGGCAACCACCACCCAA 660 Query 661 TGCAGATGTTCTGAAGGGATGGATAATTCTGGAGTATGAAATTCAGTACAAAGAAGTAAA 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 661 TGCAGATGTTCTGAAGGGATGGATAATTCTGGAGTATGAAATTCAGTACAAAGAAGTAAA 720 Query 721 TGAATCAAAATGGAAAGTGATGGGCCCTATATGGTTAACATACTGTCCAGTGTACTCATT 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 721 TGAATCAAAATGGAAAGTGATGGGCCCTATATGGTTAACATACTGTCCAGTGTACTCATT 780 Query 781 GAGAATGGATAAAGAACATGAAGTGCGGGTGAGATCCAGACAACGGAGCTTTGAAAAGTA 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 781 GAGAATGGATAAAGAACATGAAGTGCGGGTGAGATCCAGACAACGGAGCTTTGAAAAGTA 840 Query 841 CAGCGAGTTCAGCGAAGTCCTCCGTGTAATATTTCCTCAGACGAACATATTGGAAGCATG 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 841 CAGCGAGTTCAGCGAAGTCCTCCGTGTAATATTTCCTCAGACGAACATATTGGAAGCATG 900 Query 901 TGAAGAAGGAACCAAGTCCAATTCTCAGCACCCACATCAAGAGATTGACAACCACCTGTA 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 901 TGAAGAAGGAACCAAGTCCAATTCTCAGCACCCACATCAAGAGATTGACAACCACCTGTA 960 Query 961 TCACCAGCTTCAGAGGATCCGCCATCCCTAGCCTTGTGGGCACCTGCATTCATATGCACA 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 961 TCACCAGCTTCAGAGGATCCGCCATCCCTAGCCTTGTGGGCACCTGCATTCATATGCACA 1020 Query 1021 TACATGCATACGCATAATTCaaaataataaaataaaattttaaaaattaaaaaaaaaaaa 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1021 TACATGCATACGCATAATTCAAAATAATAAAATAAAATTTTAAAAATTAAAAAAAAAAAA 1080 >ref|NM_001048178.1| UniGene infoGene info Mus musculus growth hormone receptor (Ghr), transcript variant 2, mRNA Length=1223 Score = 1793 bits (1988), Expect = 0.0 Identities = 994/994 (100%), Gaps = 0/994 (0%) Strand=Plus/Plus Query 87 AGGTCTCAGGTATGGATCTTTGTCAGGTCTTCTTAACCTTGGCACTGGCAGTCACCAGCA 146 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 230 AGGTCTCAGGTATGGATCTTTGTCAGGTCTTCTTAACCTTGGCACTGGCAGTCACCAGCA 289 Query 147 GCACATTTTCTGGAAGTGAGGCTACACCAGCTACTCTTGGCAAAGCTTCCCCAGTTCTGC 206 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 290 GCACATTTTCTGGAAGTGAGGCTACACCAGCTACTCTTGGCAAAGCTTCCCCAGTTCTGC 349 Query 207 AAAGAATCAATCCAAGCCTGGGGACAAGTTCTTCTGGAAAGCCTCGATTCACCAAGTGTC 266 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 350 AAAGAATCAATCCAAGCCTGGGGACAAGTTCTTCTGGAAAGCCTCGATTCACCAAGTGTC 409 Query 267 GTTCCCCTGAACTGGAGACATTTTCATGCTACTGGACAGAAGGAGATAATCCTGATTTAA 326 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 410 GTTCCCCTGAACTGGAGACATTTTCATGCTACTGGACAGAAGGAGATAATCCTGATTTAA 469 Query 327 AGACCCCAGGATCTATTCAGCTGTACTATGCTAAAAGGGAAAGCCAACGACAAGCTGCAA 386 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 470 AGACCCCAGGATCTATTCAGCTGTACTATGCTAAAAGGGAAAGCCAACGACAAGCTGCAA 529 Query 387 GAATTGCTCATGAATGGACCCAGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAA 446 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 530 GAATTGCTCATGAATGGACCCAGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAA 589 Query 447 AAAACAGCTGTTACTTCAACTCATCATATACCTCCATTTGGATACCCTACTGCATCAAGC 506 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 590 AAAACAGCTGTTACTTCAACTCATCATATACCTCCATTTGGATACCCTACTGCATCAAGC 649 Query 507 TAACTACAAATGGTGATTTGCTGGACCAAAAATGTTTCACTGTTGACGAAATAGTGCAAC 566 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 650 TAACTACAAATGGTGATTTGCTGGACCAAAAATGTTTCACTGTTGACGAAATAGTGCAAC 709 Query 567 CTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGGGATTCGTG 626 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 710 CTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGGGATTCGTG 769 Query 627 GAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGGATGGATAA 686 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 770 GAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGGATGGATAA 829 Query 687 TTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGTGATGGGCC 746 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 830 TTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGTGATGGGCC 889 Query 747 CTATATGGTTAACATACTGTCCAGTGTACTCATTGAGAATGGATAAAGAACATGAAGTGC 806 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 890 CTATATGGTTAACATACTGTCCAGTGTACTCATTGAGAATGGATAAAGAACATGAAGTGC 949 Query 807 GGGTGAGATCCAGACAACGGAGCTTTGAAAAGTACAGCGAGTTCAGCGAAGTCCTCCGTG 866 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 950 GGGTGAGATCCAGACAACGGAGCTTTGAAAAGTACAGCGAGTTCAGCGAAGTCCTCCGTG 1009 Query 867 TAATATTTCCTCAGACGAACATATTGGAAGCATGTGAAGAAGGAACCAAGTCCAATTCTC 926 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1010 TAATATTTCCTCAGACGAACATATTGGAAGCATGTGAAGAAGGAACCAAGTCCAATTCTC 1069 Query 927 AGCACCCACATCAAGAGATTGACAACCACCTGTATCACCAGCTTCAGAGGATCCGCCATC 986 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1070 AGCACCCACATCAAGAGATTGACAACCACCTGTATCACCAGCTTCAGAGGATCCGCCATC 1129 Query 987 CCTAGCCTTGTGGGCACCTGCATTCATATGCACATACATGCATACGCATAATTCaaaata 1046 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1130 CCTAGCCTTGTGGGCACCTGCATTCATATGCACATACATGCATACGCATAATTCAAAATA 1189 Query 1047 ataaaataaaattttaaaaattaaaaaaaaaaaa 1080 |||||||||||||||||||||||||||||||||| Sbjct 1190 ATAAAATAAAATTTTAAAAATTAAAAAAAAAAAA 1223 >gb|BC024375.1| UniGene infoGeoGene info Mus musculus growth hormone receptor, mRNA (cDNA clone IMAGE:4976030), complete cds Length=1183 Score = 1793 bits (1988), Expect = 0.0 Identities = 994/994 (100%), Gaps = 0/994 (0%) Strand=Plus/Plus Query 87 AGGTCTCAGGTATGGATCTTTGTCAGGTCTTCTTAACCTTGGCACTGGCAGTCACCAGCA 146 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 187 AGGTCTCAGGTATGGATCTTTGTCAGGTCTTCTTAACCTTGGCACTGGCAGTCACCAGCA 246 Query 147 GCACATTTTCTGGAAGTGAGGCTACACCAGCTACTCTTGGCAAAGCTTCCCCAGTTCTGC 206 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 247 GCACATTTTCTGGAAGTGAGGCTACACCAGCTACTCTTGGCAAAGCTTCCCCAGTTCTGC 306 Query 207 AAAGAATCAATCCAAGCCTGGGGACAAGTTCTTCTGGAAAGCCTCGATTCACCAAGTGTC 266 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 307 AAAGAATCAATCCAAGCCTGGGGACAAGTTCTTCTGGAAAGCCTCGATTCACCAAGTGTC 366 Query 267 GTTCCCCTGAACTGGAGACATTTTCATGCTACTGGACAGAAGGAGATAATCCTGATTTAA 326 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 367 GTTCCCCTGAACTGGAGACATTTTCATGCTACTGGACAGAAGGAGATAATCCTGATTTAA 426 Query 327 AGACCCCAGGATCTATTCAGCTGTACTATGCTAAAAGGGAAAGCCAACGACAAGCTGCAA 386 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 427 AGACCCCAGGATCTATTCAGCTGTACTATGCTAAAAGGGAAAGCCAACGACAAGCTGCAA 486 Query 387 GAATTGCTCATGAATGGACCCAGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAA 446 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 487 GAATTGCTCATGAATGGACCCAGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAA 546 Query 447 AAAACAGCTGTTACTTCAACTCATCATATACCTCCATTTGGATACCCTACTGCATCAAGC 506 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 547 AAAACAGCTGTTACTTCAACTCATCATATACCTCCATTTGGATACCCTACTGCATCAAGC 606 Query 507 TAACTACAAATGGTGATTTGCTGGACCAAAAATGTTTCACTGTTGACGAAATAGTGCAAC 566 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 607 TAACTACAAATGGTGATTTGCTGGACCAAAAATGTTTCACTGTTGACGAAATAGTGCAAC 666 Query 567 CTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGGGATTCGTG 626 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 667 CTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGGGATTCGTG 726 Query 627 GAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGGATGGATAA 686 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 727 GAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGGATGGATAA 786 Query 687 TTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGTGATGGGCC 746 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 787 TTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGTGATGGGCC 846 Query 747 CTATATGGTTAACATACTGTCCAGTGTACTCATTGAGAATGGATAAAGAACATGAAGTGC 806 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 847 CTATATGGTTAACATACTGTCCAGTGTACTCATTGAGAATGGATAAAGAACATGAAGTGC 906 Query 807 GGGTGAGATCCAGACAACGGAGCTTTGAAAAGTACAGCGAGTTCAGCGAAGTCCTCCGTG 866 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 907 GGGTGAGATCCAGACAACGGAGCTTTGAAAAGTACAGCGAGTTCAGCGAAGTCCTCCGTG 966 Query 867 TAATATTTCCTCAGACGAACATATTGGAAGCATGTGAAGAAGGAACCAAGTCCAATTCTC 926 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 967 TAATATTTCCTCAGACGAACATATTGGAAGCATGTGAAGAAGGAACCAAGTCCAATTCTC 1026 Query 927 AGCACCCACATCAAGAGATTGACAACCACCTGTATCACCAGCTTCAGAGGATCCGCCATC 986 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1027 AGCACCCACATCAAGAGATTGACAACCACCTGTATCACCAGCTTCAGAGGATCCGCCATC 1086 Query 987 CCTAGCCTTGTGGGCACCTGCATTCATATGCACATACATGCATACGCATAATTCaaaata 1046 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1087 CCTAGCCTTGTGGGCACCTGCATTCATATGCACATACATGCATACGCATAATTCAAAATA 1146 Query 1047 ataaaataaaattttaaaaattaaaaaaaaaaaa 1080 |||||||||||||||||||||||||||||||||| Sbjct 1147 ATAAAATAAAATTTTAAAAATTAAAAAAAAAAAA 1180 >gb|BC056645.1| UniGene infoGeoGene info Mus musculus cDNA clone IMAGE:5136530, containing frame-shift errors Length=1164 Score = 1784 bits (1978), Expect = 0.0 Identities = 993/994 (99%), Gaps = 1/994 (0%) Strand=Plus/Plus Query 87 AGGTCTCAGGTATGGATCTTTGTCAGGTCTTCTTAACCTTGGCACTGGCAGTCACCAGCA 146 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 168 AGGTCTCAGGTATGGATCTTTGTCAGGTCTTCTTAACCTTGGCACTGGCAGTCACCAGCA 227 Query 147 GCACATTTTCTGGAAGTGAGGCTACACCAGCTACTCTTGGCAAAGCTTCCCCAGTTCTGC 206 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 228 GCACATTTTCTGGAAGTGAGGCTACACCAGCTACTCTTGGCAAAGCTTCCCCAGTTCTGC 287 Query 207 AAAGAATCAATCCAAGCCTGGGGACAAGTTCTTCTGGAAAGCCTCGATTCACCAAGTGTC 266 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 288 AAAGAATCAATCCAAGCCTGGGGACAAGTTCTTCTGGAAAGCCTCGATTCACCAAGTGTC 347 Query 267 GTTCCCCTGAACTGGAGACATTTTCATGCTACTGGACAGAAGGAGATAATCCTGATTTAA 326 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 348 GTTCCCCTGAACTGGAGACATTTTCATGCTACTGGACAGAAGGAGATAATCCTGATTTAA 407 Query 327 AGACCCCAGGATCTATTCAGCTGTACTATGCTAAAAGGGAAAGCCAACGACAAGCTGCAA 386 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 408 AGACCCCAGGATCTATTCAGCTGTACTATGCTAAAAGGGAAAGCCAACGACAAGCTGCAA 467 Query 387 GAATTGCTCATGAATGGACCCAGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAA 446 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 468 GAATTGCTCATGAATGGACCCAGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAA 527 Query 447 AAAACAGCTGTTACTTCAACTCATCATATACCTCCATTTGGATACCCTACTGCATCAAGC 506 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 528 AAAACAGCTGTTACTTCAACTCATCATATACCTCCATTTGGATACCCTACTGCATCAAGC 587 Query 507 TAACTACAAATGGTGATTTGCTGGACCAAAAATGTTTCACTGTTGACGAAATAGTGCAAC 566 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 588 TAACTACAAATGGTGATTTGCTGGACCAAAAATGTTTCACTGTTGACGAAATAGTGCAAC 647 Query 567 CTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGGGATTCGTG 626 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 648 CTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGGGATTCGTG 707 Query 627 GAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGGATGGATAA 686 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 708 GAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGGATGGATAA 767 Query 687 TTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGTGATGGGCC 746 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 768 TTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGTGATGGGCC 827 Query 747 CTATATGGTTAACATACTGTCCAGTGTACTCATTGAGAATGGATAAAGAACATGAAGTGC 806 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 828 CTATATGGTTAACATACTGTCCAGTGTACTCATTGAGAATGGATAAAGAACATGAAGTGC 887 Query 807 GGGTGAGATCCAGACAACGGAGCTTTGAAAAGTACAGCGAGTTCAGCGAAGTCCTCCGTG 866 ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| Sbjct 888 GGGTGAGATCCAGACAACGGAGCTTTGAAAAGT-CAGCGAGTTCAGCGAAGTCCTCCGTG 946 Query 867 TAATATTTCCTCAGACGAACATATTGGAAGCATGTGAAGAAGGAACCAAGTCCAATTCTC 926 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 947 TAATATTTCCTCAGACGAACATATTGGAAGCATGTGAAGAAGGAACCAAGTCCAATTCTC 1006 Query 927 AGCACCCACATCAAGAGATTGACAACCACCTGTATCACCAGCTTCAGAGGATCCGCCATC 986 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1007 AGCACCCACATCAAGAGATTGACAACCACCTGTATCACCAGCTTCAGAGGATCCGCCATC 1066 Query 987 CCTAGCCTTGTGGGCACCTGCATTCATATGCACATACATGCATACGCATAATTCaaaata 1046 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1067 CCTAGCCTTGTGGGCACCTGCATTCATATGCACATACATGCATACGCATAATTCAAAATA 1126 Query 1047 ataaaataaaattttaaaaattaaaaaaaaaaaa 1080 |||||||||||||||||||||||||||||||||| Sbjct 1127 ATAAAATAAAATTTTAAAAATTAAAAAAAAAAAA 1160 >gb|M33324.1|MUSGHRBPA UniGene infoGeoGene info Mouse high molecular weight growth hormone receptor/binding protein, complete cds Length=2288 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 1638 bits (1816), Expect = 0.0 Identities = 908/908 (100%), Gaps = 0/908 (0%) Strand=Plus/Plus Query 1 CGCACCAAGAAATAACCAGGAAACGTCTACAAAATTTCAACCCTAGCTTCTCTACCAGAT 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2 CGCACCAAGAAATAACCAGGAAACGTCTACAAAATTTCAACCCTAGCTTCTCTACCAGAT 61 Query 61 TTTAACTAAACGAGATCTTCTTGCAAAGGTCTCAGGTATGGATCTTTGTCAGGTCTTCTT 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 62 TTTAACTAAACGAGATCTTCTTGCAAAGGTCTCAGGTATGGATCTTTGTCAGGTCTTCTT 121 Query 121 AACCTTGGCACTGGCAGTCACCAGCAGCACATTTTCTGGAAGTGAGGCTACACCAGCTAC 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 122 AACCTTGGCACTGGCAGTCACCAGCAGCACATTTTCTGGAAGTGAGGCTACACCAGCTAC 181 Query 181 TCTTGGCAAAGCTTCCCCAGTTCTGCAAAGAATCAATCCAAGCCTGGGGACAAGTTCTTC 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 182 TCTTGGCAAAGCTTCCCCAGTTCTGCAAAGAATCAATCCAAGCCTGGGGACAAGTTCTTC 241 Query 241 TGGAAAGCCTCGATTCACCAAGTGTCGTTCCCCTGAACTGGAGACATTTTCATGCTACTG 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 242 TGGAAAGCCTCGATTCACCAAGTGTCGTTCCCCTGAACTGGAGACATTTTCATGCTACTG 301 Query 301 GACAGAAGGAGATAATCCTGATTTAAAGACCCCAGGATCTATTCAGCTGTACTATGCTAA 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 302 GACAGAAGGAGATAATCCTGATTTAAAGACCCCAGGATCTATTCAGCTGTACTATGCTAA 361 Query 361 AAGGGAAAGCCAACGACAAGCTGCAAGAATTGCTCATGAATGGACCCAGGAATGGAAAGA 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 362 AAGGGAAAGCCAACGACAAGCTGCAAGAATTGCTCATGAATGGACCCAGGAATGGAAAGA 421 Query 421 ATGCCCTGATTATGTCTCTGCTGGAAAAAACAGCTGTTACTTCAACTCATCATATACCTC 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 422 ATGCCCTGATTATGTCTCTGCTGGAAAAAACAGCTGTTACTTCAACTCATCATATACCTC 481 Query 481 CATTTGGATACCCTACTGCATCAAGCTAACTACAAATGGTGATTTGCTGGACCAAAAATG 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 482 CATTTGGATACCCTACTGCATCAAGCTAACTACAAATGGTGATTTGCTGGACCAAAAATG 541 Query 541 TTTCACTGTTGACGAAATAGTGCAACCTGATCCACCCATTGGCCTCAACTGGACTTTACT 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 542 TTTCACTGTTGACGAAATAGTGCAACCTGATCCACCCATTGGCCTCAACTGGACTTTACT 601 Query 601 AAACATTAGTTTGACCGGGATTCGTGGAGACATCCAAGTGAGTTGGCAACCACCACCCAA 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 602 AAACATTAGTTTGACCGGGATTCGTGGAGACATCCAAGTGAGTTGGCAACCACCACCCAA 661 Query 661 TGCAGATGTTCTGAAGGGATGGATAATTCTGGAGTATGAAATTCAGTACAAAGAAGTAAA 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 662 TGCAGATGTTCTGAAGGGATGGATAATTCTGGAGTATGAAATTCAGTACAAAGAAGTAAA 721 Query 721 TGAATCAAAATGGAAAGTGATGGGCCCTATATGGTTAACATACTGTCCAGTGTACTCATT 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 722 TGAATCAAAATGGAAAGTGATGGGCCCTATATGGTTAACATACTGTCCAGTGTACTCATT 781 Query 781 GAGAATGGATAAAGAACATGAAGTGCGGGTGAGATCCAGACAACGGAGCTTTGAAAAGTA 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 782 GAGAATGGATAAAGAACATGAAGTGCGGGTGAGATCCAGACAACGGAGCTTTGAAAAGTA 841 Query 841 CAGCGAGTTCAGCGAAGTCCTCCGTGTAATATTTCCTCAGACGAACATATTGGAAGCATG 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 842 CAGCGAGTTCAGCGAAGTCCTCCGTGTAATATTTCCTCAGACGAACATATTGGAAGCATG 901 Query 901 TGAAGAAG 908 |||||||| Sbjct 902 TGAAGAAG 909 Score = 150 bits (166), Expect = 8e-33 Identities = 85/86 (98%), Gaps = 0/86 (0%) Strand=Plus/Plus Query 907 AGGAACCAAGTCCAATTCTCAGCACCCACATCAAGAGATTGACAACCACCTGTATCACCA 966 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 989 AGGAACCAAGTCCAATTCTCAGCACCCACATCAAGAGATTGACAACCACCTGTATCACCA 1048 Query 967 GCTTCAGAGGATCCGCCATCCCTAGC 992 |||||||||||||||||||||| ||| Sbjct 1049 GCTTCAGAGGATCCGCCATCCCAAGC 1074 >gb|M31680.1|MUSGHRBP UniGene infoGeoGene info Mouse low molecular weight growth hormone receptor/binding protein, complete cds Length=1150 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 1638 bits (1816), Expect = 0.0 Identities = 908/908 (100%), Gaps = 0/908 (0%) Strand=Plus/Plus Query 1 CGCACCAAGAAATAACCAGGAAACGTCTACAAAATTTCAACCCTAGCTTCTCTACCAGAT 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2 CGCACCAAGAAATAACCAGGAAACGTCTACAAAATTTCAACCCTAGCTTCTCTACCAGAT 61 Query 61 TTTAACTAAACGAGATCTTCTTGCAAAGGTCTCAGGTATGGATCTTTGTCAGGTCTTCTT 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 62 TTTAACTAAACGAGATCTTCTTGCAAAGGTCTCAGGTATGGATCTTTGTCAGGTCTTCTT 121 Query 121 AACCTTGGCACTGGCAGTCACCAGCAGCACATTTTCTGGAAGTGAGGCTACACCAGCTAC 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 122 AACCTTGGCACTGGCAGTCACCAGCAGCACATTTTCTGGAAGTGAGGCTACACCAGCTAC 181 Query 181 TCTTGGCAAAGCTTCCCCAGTTCTGCAAAGAATCAATCCAAGCCTGGGGACAAGTTCTTC 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 182 TCTTGGCAAAGCTTCCCCAGTTCTGCAAAGAATCAATCCAAGCCTGGGGACAAGTTCTTC 241 Query 241 TGGAAAGCCTCGATTCACCAAGTGTCGTTCCCCTGAACTGGAGACATTTTCATGCTACTG 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 242 TGGAAAGCCTCGATTCACCAAGTGTCGTTCCCCTGAACTGGAGACATTTTCATGCTACTG 301 Query 301 GACAGAAGGAGATAATCCTGATTTAAAGACCCCAGGATCTATTCAGCTGTACTATGCTAA 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 302 GACAGAAGGAGATAATCCTGATTTAAAGACCCCAGGATCTATTCAGCTGTACTATGCTAA 361 Query 361 AAGGGAAAGCCAACGACAAGCTGCAAGAATTGCTCATGAATGGACCCAGGAATGGAAAGA 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 362 AAGGGAAAGCCAACGACAAGCTGCAAGAATTGCTCATGAATGGACCCAGGAATGGAAAGA 421 Query 421 ATGCCCTGATTATGTCTCTGCTGGAAAAAACAGCTGTTACTTCAACTCATCATATACCTC 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 422 ATGCCCTGATTATGTCTCTGCTGGAAAAAACAGCTGTTACTTCAACTCATCATATACCTC 481 Query 481 CATTTGGATACCCTACTGCATCAAGCTAACTACAAATGGTGATTTGCTGGACCAAAAATG 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 482 CATTTGGATACCCTACTGCATCAAGCTAACTACAAATGGTGATTTGCTGGACCAAAAATG 541 Query 541 TTTCACTGTTGACGAAATAGTGCAACCTGATCCACCCATTGGCCTCAACTGGACTTTACT 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 542 TTTCACTGTTGACGAAATAGTGCAACCTGATCCACCCATTGGCCTCAACTGGACTTTACT 601 Query 601 AAACATTAGTTTGACCGGGATTCGTGGAGACATCCAAGTGAGTTGGCAACCACCACCCAA 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 602 AAACATTAGTTTGACCGGGATTCGTGGAGACATCCAAGTGAGTTGGCAACCACCACCCAA 661 Query 661 TGCAGATGTTCTGAAGGGATGGATAATTCTGGAGTATGAAATTCAGTACAAAGAAGTAAA 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 662 TGCAGATGTTCTGAAGGGATGGATAATTCTGGAGTATGAAATTCAGTACAAAGAAGTAAA 721 Query 721 TGAATCAAAATGGAAAGTGATGGGCCCTATATGGTTAACATACTGTCCAGTGTACTCATT 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 722 TGAATCAAAATGGAAAGTGATGGGCCCTATATGGTTAACATACTGTCCAGTGTACTCATT 781 Query 781 GAGAATGGATAAAGAACATGAAGTGCGGGTGAGATCCAGACAACGGAGCTTTGAAAAGTA 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 782 GAGAATGGATAAAGAACATGAAGTGCGGGTGAGATCCAGACAACGGAGCTTTGAAAAGTA 841 Query 841 CAGCGAGTTCAGCGAAGTCCTCCGTGTAATATTTCCTCAGACGAACATATTGGAAGCATG 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 842 CAGCGAGTTCAGCGAAGTCCTCCGTGTAATATTTCCTCAGACGAACATATTGGAAGCATG 901 Query 901 TGAAGAAG 908 |||||||| Sbjct 902 TGAAGAAG 909 Score = 293 bits (324), Expect = 1e-75 Identities = 162/162 (100%), Gaps = 0/162 (0%) Strand=Plus/Plus Query 907 AGGAACCAAGTCCAATTCTCAGCACCCACATCAAGAGATTGACAACCACCTGTATCACCA 966 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 989 AGGAACCAAGTCCAATTCTCAGCACCCACATCAAGAGATTGACAACCACCTGTATCACCA 1048 Query 967 GCTTCAGAGGATCCGCCATCCCTAGCCTTGTGGGCACCTGCATTCATATGCACATACATG 1026 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1049 GCTTCAGAGGATCCGCCATCCCTAGCCTTGTGGGCACCTGCATTCATATGCACATACATG 1108 Query 1027 CATACGCATAATTCAAAATAATAAAATAAAATTTTAAAAATT 1068 |||||||||||||||||||||||||||||||||||||||||| Sbjct 1109 CATACGCATAATTCAAAATAATAAAATAAAATTTTAAAAATT 1150 >dbj|AK143886.1| UniGene infoGene info Mus musculus adult male kidney cDNA, RIKEN full-length enriched library, clone:F520003E12 product:growth hormone receptor, full insert sequence Length=2750 Score = 1487 bits (1648), Expect = 0.0 Identities = 824/824 (100%), Gaps = 0/824 (0%) Strand=Plus/Plus Query 85 AAAGGTCTCAGGTATGGATCTTTGTCAGGTCTTCTTAACCTTGGCACTGGCAGTCACCAG 144 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 52 AAAGGTCTCAGGTATGGATCTTTGTCAGGTCTTCTTAACCTTGGCACTGGCAGTCACCAG 111 Query 145 CAGCACATTTTCTGGAAGTGAGGCTACACCAGCTACTCTTGGCAAAGCTTCCCCAGTTCT 204 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 112 CAGCACATTTTCTGGAAGTGAGGCTACACCAGCTACTCTTGGCAAAGCTTCCCCAGTTCT 171 Query 205 GCAAAGAATCAATCCAAGCCTGGGGACAAGTTCTTCTGGAAAGCCTCGATTCACCAAGTG 264 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 172 GCAAAGAATCAATCCAAGCCTGGGGACAAGTTCTTCTGGAAAGCCTCGATTCACCAAGTG 231 Query 265 TCGTTCCCCTGAACTGGAGACATTTTCATGCTACTGGACAGAAGGAGATAATCCTGATTT 324 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 232 TCGTTCCCCTGAACTGGAGACATTTTCATGCTACTGGACAGAAGGAGATAATCCTGATTT 291 Query 325 AAAGACCCCAGGATCTATTCAGCTGTACTATGCTAAAAGGGAAAGCCAACGACAAGCTGC 384 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 292 AAAGACCCCAGGATCTATTCAGCTGTACTATGCTAAAAGGGAAAGCCAACGACAAGCTGC 351 Query 385 AAGAATTGCTCATGAATGGACCCAGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGG 444 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 352 AAGAATTGCTCATGAATGGACCCAGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGG 411 Query 445 AAAAAACAGCTGTTACTTCAACTCATCATATACCTCCATTTGGATACCCTACTGCATCAA 504 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 412 AAAAAACAGCTGTTACTTCAACTCATCATATACCTCCATTTGGATACCCTACTGCATCAA 471 Query 505 GCTAACTACAAATGGTGATTTGCTGGACCAAAAATGTTTCACTGTTGACGAAATAGTGCA 564 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 472 GCTAACTACAAATGGTGATTTGCTGGACCAAAAATGTTTCACTGTTGACGAAATAGTGCA 531 Query 565 ACCTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGGGATTCG 624 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 532 ACCTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGGGATTCG 591 Query 625 TGGAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGGATGGAT 684 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 592 TGGAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGGATGGAT 651 Query 685 AATTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGTGATGGG 744 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 652 AATTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGTGATGGG 711 Query 745 CCCTATATGGTTAACATACTGTCCAGTGTACTCATTGAGAATGGATAAAGAACATGAAGT 804 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 712 CCCTATATGGTTAACATACTGTCCAGTGTACTCATTGAGAATGGATAAAGAACATGAAGT 771 Query 805 GCGGGTGAGATCCAGACAACGGAGCTTTGAAAAGTACAGCGAGTTCAGCGAAGTCCTCCG 864 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 772 GCGGGTGAGATCCAGACAACGGAGCTTTGAAAAGTACAGCGAGTTCAGCGAAGTCCTCCG 831 Query 865 TGTAATATTTCCTCAGACGAACATATTGGAAGCATGTGAAGAAG 908 |||||||||||||||||||||||||||||||||||||||||||| Sbjct 832 TGTAATATTTCCTCAGACGAACATATTGGAAGCATGTGAAGAAG 875 >ref|NM_010284.2| UniGene infoGeoGene info Mus musculus growth hormone receptor (Ghr), transcript variant 1, mRNA Length=4178 Score = 1483 bits (1644), Expect = 0.0 Identities = 822/822 (100%), Gaps = 0/822 (0%) Strand=Plus/Plus Query 87 AGGTCTCAGGTATGGATCTTTGTCAGGTCTTCTTAACCTTGGCACTGGCAGTCACCAGCA 146 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 230 AGGTCTCAGGTATGGATCTTTGTCAGGTCTTCTTAACCTTGGCACTGGCAGTCACCAGCA 289 Query 147 GCACATTTTCTGGAAGTGAGGCTACACCAGCTACTCTTGGCAAAGCTTCCCCAGTTCTGC 206 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 290 GCACATTTTCTGGAAGTGAGGCTACACCAGCTACTCTTGGCAAAGCTTCCCCAGTTCTGC 349 Query 207 AAAGAATCAATCCAAGCCTGGGGACAAGTTCTTCTGGAAAGCCTCGATTCACCAAGTGTC 266 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 350 AAAGAATCAATCCAAGCCTGGGGACAAGTTCTTCTGGAAAGCCTCGATTCACCAAGTGTC 409 Query 267 GTTCCCCTGAACTGGAGACATTTTCATGCTACTGGACAGAAGGAGATAATCCTGATTTAA 326 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 410 GTTCCCCTGAACTGGAGACATTTTCATGCTACTGGACAGAAGGAGATAATCCTGATTTAA 469 Query 327 AGACCCCAGGATCTATTCAGCTGTACTATGCTAAAAGGGAAAGCCAACGACAAGCTGCAA 386 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 470 AGACCCCAGGATCTATTCAGCTGTACTATGCTAAAAGGGAAAGCCAACGACAAGCTGCAA 529 Query 387 GAATTGCTCATGAATGGACCCAGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAA 446 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 530 GAATTGCTCATGAATGGACCCAGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAA 589 Query 447 AAAACAGCTGTTACTTCAACTCATCATATACCTCCATTTGGATACCCTACTGCATCAAGC 506 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 590 AAAACAGCTGTTACTTCAACTCATCATATACCTCCATTTGGATACCCTACTGCATCAAGC 649 Query 507 TAACTACAAATGGTGATTTGCTGGACCAAAAATGTTTCACTGTTGACGAAATAGTGCAAC 566 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 650 TAACTACAAATGGTGATTTGCTGGACCAAAAATGTTTCACTGTTGACGAAATAGTGCAAC 709 Query 567 CTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGGGATTCGTG 626 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 710 CTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGGGATTCGTG 769 Query 627 GAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGGATGGATAA 686 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 770 GAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGGATGGATAA 829 Query 687 TTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGTGATGGGCC 746 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 830 TTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGTGATGGGCC 889 Query 747 CTATATGGTTAACATACTGTCCAGTGTACTCATTGAGAATGGATAAAGAACATGAAGTGC 806 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 890 CTATATGGTTAACATACTGTCCAGTGTACTCATTGAGAATGGATAAAGAACATGAAGTGC 949 Query 807 GGGTGAGATCCAGACAACGGAGCTTTGAAAAGTACAGCGAGTTCAGCGAAGTCCTCCGTG 866 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 950 GGGTGAGATCCAGACAACGGAGCTTTGAAAAGTACAGCGAGTTCAGCGAAGTCCTCCGTG 1009 Query 867 TAATATTTCCTCAGACGAACATATTGGAAGCATGTGAAGAAG 908 |||||||||||||||||||||||||||||||||||||||||| Sbjct 1010 TAATATTTCCTCAGACGAACATATTGGAAGCATGTGAAGAAG 1051 >dbj|AK143925.1| UniGene infoGene info Mus musculus adult male kidney cDNA, RIKEN full-length enriched library, clone:F520015N09 product:growth hormone receptor, full insert sequence Length=3926 Score = 1483 bits (1644), Expect = 0.0 Identities = 822/822 (100%), Gaps = 0/822 (0%) Strand=Plus/Plus Query 87 AGGTCTCAGGTATGGATCTTTGTCAGGTCTTCTTAACCTTGGCACTGGCAGTCACCAGCA 146 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 150 AGGTCTCAGGTATGGATCTTTGTCAGGTCTTCTTAACCTTGGCACTGGCAGTCACCAGCA 209 Query 147 GCACATTTTCTGGAAGTGAGGCTACACCAGCTACTCTTGGCAAAGCTTCCCCAGTTCTGC 206 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 210 GCACATTTTCTGGAAGTGAGGCTACACCAGCTACTCTTGGCAAAGCTTCCCCAGTTCTGC 269 Query 207 AAAGAATCAATCCAAGCCTGGGGACAAGTTCTTCTGGAAAGCCTCGATTCACCAAGTGTC 266 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 270 AAAGAATCAATCCAAGCCTGGGGACAAGTTCTTCTGGAAAGCCTCGATTCACCAAGTGTC 329 Query 267 GTTCCCCTGAACTGGAGACATTTTCATGCTACTGGACAGAAGGAGATAATCCTGATTTAA 326 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 330 GTTCCCCTGAACTGGAGACATTTTCATGCTACTGGACAGAAGGAGATAATCCTGATTTAA 389 Query 327 AGACCCCAGGATCTATTCAGCTGTACTATGCTAAAAGGGAAAGCCAACGACAAGCTGCAA 386 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 390 AGACCCCAGGATCTATTCAGCTGTACTATGCTAAAAGGGAAAGCCAACGACAAGCTGCAA 449 Query 387 GAATTGCTCATGAATGGACCCAGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAA 446 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 450 GAATTGCTCATGAATGGACCCAGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAA 509 Query 447 AAAACAGCTGTTACTTCAACTCATCATATACCTCCATTTGGATACCCTACTGCATCAAGC 506 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 510 AAAACAGCTGTTACTTCAACTCATCATATACCTCCATTTGGATACCCTACTGCATCAAGC 569 Query 507 TAACTACAAATGGTGATTTGCTGGACCAAAAATGTTTCACTGTTGACGAAATAGTGCAAC 566 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 570 TAACTACAAATGGTGATTTGCTGGACCAAAAATGTTTCACTGTTGACGAAATAGTGCAAC 629 Query 567 CTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGGGATTCGTG 626 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 630 CTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGGGATTCGTG 689 Query 627 GAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGGATGGATAA 686 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 690 GAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGGATGGATAA 749 Query 687 TTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGTGATGGGCC 746 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 750 TTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGTGATGGGCC 809 Query 747 CTATATGGTTAACATACTGTCCAGTGTACTCATTGAGAATGGATAAAGAACATGAAGTGC 806 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 810 CTATATGGTTAACATACTGTCCAGTGTACTCATTGAGAATGGATAAAGAACATGAAGTGC 869 Query 807 GGGTGAGATCCAGACAACGGAGCTTTGAAAAGTACAGCGAGTTCAGCGAAGTCCTCCGTG 866 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 870 GGGTGAGATCCAGACAACGGAGCTTTGAAAAGTACAGCGAGTTCAGCGAAGTCCTCCGTG 929 Query 867 TAATATTTCCTCAGACGAACATATTGGAAGCATGTGAAGAAG 908 |||||||||||||||||||||||||||||||||||||||||| Sbjct 930 TAATATTTCCTCAGACGAACATATTGGAAGCATGTGAAGAAG 971 >gb|BC075720.1| UniGene infoGeoGene info Mus musculus growth hormone receptor, mRNA (cDNA clone MGC:78163 IMAGE:5044060), complete cds Length=4180 Score = 1478 bits (1638), Expect = 0.0 Identities = 821/822 (99%), Gaps = 0/822 (0%) Strand=Plus/Plus Query 87 AGGTCTCAGGTATGGATCTTTGTCAGGTCTTCTTAACCTTGGCACTGGCAGTCACCAGCA 146 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 200 AGGTCTCAGGTATGGATCTTTGTCAGGTCTTCTTAACCTTGGCACTGGCAGTCACCAGCA 259 Query 147 GCACATTTTCTGGAAGTGAGGCTACACCAGCTACTCTTGGCAAAGCTTCCCCAGTTCTGC 206 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 260 GCACATTTTCTGGAAGTGAGGCTACACCAGCTACTCTTGGCAAAGCTTCCCCAGTTCTGC 319 Query 207 AAAGAATCAATCCAAGCCTGGGGACAAGTTCTTCTGGAAAGCCTCGATTCACCAAGTGTC 266 ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| Sbjct 320 AAAGAATCAATCCAAGCCTGGGGACAAGTTCTTCTGGGAAGCCTCGATTCACCAAGTGTC 379 Query 267 GTTCCCCTGAACTGGAGACATTTTCATGCTACTGGACAGAAGGAGATAATCCTGATTTAA 326 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 380 GTTCCCCTGAACTGGAGACATTTTCATGCTACTGGACAGAAGGAGATAATCCTGATTTAA 439 Query 327 AGACCCCAGGATCTATTCAGCTGTACTATGCTAAAAGGGAAAGCCAACGACAAGCTGCAA 386 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 440 AGACCCCAGGATCTATTCAGCTGTACTATGCTAAAAGGGAAAGCCAACGACAAGCTGCAA 499 Query 387 GAATTGCTCATGAATGGACCCAGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAA 446 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 500 GAATTGCTCATGAATGGACCCAGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAA 559 Query 447 AAAACAGCTGTTACTTCAACTCATCATATACCTCCATTTGGATACCCTACTGCATCAAGC 506 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 560 AAAACAGCTGTTACTTCAACTCATCATATACCTCCATTTGGATACCCTACTGCATCAAGC 619 Query 507 TAACTACAAATGGTGATTTGCTGGACCAAAAATGTTTCACTGTTGACGAAATAGTGCAAC 566 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 620 TAACTACAAATGGTGATTTGCTGGACCAAAAATGTTTCACTGTTGACGAAATAGTGCAAC 679 Query 567 CTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGGGATTCGTG 626 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 680 CTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGGGATTCGTG 739 Query 627 GAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGGATGGATAA 686 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 740 GAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGGATGGATAA 799 Query 687 TTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGTGATGGGCC 746 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 800 TTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGTGATGGGCC 859 Query 747 CTATATGGTTAACATACTGTCCAGTGTACTCATTGAGAATGGATAAAGAACATGAAGTGC 806 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 860 CTATATGGTTAACATACTGTCCAGTGTACTCATTGAGAATGGATAAAGAACATGAAGTGC 919 Query 807 GGGTGAGATCCAGACAACGGAGCTTTGAAAAGTACAGCGAGTTCAGCGAAGTCCTCCGTG 866 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 920 GGGTGAGATCCAGACAACGGAGCTTTGAAAAGTACAGCGAGTTCAGCGAAGTCCTCCGTG 979 Query 867 TAATATTTCCTCAGACGAACATATTGGAAGCATGTGAAGAAG 908 |||||||||||||||||||||||||||||||||||||||||| Sbjct 980 TAATATTTCCTCAGACGAACATATTGGAAGCATGTGAAGAAG 1021 >gb|BC127501.1| UniGene info Rattus norvegicus cDNA clone MGC:156665 IMAGE:8375548, complete cds Length=1232 Score = 1323 bits (1466), Expect = 0.0 Identities = 889/995 (89%), Gaps = 26/995 (2%) Strand=Plus/Plus Query 87 AGGTCTCAGGTATGGATCTTTGTCAGGTCTTCTTAACCTTGGCACTGGCAGTCACCAGCA 146 |||||||||||||||||||||| | ||| ||||||||| |||||||||||||| ||||| Sbjct 221 AGGTCTCAGGTATGGATCTTTGGCGGGTGTTCTTAACCCTGGCACTGGCAGTCTCCAGCG 280 Query 147 GCACATTTTCTGGAAGTGAGGCTACACCAGCTACTCTTGGCAAAGCTTCCCCAGTTCTGC 206 || ||| ||||||||| ||||||||||||||||||||||||||||||||| ||||||| Sbjct 281 ACATGTTTCCTGGAAGTGGGGCTACACCAGCTACTCTTGGCAAAGCTTCCCCGGTTCTGC 340 Query 207 AAAGAATCAATCCAAGCCTGGGGACAAGTTCTTCTGGAAAGCCTCGATTCACCAAGTGTC 266 ||||||| |||||||||||| || |||||| |||||||||||||||||||||||||||| Sbjct 341 AAAGAATTAATCCAAGCCTGAGGGAAAGTTCCTCTGGAAAGCCTCGATTCACCAAGTGTC 400 Query 267 GTTCCCCTGAACTGGAGACATTTTCATGCTACTGGACAGAAGGAGATAATCCTGATTTAA 326 ||||||||||||||||||| ||||||||||||||||||||||| ||| ||| | |||||| Sbjct 401 GTTCCCCTGAACTGGAGACCTTTTCATGCTACTGGACAGAAGGGGATGATCATAATTTAA 460 Query 327 AGACCCCAGGATCTATTCAGCTGTACTATGCTAAAAGGGAAAGCCAACGACAAGCTGCAA 386 || ||| |||||||||||||| ||||||||| || || Sbjct 461 AGGTCCCGGGATCTATTCAGCTATACTATGCT--------------------AG----AA 496 Query 387 GAATTGCTCATGAATGGACCCAGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAA 446 ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct 497 GAATTGCTCATGAATGGACCCCGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAG 556 Query 447 AAAACAGCTGTTACTTCAACTCATCATATACCTCCATTTGGATACCCTACTGCATCAAGC 506 |||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| Sbjct 557 CAAACAGCTGTTACTTCAACTCATCGTATACCTCCATTTGGATACCCTACTGCATTAAGC 616 Query 507 TAACTACAAATGGTGATTTGCTGGACCAAAAATGTTTCACTGTTGACGAAATAGTGCAAC 566 | |||||||||||||||||| ||||| |||| |||||||||||||| ||||||||||||| Sbjct 617 TTACTACAAATGGTGATTTGTTGGACGAAAAGTGTTTCACTGTTGATGAAATAGTGCAAC 676 Query 567 CTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGGGATTCGTG 626 ||||||| |||||||||||||||||||||||||||||||| |||||| | ||||| |||| Sbjct 677 CTGATCCGCCCATTGGCCTCAACTGGACTTTACTAAACATCAGTTTGCCTGGGATCCGTG 736 Query 627 GAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGGATGGATAA 686 |||| ||||||||||||||||| ||||| |||| ||| |||||||||||||||||||||| Sbjct 737 GAGATATCCAAGTGAGTTGGCAGCCACCGCCCAGTGCCGATGTTCTGAAGGGATGGATAA 796 Query 687 TTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGTGATGGGCC 746 |||||||||||||||||||||||||||||||||||||| ||||||||||| |||| ||| Sbjct 797 TTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGAAACAAAATGGAAAACGATGAGCC 856 Query 747 CTATATGGTTAACATACTGT-CCAGTGTACTCATTGAGAATGGATAAAGAACATGAAGTG 805 | ||||||| ||||| | || ||| |||||||| ||||| |||||||||| || |||||| Sbjct 857 CGATATGGTCAACAT-CAGTCCCACTGTACTCACTGAGACTGGATAAAGAGCACGAAGTG 915 Query 806 CGGGTGAGATCCAGACAACGGAGCTTTGAAAAGTACAGCGAGTTCAGCGAAGTCCTCCGT 865 || ||||||||||||||||||||||| |||||||||||||||||||| ||||| |||||| Sbjct 916 CGTGTGAGATCCAGACAACGGAGCTTCGAAAAGTACAGCGAGTTCAGTGAAGTACTCCGT 975 Query 866 GTAATATTTCCTCAGACGAACATATTGGAAGCATGTGAAGAAGGAACCAAGTCCAATTCT 925 |||| |||||||||| | ||| | ||| |||||||||||||||| |||||| |||||| Sbjct 976 GTAACGTTTCCTCAGATGGACACACTGGCAGCATGTGAAGAAGGACCCAAGTTCAATTCC 1035 Query 926 CAGCACCCACATCAAGAGATTGACAACCACCTGTATCACCAGCTTCAGAGGATCCGCCAT 985 ||||||||||||||||||||||||||||||||||| |||||||| ||||||||| ||||| Sbjct 1036 CAGCACCCACATCAAGAGATTGACAACCACCTGTAACACCAGCTCCAGAGGATCTGCCAT 1095 Query 986 CCCTAGCCTTGTGGGCACCTGCATTCATATGCACATACATGCATACGCATAATTCaaaat 1045 ||||||||||| |||||||||||||||||||||||||||||||||| ||||||| ||| | Sbjct 1096 CCCTAGCCTTGCGGGCACCTGCATTCATATGCACATACATGCATACACATAATTAAAATT 1155 Query 1046 aataaaataaaattttaaaaattaaaaaaaaaaaa 1080 |||||||||||||||||||||| |||||||||||| Sbjct 1156 AATAAAATAAAATTTTAAAAATAAAAAAAAAAAAA 1190 >gb|BC103659.1| UniGene infoGene info Rattus norvegicus growth hormone receptor, mRNA (cDNA clone IMAGE:7325614), complete cds Length=1124 Score = 1323 bits (1466), Expect = 0.0 Identities = 889/995 (89%), Gaps = 26/995 (2%) Strand=Plus/Plus Query 87 AGGTCTCAGGTATGGATCTTTGTCAGGTCTTCTTAACCTTGGCACTGGCAGTCACCAGCA 146 |||||||||||||||||||||| | ||| ||||||||| |||||||||||||| ||||| Sbjct 142 AGGTCTCAGGTATGGATCTTTGGCGGGTGTTCTTAACCCTGGCACTGGCAGTCTCCAGCG 201 Query 147 GCACATTTTCTGGAAGTGAGGCTACACCAGCTACTCTTGGCAAAGCTTCCCCAGTTCTGC 206 || ||| ||||||||| ||||||||||||||||||||||||||||||||| ||||||| Sbjct 202 ACATGTTTCCTGGAAGTGGGGCTACACCAGCTACTCTTGGCAAAGCTTCCCCGGTTCTGC 261 Query 207 AAAGAATCAATCCAAGCCTGGGGACAAGTTCTTCTGGAAAGCCTCGATTCACCAAGTGTC 266 ||||||| |||||||||||| || |||||| |||||||||||||||||||||||||||| Sbjct 262 AAAGAATTAATCCAAGCCTGAGGGAAAGTTCCTCTGGAAAGCCTCGATTCACCAAGTGTC 321 Query 267 GTTCCCCTGAACTGGAGACATTTTCATGCTACTGGACAGAAGGAGATAATCCTGATTTAA 326 ||||||||||||||||||| ||||||||||||||||||||||| ||| ||| | |||||| Sbjct 322 GTTCCCCTGAACTGGAGACCTTTTCATGCTACTGGACAGAAGGGGATGATCATAATTTAA 381 Query 327 AGACCCCAGGATCTATTCAGCTGTACTATGCTAAAAGGGAAAGCCAACGACAAGCTGCAA 386 || ||| |||||||||||||| ||||||||| || || Sbjct 382 AGGTCCCGGGATCTATTCAGCTATACTATGCT--------------------AG----AA 417 Query 387 GAATTGCTCATGAATGGACCCAGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAA 446 ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct 418 GAATTGCTCATGAATGGACCCCGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAG 477 Query 447 AAAACAGCTGTTACTTCAACTCATCATATACCTCCATTTGGATACCCTACTGCATCAAGC 506 |||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| Sbjct 478 CAAACAGCTGTTACTTCAACTCATCGTATACCTCCATTTGGATACCCTACTGCATTAAGC 537 Query 507 TAACTACAAATGGTGATTTGCTGGACCAAAAATGTTTCACTGTTGACGAAATAGTGCAAC 566 | |||||||||||||||||| ||||| |||| |||||||||||||| ||||||||||||| Sbjct 538 TTACTACAAATGGTGATTTGTTGGACGAAAAGTGTTTCACTGTTGATGAAATAGTGCAAC 597 Query 567 CTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGGGATTCGTG 626 ||||||| |||||||||||||||||||||||||||||||| |||||| | ||||| |||| Sbjct 598 CTGATCCGCCCATTGGCCTCAACTGGACTTTACTAAACATCAGTTTGCCTGGGATCCGTG 657 Query 627 GAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGGATGGATAA 686 |||| ||||||||||||||||| ||||| |||| ||| |||||||||||||||||||||| Sbjct 658 GAGATATCCAAGTGAGTTGGCAGCCACCGCCCAGTGCCGATGTTCTGAAGGGATGGATAA 717 Query 687 TTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGTGATGGGCC 746 |||||||||||||||||||||||||||||||||||||| ||||||||||| |||| ||| Sbjct 718 TTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGAAACAAAATGGAAAACGATGAGCC 777 Query 747 CTATATGGTTAACATACTGT-CCAGTGTACTCATTGAGAATGGATAAAGAACATGAAGTG 805 | ||||||| ||||| | || ||| |||||||| ||||| |||||||||| || |||||| Sbjct 778 CGATATGGTCAACAT-CAGTCCCACTGTACTCACTGAGACTGGATAAAGAGCACGAAGTG 836 Query 806 CGGGTGAGATCCAGACAACGGAGCTTTGAAAAGTACAGCGAGTTCAGCGAAGTCCTCCGT 865 || ||||||||||||||||||||||| |||||||||||||||||||| ||||| |||||| Sbjct 837 CGTGTGAGATCCAGACAACGGAGCTTCGAAAAGTACAGCGAGTTCAGTGAAGTACTCCGT 896 Query 866 GTAATATTTCCTCAGACGAACATATTGGAAGCATGTGAAGAAGGAACCAAGTCCAATTCT 925 |||| |||||||||| | ||| | ||| |||||||||||||||| |||||| |||||| Sbjct 897 GTAACGTTTCCTCAGATGGACACACTGGCAGCATGTGAAGAAGGACCCAAGTTCAATTCC 956 Query 926 CAGCACCCACATCAAGAGATTGACAACCACCTGTATCACCAGCTTCAGAGGATCCGCCAT 985 ||||||||||||||||||||||||||||||||||| |||||||| ||||||||| ||||| Sbjct 957 CAGCACCCACATCAAGAGATTGACAACCACCTGTAACACCAGCTCCAGAGGATCTGCCAT 1016 Query 986 CCCTAGCCTTGTGGGCACCTGCATTCATATGCACATACATGCATACGCATAATTCaaaat 1045 ||||||||||| |||||||||||||||||||||||||||||||||| ||||||| ||| | Sbjct 1017 CCCTAGCCTTGCGGGCACCTGCATTCATATGCACATACATGCATACACATAATTAAAATT 1076 Query 1046 aataaaataaaattttaaaaattaaaaaaaaaaaa 1080 |||||||||||||||||||||| |||||||||||| Sbjct 1077 AATAAAATAAAATTTTAAAAATAAAAAAAAAAAAA 1111 >gb|BC086591.1| UniGene infoGene info Rattus norvegicus growth hormone receptor, mRNA (cDNA clone IMAGE:7310431), complete cds Length=1145 Score = 1323 bits (1466), Expect = 0.0 Identities = 889/995 (89%), Gaps = 26/995 (2%) Strand=Plus/Plus Query 87 AGGTCTCAGGTATGGATCTTTGTCAGGTCTTCTTAACCTTGGCACTGGCAGTCACCAGCA 146 |||||||||||||||||||||| | ||| ||||||||| |||||||||||||| ||||| Sbjct 163 AGGTCTCAGGTATGGATCTTTGGCGGGTGTTCTTAACCCTGGCACTGGCAGTCTCCAGCG 222 Query 147 GCACATTTTCTGGAAGTGAGGCTACACCAGCTACTCTTGGCAAAGCTTCCCCAGTTCTGC 206 || ||| ||||||||| ||||||||||||||||||||||||||||||||| ||||||| Sbjct 223 ACATGTTTCCTGGAAGTGGGGCTACACCAGCTACTCTTGGCAAAGCTTCCCCGGTTCTGC 282 Query 207 AAAGAATCAATCCAAGCCTGGGGACAAGTTCTTCTGGAAAGCCTCGATTCACCAAGTGTC 266 ||||||| |||||||||||| || |||||| |||||||||||||||||||||||||||| Sbjct 283 AAAGAATTAATCCAAGCCTGAGGGAAAGTTCCTCTGGAAAGCCTCGATTCACCAAGTGTC 342 Query 267 GTTCCCCTGAACTGGAGACATTTTCATGCTACTGGACAGAAGGAGATAATCCTGATTTAA 326 ||||||||||||||||||| ||||||||||||||||||||||| ||| ||| | |||||| Sbjct 343 GTTCCCCTGAACTGGAGACCTTTTCATGCTACTGGACAGAAGGGGATGATCATAATTTAA 402 Query 327 AGACCCCAGGATCTATTCAGCTGTACTATGCTAAAAGGGAAAGCCAACGACAAGCTGCAA 386 || ||| |||||||||||||| ||||||||| || || Sbjct 403 AGGTCCCGGGATCTATTCAGCTATACTATGCT--------------------AG----AA 438 Query 387 GAATTGCTCATGAATGGACCCAGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAA 446 ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct 439 GAATTGCTCATGAATGGACCCCGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAG 498 Query 447 AAAACAGCTGTTACTTCAACTCATCATATACCTCCATTTGGATACCCTACTGCATCAAGC 506 |||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| Sbjct 499 CAAACAGCTGTTACTTCAACTCATCGTATACCTCCATTTGGATACCCTACTGCATTAAGC 558 Query 507 TAACTACAAATGGTGATTTGCTGGACCAAAAATGTTTCACTGTTGACGAAATAGTGCAAC 566 | |||||||||||||||||| ||||| |||| |||||||||||||| ||||||||||||| Sbjct 559 TTACTACAAATGGTGATTTGTTGGACGAAAAGTGTTTCACTGTTGATGAAATAGTGCAAC 618 Query 567 CTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGGGATTCGTG 626 ||||||| |||||||||||||||||||||||||||||||| |||||| | ||||| |||| Sbjct 619 CTGATCCGCCCATTGGCCTCAACTGGACTTTACTAAACATCAGTTTGCCTGGGATCCGTG 678 Query 627 GAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGGATGGATAA 686 |||| ||||||||||||||||| ||||| |||| ||| |||||||||||||||||||||| Sbjct 679 GAGATATCCAAGTGAGTTGGCAGCCACCGCCCAGTGCCGATGTTCTGAAGGGATGGATAA 738 Query 687 TTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGTGATGGGCC 746 |||||||||||||||||||||||||||||||||||||| ||||||||||| |||| ||| Sbjct 739 TTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGAAACAAAATGGAAAACGATGAGCC 798 Query 747 CTATATGGTTAACATACTGT-CCAGTGTACTCATTGAGAATGGATAAAGAACATGAAGTG 805 | ||||||| ||||| | || ||| |||||||| ||||| |||||||||| || |||||| Sbjct 799 CGATATGGTCAACAT-CAGTCCCACTGTACTCACTGAGACTGGATAAAGAGCACGAAGTG 857 Query 806 CGGGTGAGATCCAGACAACGGAGCTTTGAAAAGTACAGCGAGTTCAGCGAAGTCCTCCGT 865 || ||||||||||||||||||||||| |||||||||||||||||||| ||||| |||||| Sbjct 858 CGTGTGAGATCCAGACAACGGAGCTTCGAAAAGTACAGCGAGTTCAGTGAAGTACTCCGT 917 Query 866 GTAATATTTCCTCAGACGAACATATTGGAAGCATGTGAAGAAGGAACCAAGTCCAATTCT 925 |||| |||||||||| | ||| | ||| |||||||||||||||| |||||| |||||| Sbjct 918 GTAACGTTTCCTCAGATGGACACACTGGCAGCATGTGAAGAAGGACCCAAGTTCAATTCC 977 Query 926 CAGCACCCACATCAAGAGATTGACAACCACCTGTATCACCAGCTTCAGAGGATCCGCCAT 985 ||||||||||||||||||||||||||||||||||| |||||||| ||||||||| ||||| Sbjct 978 CAGCACCCACATCAAGAGATTGACAACCACCTGTAACACCAGCTCCAGAGGATCTGCCAT 1037 Query 986 CCCTAGCCTTGTGGGCACCTGCATTCATATGCACATACATGCATACGCATAATTCaaaat 1045 ||||||||||| |||||||||||||||||||||||||||||||||| ||||||| ||| | Sbjct 1038 CCCTAGCCTTGCGGGCACCTGCATTCATATGCACATACATGCATACACATAATTAAAATT 1097 Query 1046 aataaaataaaattttaaaaattaaaaaaaaaaaa 1080 |||||||||||||||||||||| |||||||||||| Sbjct 1098 AATAAAATAAAATTTTAAAAATAAAAAAAAAAAAA 1132 >gb|S49003.1| Geo short isoform growth hormone receptor [rats, mRNA, 1136 nt] Length=1136 Score = 1303 bits (1444), Expect = 0.0 Identities = 877/982 (89%), Gaps = 26/982 (2%) Strand=Plus/Plus Query 87 AGGTCTCAGGTATGGATCTTTGTCAGGTCTTCTTAACCTTGGCACTGGCAGTCACCAGCA 146 |||||||||||||||||||||| | ||| ||||||||| |||||||||||||| ||||| Sbjct 180 AGGTCTCAGGTATGGATCTTTGGCGGGTGTTCTTAACCCTGGCACTGGCAGTCTCCAGCG 239 Query 147 GCACATTTTCTGGAAGTGAGGCTACACCAGCTACTCTTGGCAAAGCTTCCCCAGTTCTGC 206 || ||| ||||||||| ||||||||||||||||||||||||||||||||| ||||||| Sbjct 240 ACATGTTTCCTGGAAGTGGGGCTACACCAGCTACTCTTGGCAAAGCTTCCCCGGTTCTGC 299 Query 207 AAAGAATCAATCCAAGCCTGGGGACAAGTTCTTCTGGAAAGCCTCGATTCACCAAGTGTC 266 ||||||| |||||||||||| || |||||| |||||||||||||||||||||||||||| Sbjct 300 AAAGAATTAATCCAAGCCTGAGGGAAAGTTCCTCTGGAAAGCCTCGATTCACCAAGTGTC 359 Query 267 GTTCCCCTGAACTGGAGACATTTTCATGCTACTGGACAGAAGGAGATAATCCTGATTTAA 326 ||||||||||||||||||| ||||||||||||||||||||||| ||| ||| | |||||| Sbjct 360 GTTCCCCTGAACTGGAGACCTTTTCATGCTACTGGACAGAAGGGGATGATCATAATTTAA 419 Query 327 AGACCCCAGGATCTATTCAGCTGTACTATGCTAAAAGGGAAAGCCAACGACAAGCTGCAA 386 || ||| |||||||||||||| ||||||||| || || Sbjct 420 AGGTCCCGGGATCTATTCAGCTATACTATGCT--------------------AG----AA 455 Query 387 GAATTGCTCATGAATGGACCCAGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAA 446 ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct 456 GAATTGCTCATGAATGGACCCCGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAG 515 Query 447 AAAACAGCTGTTACTTCAACTCATCATATACCTCCATTTGGATACCCTACTGCATCAAGC 506 |||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| Sbjct 516 CAAACAGCTGTTACTTCAACTCATCGTATACCTCCATTTGGATACCCTACTGCATTAAGC 575 Query 507 TAACTACAAATGGTGATTTGCTGGACCAAAAATGTTTCACTGTTGACGAAATAGTGCAAC 566 | |||||||||||||||||| ||||| |||| |||||||||||||| ||||||||||||| Sbjct 576 TTACTACAAATGGTGATTTGTTGGACGAAAAGTGTTTCACTGTTGATGAAATAGTGCAAC 635 Query 567 CTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGGGATTCGTG 626 ||||||| |||||||||||||||||||||||||||||||| |||||| | ||||| |||| Sbjct 636 CTGATCCGCCCATTGGCCTCAACTGGACTTTACTAAACATCAGTTTGCCTGGGATCCGTG 695 Query 627 GAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGGATGGATAA 686 |||| ||||||||||||||||| ||||| |||| ||| |||||||||||||||||||||| Sbjct 696 GAGATATCCAAGTGAGTTGGCAGCCACCGCCCAGTGCCGATGTTCTGAAGGGATGGATAA 755 Query 687 TTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGTGATGGGCC 746 |||||||||||||||||||||||||||||||||||||| ||||||||||| |||| ||| Sbjct 756 TTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGAAACAAAATGGAAAACGATGAGCC 815 Query 747 CTATATGGTTAACATACTGT-CCAGTGTACTCATTGAGAATGGATAAAGAACATGAAGTG 805 | ||||||| ||||| | || ||| |||||||| ||||| |||||||||| || |||||| Sbjct 816 CGATATGGTCAACAT-CAGTCCCACTGTACTCACTGAGACTGGATAAAGAGCACGAAGTG 874 Query 806 CGGGTGAGATCCAGACAACGGAGCTTTGAAAAGTACAGCGAGTTCAGCGAAGTCCTCCGT 865 || ||||||||||||||||||||||| |||||||||||||||||||| ||||| |||||| Sbjct 875 CGTGTGAGATCCAGACAACGGAGCTTCGAAAAGTACAGCGAGTTCAGTGAAGTACTCCGT 934 Query 866 GTAATATTTCCTCAGACGAACATATTGGAAGCATGTGAAGAAGGAACCAAGTCCAATTCT 925 |||| |||||||||| | ||| | ||| |||||||||||||||| |||||| |||||| Sbjct 935 GTAACGTTTCCTCAGATGGACACACTGGCAGCATGTGAAGAAGGACCCAAGTTCAATTCC 994 Query 926 CAGCACCCACATCAAGAGATTGACAACCACCTGTATCACCAGCTTCAGAGGATCCGCCAT 985 ||||||||||||||||||||||||||||||||||| |||||||| ||||||||| ||||| Sbjct 995 CAGCACCCACATCAAGAGATTGACAACCACCTGTAACACCAGCTCCAGAGGATCTGCCAT 1054 Query 986 CCCTAGCCTTGTGGGCACCTGCATTCATATGCACATACATGCATACGCATAATTCAAAAT 1045 ||||||||||| |||||||||||||||||||||||||||||||||| ||||||| ||| | Sbjct 1055 CCCTAGCCTTGCGGGCACCTGCATTCATATGCACATACATGCATACACATAATTAAAATT 1114 Query 1046 AATAAAATAAAATTTTAAAAAT 1067 |||||||||||||||||||||| Sbjct 1115 AATAAAATAAAATTTTAAAAAT 1136 >ref|NM_017094.1| UniGene infoGeoGene info Rattus norvegicus growth hormone receptor (Ghr), mRNA gb|J04811.1|RATGHR UniGene infoGeoGene info Rat growth hormone receptor mRNA, complete cds Length=2950 Score = 1173 bits (1300), Expect = 0.0 Identities = 804/907 (88%), Gaps = 31/907 (3%) Strand=Plus/Plus Query 3 CACCAAGAAATAACCAGGAAACGTCTACAAAATTTCAACCCTAGCTTCTCTACCAGATTT 62 |||||||||||||||| |||| ||||| |||||||||||||||||||||||||||| Sbjct 101 CACCAAGAAATAACCACGAAAT-TCTAC----TTTCAACCCTAGCTTCTCTACCAGATTT 155 Query 63 TAACTAAACGAGATCTTCTTGCAAAGGTCTCAGGTATGGATCTTTGTCAGGTCTTCTTAA 122 ||||||||| |||||||||||||||||||||||||||||||||||| | ||| ||||||| Sbjct 156 TAACTAAACAAGATCTTCTTGCAAAGGTCTCAGGTATGGATCTTTGGCGGGTGTTCTTAA 215 Query 123 CCTTGGCACTGGCAGTCACCAGCAGCACATTTTCTGGAAGTGAGGCTACACCAGCTACTC 182 || |||||||||||||| ||||| || ||| ||||||||| ||||||||||||||||| Sbjct 216 CCCTGGCACTGGCAGTCTCCAGCGACATGTTTCCTGGAAGTGGGGCTACACCAGCTACTC 275 Query 183 TTGGCAAAGCTTCCCCAGTTCTGCAAAGAATCAATCCAAGCCTGGGGACAAGTTCTTCTG 242 |||||||||||||||| |||||||||||||| |||||||||||| || |||||| |||| Sbjct 276 TTGGCAAAGCTTCCCCGGTTCTGCAAAGAATTAATCCAAGCCTGAGGGAAAGTTCCTCTG 335 Query 243 GAAAGCCTCGATTCACCAAGTGTCGTTCCCCTGAACTGGAGACATTTTCATGCTACTGGA 302 ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| Sbjct 336 GAAAGCCTCGATTCACCAAGTGTCGTTCCCCTGAACTGGAGACCTTTTCATGCTACTGGA 395 Query 303 CAGAAGGAGATAATCCTGATTTAAAGACCCCAGGATCTATTCAGCTGTACTATGCTAAAA 362 ||||||| ||| ||| | |||||||| ||| |||||||||||||| ||||||||| Sbjct 396 CAGAAGGGGATGATCATAATTTAAAGGTCCCGGGATCTATTCAGCTATACTATGCT---- 451 Query 363 GGGAAAGCCAACGACAAGCTGCAAGAATTGCTCATGAATGGACCCAGGAATGGAAAGAAT 422 || ||||||||||||||||||||||| |||||||||||||| Sbjct 452 ----------------AG----AAGAATTGCTCATGAATGGACCCCGGAATGGAAAGAAT 491 Query 423 GCCCTGATTATGTCTCTGCTGGAAAAAACAGCTGTTACTTCAACTCATCATATACCTCCA 482 ||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||| Sbjct 492 GCCCTGATTATGTCTCTGCTGGAGCAAACAGCTGTTACTTCAACTCATCGTATACCTCCA 551 Query 483 TTTGGATACCCTACTGCATCAAGCTAACTACAAATGGTGATTTGCTGGACCAAAAATGTT 542 ||||||||||||||||||| ||||| |||||||||||||||||| ||||| |||| |||| Sbjct 552 TTTGGATACCCTACTGCATTAAGCTTACTACAAATGGTGATTTGTTGGACGAAAAGTGTT 611 Query 543 TCACTGTTGACGAAATAGTGCAACCTGATCCACCCATTGGCCTCAACTGGACTTTACTAA 602 |||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||| Sbjct 612 TCACTGTTGATGAAATAGTGCAACCTGATCCGCCCATTGGCCTCAACTGGACTTTACTAA 671 Query 603 ACATTAGTTTGACCGGGATTCGTGGAGACATCCAAGTGAGTTGGCAACCACCACCCAATG 662 |||| |||||| | ||||| |||||||| ||||||||||||||||| ||||| |||| || Sbjct 672 ACATCAGTTTGCCTGGGATCCGTGGAGATATCCAAGTGAGTTGGCAGCCACCGCCCAGTG 731 Query 663 CAGATGTTCTGAAGGGATGGATAATTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATG 722 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 732 CCGATGTTCTGAAGGGATGGATAATTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATG 791 Query 723 AATCAAAATGGAAAGTGATGGGCCCTATATGGTTAACATACTGT-CCAGTGTACTCATTG 781 || ||||||||||| |||| |||| ||||||| ||||| | || ||| |||||||| || Sbjct 792 AAACAAAATGGAAAACGATGAGCCCGATATGGTCAACAT-CAGTCCCACTGTACTCACTG 850 Query 782 AGAATGGATAAAGAACATGAAGTGCGGGTGAGATCCAGACAACGGAGCTTTGAAAAGTAC 841 ||| |||||||||| || |||||||| ||||||||||||||||||||||| ||||||||| Sbjct 851 AGACTGGATAAAGAGCACGAAGTGCGTGTGAGATCCAGACAACGGAGCTTCGAAAAGTAC 910 Query 842 AGCGAGTTCAGCGAAGTCCTCCGTGTAATATTTCCTCAGACGAACATATTGGAAGCATGT 901 ||||||||||| ||||| |||||||||| |||||||||| | ||| | ||| ||||||| Sbjct 911 AGCGAGTTCAGTGAAGTACTCCGTGTAACGTTTCCTCAGATGGACACACTGGCAGCATGT 970 Query 902 GAAGAAG 908 ||||||| Sbjct 971 GAAGAAG 977 >emb|X16726.1|RRGHREC R.rattus RNA for GH receptor Length=2553 Score = 1061 bits (1176), Expect = 0.0 Identities = 728/823 (88%), Gaps = 26/823 (3%) Strand=Plus/Plus Query 87 AGGTCTCAGGTATGGATCTTTGTCAGGTCTTCTTAACCTTGGCACTGGCAGTCACCAGCA 146 |||||||||||||||||||||| | ||| ||||||||| |||||||||||||| ||||| Sbjct 1 AGGTCTCAGGTATGGATCTTTGGCGGGTGTTCTTAACCCTGGCACTGGCAGTCTCCAGCG 60 Query 147 GCACATTTTCTGGAAGTGAGGCTACACCAGCTACTCTTGGCAAAGCTTCCCCAGTTCTGC 206 || ||| ||||||||| ||||||||||||||||||||||||||||||||| ||||||| Sbjct 61 ACATGTTTCCTGGAAGTGGGGCTACACCAGCTACTCTTGGCAAAGCTTCCCCGGTTCTGC 120 Query 207 AAAGAATCAATCCAAGCCTGGGGACAAGTTCTTCTGGAAAGCCTCGATTCACCAAGTGTC 266 ||||||| |||||||||||| || |||||| |||||||||||||||||||||||||||| Sbjct 121 AAAGAATTAATCCAAGCCTGAGGGAAAGTTCCTCTGGAAAGCCTCGATTCACCAAGTGTC 180 Query 267 GTTCCCCTGAACTGGAGACATTTTCATGCTACTGGACAGAAGGAGATAATCCTGATTTAA 326 ||||||||||||||||||| ||||||||||||||||||||||| ||| ||| | |||||| Sbjct 181 GTTCCCCTGAACTGGAGACCTTTTCATGCTACTGGACAGAAGGGGATGATCATAATTTAA 240 Query 327 AGACCCCAGGATCTATTCAGCTGTACTATGCTAAAAGGGAAAGCCAACGACAAGCTGCAA 386 || ||| |||||||||||||| ||||||||| || || Sbjct 241 AGGTCCCGGGATCTATTCAGCTATACTATGCT--------------------AG----AA 276 Query 387 GAATTGCTCATGAATGGACCCAGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAA 446 ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct 277 GAATTGCTCATGAATGGACCCCGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAG 336 Query 447 AAAACAGCTGTTACTTCAACTCATCATATACCTCCATTTGGATACCCTACTGCATCAAGC 506 |||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| Sbjct 337 CAAACAGCTGTTACTTCAACTCATCGTATACCTCCATTTGGATACCCTACTGCATTAAGC 396 Query 507 TAACTACAAATGGTGATTTGCTGGACCAAAAATGTTTCACTGTTGACGAAATAGTGCAAC 566 | |||||||||||||||||| ||||| |||| |||||||||||||| ||||||||||||| Sbjct 397 TTACTACAAATGGTGATTTGTTGGACGAAAAGTGTTTCACTGTTGATGAAATAGTGCAAC 456 Query 567 CTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGGGATTCGTG 626 ||||||| |||||||||||||||||||||||||||||||| |||||| | ||||| |||| Sbjct 457 CTGATCCGCCCATTGGCCTCAACTGGACTTTACTAAACATCAGTTTGCCTGGGATCCGTG 516 Query 627 GAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGGATGGATAA 686 |||| ||||||||||||||||| ||||| |||| ||| |||||||||||||||||||||| Sbjct 517 GAGATATCCAAGTGAGTTGGCAGCCACCGCCCAGTGCCGATGTTCTGAAGGGATGGATAA 576 Query 687 TTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGTGATGGGCC 746 |||||||||||||||||||||||||||||||||||||| ||||||||||| |||| ||| Sbjct 577 TTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGAAACAAAATGGAAAACGATGAGCC 636 Query 747 CTATATGGTTAACATACTGT-CCAGTGTACTCATTGAGAATGGATAAAGAACATGAAGTG 805 | ||||||| ||||| | || ||| |||||||| ||||| |||||||||| || |||||| Sbjct 637 CGATATGGTCAACAT-CAGTCCCACTGTACTCACTGAGACTGGATAAAGAGCACGAAGTG 695 Query 806 CGGGTGAGATCCAGACAACGGAGCTTTGAAAAGTACAGCGAGTTCAGCGAAGTCCTCCGT 865 || ||||||||||||||||||||||| |||||||||||||||||||| ||||| |||||| Sbjct 696 CGTGTGAGATCCAGACAACGGAGCTTCGAAAAGTACAGCGAGTTCAGTGAAGTACTCCGT 755 Query 866 GTAATATTTCCTCAGACGAACATATTGGAAGCATGTGAAGAAG 908 |||| |||||||||| | ||| | ||| |||||||||||||| Sbjct 756 GTAACGTTTCCTCAGATGGACACACTGGCAGCATGTGAAGAAG 798 >gb|AF395535.1|AF395535 Ailuropoda melanoleuca growth hormone receptor precursor (GHR) mRNA, complete cds Length=1938 Score = 720 bits (798), Expect = 0.0 Identities = 647/816 (79%), Gaps = 27/816 (3%) Strand=Plus/Plus Query 93 CAGGTATGGATCTTTGTCAGGTCTTCTTAACCTTGGCACTGGCAGTCACCAGCAGCACAT 152 ||||||||||||| || ||| | | || ||||||||| |||||| | | ||| | Sbjct 8 CAGGTATGGATCTCTGGCAGCTGCTGTTGACCTTGGCAGTGGCAGGCTCAGGCAATGCTG 67 Query 153 TTTCTGGAAGTGAGGCTACACCAGCTACTCTTGGCAAAGCTTCCCCAGTTCTGCAAAGAA 212 ||||||| ||||| || |||||||||| ||||||| ||| |||| |||||||||| Sbjct 68 TTTCTGGGAGTGAAGCCACACCAGCTATCCTTGGCAGAGCATCCCAGAGTCTGCAAAGAG 127 Query 213 TCAATCCAAGCCTGGGGACAAGTTCTTCTGGAAAGCCTCGATTCACCAAGTGTCGTTCCC 272 | |||||| ||| ||||||| | ||||||| ||||||| ||||||||||| ||||| | Sbjct 128 TTAATCCAGGCCCAGGGACAAATCCTTCTGGGAAGCCTCAGTTCACCAAGTGCCGTTCAC 187 Query 273 CTGAACTGGAGACATTTTCATGCTACTGGACAGAAGGAGATAATCCTGATTTAAAGACCC 332 ||||||| ||||| ||||||||| |||||||||| || | | ||| | | | |||| || Sbjct 188 CTGAACTAGAGACTTTTTCATGCCACTGGACAGAGGGGGTTCATCACGGTGTGAAGAACC 247 Query 333 CAGGATCTATTCAGCTGTACTATGCTAAAAGGGAAAGCCAACGACAAGCTGCAAGAATTG 392 ||||||| || ||||||| |||| || |||| ||| Sbjct 248 CAGGATCCATACAGCTGTTCTATATTAGAAGGA-----------------GCA------- 283 Query 393 CTCATGAATGGACCCAGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAAAAAACA 452 |||| |||||||| | |||||||||||||| || |||||||||||||||||| |||||| Sbjct 284 CTCAAGAATGGACTCCAGAATGGAAAGAATGTCCCGATTATGTCTCTGCTGGAGAAAACA 343 Query 453 GCTGTTACTTCAACTCATCATATACCTCCATTTGGATACCCTACTGCATCAAGCTAACTA 512 |||||||||| || ||||| |||||||||||||||||||||||||| ||||||||||| | Sbjct 344 GCTGTTACTTTAATTCATCTTATACCTCCATTTGGATACCCTACTGTATCAAGCTAACCA 403 Query 513 CAAATGGTGATTTGCTGGACCAAAAATGTTTCACTGTTGACGAAATAGTGCAACCTGATC 572 ||||||||| |||| |||||||||||| ||||||| |||||||||||||| || | Sbjct 404 GCAATGGTGATACAGTGGATCAAAAATGTTTCTCTGTTGAGGAAATAGTGCAACCAGACC 463 Query 573 CACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGGGATTCGTGGAGACA 632 ||||||| |||||||||||||||||||| ||||| ||||| || ||||||| || || | Sbjct 464 CACCCATCGGCCTCAACTGGACTTTACTGAACATCAGTTTAACGGGGATTCATGCGGATA 523 Query 633 TCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGGATGGATAATTCTGG 692 |||||||||| ||| ||||||| ||||| |||||||||| |||||| |||||| | |||| Sbjct 524 TCCAAGTGAGATGGGAACCACCGCCCAACGCAGATGTTCAGAAGGGTTGGATAGTCCTGG 583 Query 693 AGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGTGATGGGCCCTATAT 752 |||||||| | || |||||||||||||| || || | |||||| |||||| |||| ||| Sbjct 584 AGTATGAACTGCAATACAAAGAAGTAAACGAGTCCCAGTGGAAAATGATGGACCCTGTAT 643 Query 753 GGTTAACATACTGTCCAGTGTACTCATTGAGAATGGATAAAGAACATGAAGTGCGGGTGA 812 || ||||| |||||| |||||||||||| ||||||| ||| |||||||||| |||| Sbjct 644 TGTCAACATCAGTTCCAGTTTACTCATTGAGACTGGATAAGGAATATGAAGTGCGTGTGA 703 Query 813 GATCCAGACAACGGAGCTTTGAAAAGTACAGCGAGTTCAGCGAAGTCCTCCGTGTAATAT 872 ||||||||||||| | | |||||| || |||||||||| ||||| ||| |||| | Sbjct 704 GATCCAGACAACGAAATTCTGAAAAATATGGCGAGTTCAGTGAAGTGCTCTATGTAGCAC 763 Query 873 TTCCTCAGACGAACATATTGGAAGCATGTGAAGAAG 908 ||||||||| || ||| ||||||||||||| Sbjct 764 TTCCTCAGATGAGTCCATT---TGCATGTGAAGAAG 796 >ref|NM_001082636.1| Gene info Oryctolagus cuniculus growth hormone receptor (GHR), mRNA gb|AF015252.1|AF015252 UniGene infoGene info Oryctolagus cuniculus growth hormone receptor mRNA, complete cds Length=4029 Score = 720 bits (798), Expect = 0.0 Identities = 648/816 (79%), Gaps = 27/816 (3%) Strand=Plus/Plus Query 93 CAGGTATGGATCTTTGTCAGGTCTTCTTAACCTTGGCACTGGCAGTCACCAGCAGCACAT 152 ||||||||||||| || ||| | | || ||| ||||||| |||| | || | | Sbjct 140 CAGGTATGGATCTCTGGCAGCTGCTGTTGACCGTGGCACTAGCAGGGTCAAGTGATGCTT 199 Query 153 TTTCTGGAAGTGAGGCTACACCAGCTACTCTTGGCAAAGCTTCCCCAGTTCTGCAAAGAA 212 ||||||| |||||||| ||||||||||| ||||||| ||| ||| | |||||||| Sbjct 200 TTTCTGGGAGTGAGGCCACACCAGCTACCCTTGGCAGAGCATCCGAGAGTGTGCAAAGAG 259 Query 213 TCAATCCAAGCCTGGGGACAAGTTCTTCTGGAAAGCCTCGATTCACCAAGTGTCGTTCCC 272 | ||||| |||||||||||| ||||||||| ||||| |||||||||||| ||||| | Sbjct 260 TTCATCCAGGCCTGGGGACAAATTCTTCTGGGAAGCCCAAATTCACCAAGTGCCGTTCAC 319 Query 273 CTGAACTGGAGACATTTTCATGCTACTGGACAGAAGGAGATAATCCTGATTTAAAGACCC 332 ||||||| ||||| ||||||||| |||||||||| || | | ||| || |||||||| || Sbjct 320 CTGAACTAGAGACTTTTTCATGCCACTGGACAGATGGGGTTCATCATGGTTTAAAGAGCC 379 Query 333 CAGGATCTATTCAGCTGTACTATGCTAAAAGGGAAAGCCAACGACAAGCTGCAAGAATTG 392 |||||||| | ||||||| |||| || ||| ||| || Sbjct 380 CAGGATCTGTGCAGCTGTTCTATATTAGGAGG-------AAC-AC--------------- 416 Query 393 CTCATGAATGGACCCAGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAAAAAACA 452 ||| |||||||| || |||||||||||||||||||| ||||| |||||||| | |||| Sbjct 417 -TCAAGAATGGACTCAAGAATGGAAAGAATGCCCTGACTATGTTTCTGCTGGGGAGAACA 475 Query 453 GCTGTTACTTCAACTCATCATATACCTCCATTTGGATACCCTACTGCATCAAGCTAACTA 512 |||||||||| || ||||| ||||||||||||||||| |||||||| ||||||||||||| Sbjct 476 GCTGTTACTTTAATTCATCCTATACCTCCATTTGGATCCCCTACTGTATCAAGCTAACTA 535 Query 513 CAAATGGTGATTTGCTGGACCAAAAATGTTTCACTGTTGACGAAATAGTGCAACCTGATC 572 ||||||| | || |||| ||||| |||||| ||||||| |||||||||||||| |||| Sbjct 536 ACAATGGTGGTATGGTGGATCAAAAGTGTTTCTCTGTTGAGGAAATAGTGCAACCAGATC 595 Query 573 CACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGGGATTCGTGGAGACA 632 |||||||||||||||||||||||||||| || |||| || |||||||||| || ||| | Sbjct 596 CACCCATTGGCCTCAACTGGACTTTACTGAATGTTAGCTTAACCGGGATTCATGCAGATA 655 Query 633 TCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGGATGGATAATTCTGG 692 | |||||| | ||| |||||||||||||||||||||||| ||||||||||||| | ||| Sbjct 656 TTCAAGTGCGATGGGAACCACCACCCAATGCAGATGTTCAGAAGGGATGGATAGTCTTGG 715 Query 693 AGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGTGATGGGCCCTATAT 752 |||||||| |||| ||||||||||| |||||| | |||||||| |||||| |||| ||| Sbjct 716 AGTATGAACTTCAATACAAAGAAGTCAATGAAACTCAATGGAAAATGATGGACCCTGTAT 775 Query 753 GGTTAACATACTGTCCAGTGTACTCATTGAGAATGGATAAAGAACATGAAGTGCGGGTGA 812 || |||| ||| |||||||| || ||| |||| |||||| |||||||||| |||| Sbjct 776 TGTCGACATCAGTTCCTGTGTACTCGTTAAGACTGGACAAAGAATATGAAGTGCGTGTGA 835 Query 813 GATCCAGACAACGGAGCTTTGAAAAGTACAGCGAGTTCAGCGAAGTCCTCCGTGTAATAT 872 |||||||||| || |||| |||||| || |||||||||| || || ||| ||||| Sbjct 836 GATCCAGACAGCGAAGCTCTGAAAAATATGGCGAGTTCAGTGAGGTGCTCTATGTAACCC 895 Query 873 TTCCTCAGACGAACATATTGGAAGCATGTGAAGAAG 908 ||||||| | || | ||| |||||||||||| Sbjct 896 TTCCTCAAATGAGCCCATT---CACATGTGAAGAAG 928 >dbj|AK233142.1| UniGene info Sus scrofa mRNA, clone:LVRM10088G11, expressed in liver Length=2968 Score = 699 bits (774), Expect = 0.0 Identities = 642/816 (78%), Gaps = 27/816 (3%) Strand=Plus/Plus Query 93 CAGGTATGGATCTTTGTCAGGTCTTCTTAACCTTGGCACTGGCAGTCACCAGCAGCACAT 152 ||||||||||||| || ||| | | || ||||||||| |||||| | | || | | Sbjct 219 CAGGTATGGATCTCTGGCAGCTTCTGTTGACCTTGGCAGTGGCAGGCTCAAGTGATGCTT 278 Query 153 TTTCTGGAAGTGAGGCTACACCAGCTACTCTTGGCAAAGCTTCCCCAGTTCTGCAAAGAA 212 ||||||| ||||| || ||||||||| |||| || ||| || | |||||| ||| Sbjct 279 TTTCTGGGAGTGAAGCCACACCAGCTGTCCTTGTCAGAGCATCTCAGAGTCTGCAGAGAG 338 Query 213 TCAATCCAAGCCTGGGGACAAGTTCTTCTGGAAAGCCTCGATTCACCAAGTGTCGTTCCC 272 | ||||| |||| | ||||| |||||||||||||||| |||||||||||| ||||| | Sbjct 339 TTCATCCAGGCCTAGAGACAAATTCTTCTGGAAAGCCTAAATTCACCAAGTGCCGTTCAC 398 Query 273 CTGAACTGGAGACATTTTCATGCTACTGGACAGAAGGAGATAATCCTGATTTAAAGACCC 332 ||||||| ||||| ||||||||| |||||||||| || | || | |||| ||| || Sbjct 399 CTGAACTAGAGACTTTTTCATGCCACTGGACAGATGGGGTCCGTCACGGTTTACAGAGCC 458 Query 333 CAGGATCTATTCAGCTGTACTATGCTAAAAGGGAAAGCCAACGACAAGCTGCAAGAATTG 392 | ||||| || ||||||| |||| || |||| ||| Sbjct 459 CTGGATCCATACAGCTGTTCTATATTAGAAGGA-----------------GCA------- 494 Query 393 CTCATGAATGGACCCAGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAAAAAACA 452 |||| || ||||| || ||||||||||| |||||||||||||||||||||||| |||||| Sbjct 495 CTCAAGAGTGGACTCAAGAATGGAAAGAGTGCCCTGATTATGTCTCTGCTGGAGAAAACA 554 Query 453 GCTGTTACTTCAACTCATCATATACCTCCATTTGGATACCCTACTGCATCAAGCTAACTA 512 |||||||||| || ||||| |||||||||||||||||||||||||| |||||||| |||| Sbjct 555 GCTGTTACTTTAATTCATCTTATACCTCCATTTGGATACCCTACTGTATCAAGCTGACTA 614 Query 513 CAAATGGTGATTTGCTGGACCAAAAATGTTTCACTGTTGACGAAATAGTGCAACCTGATC 572 ||||||| |||| ||||| |||||| | ||||| |||||||||||||| |||| Sbjct 615 GCAATGGTGGGACTGTGGATCAAAAGTGTTTCTCCGTTGAGGAAATAGTGCAACCGGATC 674 Query 573 CACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGGGATTCGTGGAGACA 632 ||||||||||||||||||||||| |||| || || ||||| || ||||||| || ||| | Sbjct 675 CACCCATTGGCCTCAACTGGACTCTACTGAATATCAGTTTAACAGGGATTCATGCAGATA 734 Query 633 TCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGGATGGATAATTCTGG 692 |||||||||| ||| ||||||| |||||||||||||||| ||||||||||||| | |||| Sbjct 735 TCCAAGTGAGATGGGAACCACCTCCCAATGCAGATGTTCAGAAGGGATGGATAGTCCTGG 794 Query 693 AGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGTGATGGGCCCTATAT 752 |||||||| | || ||||||||||||||||| | | |||||| |||||| |||| ||| Sbjct 795 AGTATGAACTGCAATACAAAGAAGTAAATGAGACCCAGTGGAAAATGATGGACCCTGTAT 854 Query 753 GGTTAACATACTGTCCAGTGTACTCATTGAGAATGGATAAAGAACATGAAGTGCGGGTGA 812 || ||||| ||| |||||||| |||||| |||||||||| |||||||||| |||| Sbjct 855 TGTCAACATCAGTTCCGGTGTACTCCTTGAGACTGGATAAAGAGTATGAAGTGCGTGTGA 914 Query 813 GATCCAGACAACGGAGCTTTGAAAAGTACAGCGAGTTCAGCGAAGTCCTCCGTGTAATAT 872 ||||||||||||| | || |||||| || | |||||||| ||||| || ||||| | Sbjct 915 GATCCAGACAACGAAACTCTGAAAAATATGGAGAGTTCAGTGAAGTGCTGTATGTAACAC 974 Query 873 TTCCTCAGACGAACATATTGGAAGCATGTGAAGAAG 908 ||||||||| || | ||| ||||||||||||| Sbjct 975 TTCCTCAGATGAGCCCATT---TGCATGTGAAGAAG 1007 >emb|X54429.1|SSPGHRC UniGene infoGene info Porcine mRNA for growth hormone receptor Length=1952 Score = 699 bits (774), Expect = 0.0 Identities = 642/816 (78%), Gaps = 27/816 (3%) Strand=Plus/Plus Query 93 CAGGTATGGATCTTTGTCAGGTCTTCTTAACCTTGGCACTGGCAGTCACCAGCAGCACAT 152 ||||||||||||| || ||| | | || ||||||||| |||||| | | || | | Sbjct 14 CAGGTATGGATCTCTGGCAGCTTCTGTTGACCTTGGCAGTGGCAGGCTCAAGTGATGCTT 73 Query 153 TTTCTGGAAGTGAGGCTACACCAGCTACTCTTGGCAAAGCTTCCCCAGTTCTGCAAAGAA 212 ||||||| ||||| || ||||||||| |||| || ||| || | |||||| ||| Sbjct 74 TTTCTGGGAGTGAAGCCACACCAGCTGTCCTTGTCAGAGCATCTCAGAGTCTGCAGAGAG 133 Query 213 TCAATCCAAGCCTGGGGACAAGTTCTTCTGGAAAGCCTCGATTCACCAAGTGTCGTTCCC 272 | ||||| |||| | ||||| |||||||||||||||| |||||||||||| ||||| | Sbjct 134 TTCATCCAGGCCTAGAGACAAATTCTTCTGGAAAGCCTAAATTCACCAAGTGCCGTTCAC 193 Query 273 CTGAACTGGAGACATTTTCATGCTACTGGACAGAAGGAGATAATCCTGATTTAAAGACCC 332 ||||||| ||||| ||||||||| |||||||||| || | || | |||| ||| || Sbjct 194 CTGAACTAGAGACTTTTTCATGCCACTGGACAGATGGGGTCCGTCACGGTTTACAGAGCC 253 Query 333 CAGGATCTATTCAGCTGTACTATGCTAAAAGGGAAAGCCAACGACAAGCTGCAAGAATTG 392 | ||||| || ||||||| |||| || |||| ||| Sbjct 254 CTGGATCCATACAGCTGTTCTATATTAGAAGGA-----------------GCA------- 289 Query 393 CTCATGAATGGACCCAGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAAAAAACA 452 |||| || ||||| || ||||||||||| |||||||||||||||||||||||| |||||| Sbjct 290 CTCAAGAGTGGACTCAAGAATGGAAAGAGTGCCCTGATTATGTCTCTGCTGGAGAAAACA 349 Query 453 GCTGTTACTTCAACTCATCATATACCTCCATTTGGATACCCTACTGCATCAAGCTAACTA 512 |||||||||| || ||||| |||||||||||||||||||||||||| |||||||| |||| Sbjct 350 GCTGTTACTTTAATTCATCTTATACCTCCATTTGGATACCCTACTGTATCAAGCTGACTA 409 Query 513 CAAATGGTGATTTGCTGGACCAAAAATGTTTCACTGTTGACGAAATAGTGCAACCTGATC 572 ||||||| |||| ||||| |||||| | ||||| |||||||||||||| |||| Sbjct 410 GCAATGGTGGGACTGTGGATCAAAAGTGTTTCTCCGTTGAGGAAATAGTGCAACCGGATC 469 Query 573 CACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGGGATTCGTGGAGACA 632 ||||||||||||||||||||||| |||| || || ||||| || ||||||| || ||| | Sbjct 470 CACCCATTGGCCTCAACTGGACTCTACTGAATATCAGTTTAACAGGGATTCATGCAGATA 529 Query 633 TCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGGATGGATAATTCTGG 692 |||||||||| ||| ||||||| |||||||||||||||| ||||||||||||| | |||| Sbjct 530 TCCAAGTGAGATGGGAACCACCTCCCAATGCAGATGTTCAGAAGGGATGGATAGTCCTGG 589 Query 693 AGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGTGATGGGCCCTATAT 752 |||||||| | || ||||||||||||||||| | | |||||| |||||| |||| ||| Sbjct 590 AGTATGAACTGCAATACAAAGAAGTAAATGAGACCCAGTGGAAAATGATGGACCCTGTAT 649 Query 753 GGTTAACATACTGTCCAGTGTACTCATTGAGAATGGATAAAGAACATGAAGTGCGGGTGA 812 || ||||| ||| |||||||| |||||| |||||||||| |||||||||| |||| Sbjct 650 TGTCAACATCAGTTCCGGTGTACTCCTTGAGACTGGATAAAGAGTATGAAGTGCGTGTGA 709 Query 813 GATCCAGACAACGGAGCTTTGAAAAGTACAGCGAGTTCAGCGAAGTCCTCCGTGTAATAT 872 ||||||||||||| | || |||||| || | |||||||| ||||| || ||||| | Sbjct 710 GATCCAGACAACGAAACTCTGAAAAATATGGAGAGTTCAGTGAAGTGCTGTATGTAACAC 769 Query 873 TTCCTCAGACGAACATATTGGAAGCATGTGAAGAAG 908 ||||||||| || | ||| ||||||||||||| Sbjct 770 TTCCTCAGATGAGCCCATT---TGCATGTGAAGAAG 802 >gb|EF041823.1| UniGene info Sus scrofa breed BaMa mini-pig growth hormone receptor mRNA, complete cds Length=1917 Score = 690 bits (764), Expect = 0.0 Identities = 637/811 (78%), Gaps = 27/811 (3%) Strand=Plus/Plus Query 98 ATGGATCTTTGTCAGGTCTTCTTAACCTTGGCACTGGCAGTCACCAGCAGCACATTTTCT 157 |||||||| || ||| | | || ||||||||| |||||| | | || | |||||| Sbjct 1 ATGGATCTCTGGCAGCTTCTGTTGACCTTGGCAGTGGCAGGCTCAAGTGATGCTTTTTCT 60 Query 158 GGAAGTGAGGCTACACCAGCTACTCTTGGCAAAGCTTCCCCAGTTCTGCAAAGAATCAAT 217 || ||||| || ||||||||| |||| || ||| || | |||||| ||| | || Sbjct 61 GGGAGTGAAGCCACACCAGCTGTCCTTGTCAGAGCATCTCAGAGTCTGCAGAGAGTTCAT 120 Query 218 CCAAGCCTGGGGACAAGTTCTTCTGGAAAGCCTCGATTCACCAAGTGTCGTTCCCCTGAA 277 ||| |||| | ||||| |||||||||||||||| |||||||||||| ||||| |||||| Sbjct 121 CCAGGCCTAGAGACAAATTCTTCTGGAAAGCCTAAATTCACCAAGTGCCGTTCACCTGAA 180 Query 278 CTGGAGACATTTTCATGCTACTGGACAGAAGGAGATAATCCTGATTTAAAGACCCCAGGA 337 || ||||| ||||||||| |||||||||| || | || | |||| ||| ||| ||| Sbjct 181 CTAGAGACTTTTTCATGCCACTGGACAGATGGGGTCCGTCACGGTTTACAGAGCCCYGGA 240 Query 338 TCTATTCAGCTGTACTATGCTAAAAGGGAAAGCCAACGACAAGCTGCAAGAATTGCTCAT 397 || || ||||||| |||| || |||| ||| |||| Sbjct 241 TCCATACAGCTGTTCTATATTAGAAGGA-----------------GCA-------CTCAA 276 Query 398 GAATGGACCCAGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAAAAAACAGCTGT 457 || ||||| || ||||||||||| |||||||||||||||||||||||| ||||||||||| Sbjct 277 GAGTGGACTCAAGAATGGAAAGAGTGCCCTGATTATGTCTCTGCTGGAGAAAACAGCTGT 336 Query 458 TACTTCAACTCATCATATACCTCCATTTGGATACCCTACTGCATCAAGCTAACTACAAAT 517 ||||| || ||||| |||||||||||||||||||||||||| |||||||| |||| ||| Sbjct 337 TACTTTAATTCATCTTATACCTCCATTTGGATACCCTACTGTATCAAGCTGACTAGCAAT 396 Query 518 GGTGATTTGCTGGACCAAAAATGTTTCACTGTTGACGAAATAGTGCAACCTGATCCACCC 577 |||| |||| ||||| |||||| | ||||| |||||||||||||| ||||||||| Sbjct 397 GGTGGGACTGTGGATCAAAAGTGTTTCTCCGTTGAGGAAATAGTGCAACCGGATCCACCC 456 Query 578 ATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGGGATTCGTGGAGACATCCAA 637 |||||||||||||||||| |||| || || ||||| || ||||||| || ||| |||||| Sbjct 457 ATTGGCCTCAACTGGACTCTACTGAATATCAGTTTAACAGGGATTCATGCAGATATCCAA 516 Query 638 GTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGGATGGATAATTCTGGAGTAT 697 ||||| ||| ||||||| |||||||||||||||| ||||||||||||| | ||||||||| Sbjct 517 GTGAGATGGGAACCACCTCCCAATGCAGATGTTCAGAAGGGATGGATAGTCCTGGAGTAT 576 Query 698 GAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGTGATGGGCCCTATATGGTTA 757 ||| | || ||||||||||||||||| | | |||||| |||||| |||| ||| || | Sbjct 577 GAACTGCAATACAAAGAAGTAAATGAGACCCAGTGGAAAATGATGGACCCTGTATTGTCA 636 Query 758 ACATACTGTCCAGTGTACTCATTGAGAATGGATAAAGAACATGAAGTGCGGGTGAGATCC 817 |||| ||| |||||||| |||||| |||||||||| |||||||||| ||||||||| Sbjct 637 ACATCAGTTCCGGTGTACTCCTTGAGACTGGATAAAGAGTATGAAGTGCGTGTGAGATCC 696 Query 818 AGACAACGGAGCTTTGAAAAGTACAGCGAGTTCAGCGAAGTCCTCCGTGTAATATTTCCT 877 |||||||| | || |||||| || | |||||||| ||||| || ||||| | ||||| Sbjct 697 AGACAACGAAACTCTGAAAAATATGGAGAGTTCAGTGAAGTGCTGTATGTAACACTTCCT 756 Query 878 CAGACGAACATATTGGAAGCATGTGAAGAAG 908 |||| || | ||| ||||||||||||| Sbjct 757 CAGATGAGCCCATT---TGCATGTGAAGAAG 784 >ref|NM_214254.2| UniGene infoGene info Sus scrofa growth hormone receptor (GHR), mRNA gb|DQ106869.1| UniGene infoGene info Sus scrofa growth hormone receptor mRNA, complete cds Length=1932 Score = 690 bits (764), Expect = 0.0 Identities = 637/811 (78%), Gaps = 27/811 (3%) Strand=Plus/Plus Query 98 ATGGATCTTTGTCAGGTCTTCTTAACCTTGGCACTGGCAGTCACCAGCAGCACATTTTCT 157 |||||||| || ||| | | || ||||||||| |||||| | | || | |||||| Sbjct 1 ATGGATCTCTGGCAGCTTCTGTTGACCTTGGCAGTGGCAGGCTCAAGTGATGCTTTTTCT 60 Query 158 GGAAGTGAGGCTACACCAGCTACTCTTGGCAAAGCTTCCCCAGTTCTGCAAAGAATCAAT 217 || ||||| || ||||||||| |||| || ||| || | |||||| ||| | || Sbjct 61 GGGAGTGAAGCCACACCAGCTGTCCTTGTCAGAGCATCTCAGAGTCTGCAGAGAGTTCAT 120 Query 218 CCAAGCCTGGGGACAAGTTCTTCTGGAAAGCCTCGATTCACCAAGTGTCGTTCCCCTGAA 277 ||| |||| | ||||| |||||||||||||||| |||||||||||| ||||| |||||| Sbjct 121 CCAGGCCTAGAGACAAATTCTTCTGGAAAGCCTAAATTCACCAAGTGCCGTTCACCTGAA 180 Query 278 CTGGAGACATTTTCATGCTACTGGACAGAAGGAGATAATCCTGATTTAAAGACCCCAGGA 337 || ||||| ||||||||| |||||||||| || | || | |||| ||| ||| ||| Sbjct 181 CTAGAGACTTTTTCATGCCACTGGACAGATGGGGTCCGTCACGGTTTACAGAGCCCTGGA 240 Query 338 TCTATTCAGCTGTACTATGCTAAAAGGGAAAGCCAACGACAAGCTGCAAGAATTGCTCAT 397 || || ||||||| |||| || |||| ||| |||| Sbjct 241 TCCATACAGCTGTTCTATATTAGAAGGA-----------------GCA-------CTCAA 276 Query 398 GAATGGACCCAGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAAAAAACAGCTGT 457 || ||||| || ||||||||||| |||||||||||||||||||||||| ||||||||||| Sbjct 277 GAGTGGACTCAAGAATGGAAAGAGTGCCCTGATTATGTCTCTGCTGGAGAAAACAGCTGT 336 Query 458 TACTTCAACTCATCATATACCTCCATTTGGATACCCTACTGCATCAAGCTAACTACAAAT 517 ||||| || ||||| |||||||||||||||||||||||||| |||||||| |||| ||| Sbjct 337 TACTTTAATTCATCTTATACCTCCATTTGGATACCCTACTGTATCAAGCTGACTAGCAAT 396 Query 518 GGTGATTTGCTGGACCAAAAATGTTTCACTGTTGACGAAATAGTGCAACCTGATCCACCC 577 |||| |||| ||||| |||||| | ||||| |||||||||||||| ||||||||| Sbjct 397 GGTGGGACTGTGGATCAAAAGTGTTTCTCCGTTGAGGAAATAGTGCAACCGGATCCACCC 456 Query 578 ATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGGGATTCGTGGAGACATCCAA 637 |||||||||||||||||| |||| || || ||||| || ||||||| || ||| |||||| Sbjct 457 ATTGGCCTCAACTGGACTCTACTGAATATCAGTTTAACAGGGATTCATGCAGATATCCAA 516 Query 638 GTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGGATGGATAATTCTGGAGTAT 697 ||||| ||| ||||||| |||||||||||||||| ||||||||||||| | ||||||||| Sbjct 517 GTGAGATGGGAACCACCTCCCAATGCAGATGTTCAGAAGGGATGGATAGTCCTGGAGTAT 576 Query 698 GAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGTGATGGGCCCTATATGGTTA 757 ||| | || ||||||||||||||||| | | |||||| |||||| |||| ||| || | Sbjct 577 GAACTGCAATACAAAGAAGTAAATGAGACCCAGTGGAAAATGATGGACCCTGTATTGTCA 636 Query 758 ACATACTGTCCAGTGTACTCATTGAGAATGGATAAAGAACATGAAGTGCGGGTGAGATCC 817 |||| ||| |||||||| |||||| |||||||||| |||||||||| ||||||||| Sbjct 637 ACATCAGTTCCGGTGTACTCCTTGAGACTGGATAAAGAGTATGAAGTGCGTGTGAGATCC 696 Query 818 AGACAACGGAGCTTTGAAAAGTACAGCGAGTTCAGCGAAGTCCTCCGTGTAATATTTCCT 877 |||||||| | || |||||| || | |||||||| ||||| || ||||| | ||||| Sbjct 697 AGACAACGAAACTCTGAAAAATATGGAGAGTTCAGTGAAGTGCTGTATGTAACACTTCCT 756 Query 878 CAGACGAACATATTGGAAGCATGTGAAGAAG 908 |||| || | ||| ||||||||||||| Sbjct 757 CAGATGAGCCCATT---TGCATGTGAAGAAG 784 >ref|NM_001003123.1| UniGene infoGene info Canis lupus familiaris growth hormone receptor (GHR), mRNA gb|AF133835.1|AF133835 UniGene infoGeoGene info Canis familiaris growth hormone receptor precursor (GHR) mRNA, complete cds Length=1946 Score = 690 bits (764), Expect = 0.0 Identities = 642/816 (78%), Gaps = 27/816 (3%) Strand=Plus/Plus Query 93 CAGGTATGGATCTTTGTCAGGTCTTCTTAACCTTGGCACTGGCAGTCACCAGCAGCACAT 152 ||||||||||||| || ||| | | || ||||||||| |||||| | | |||| | | Sbjct 7 CAGGTATGGATCTCTGGCAGCTGCTGTTGACCTTGGCAGTGGCAGGCTCAGGCAGTGCTT 66 Query 153 TTTCTGGAAGTGAGGCTACACCAGCTACTCTTGGCAAAGCTTCCCCAGTTCTGCAAAGAA 212 ||||||| ||||| || |||||| ||| ||||||| || |||| ||| |||||| Sbjct 67 TTTCTGGGAGTGAAGCCACACCAACTATCCTTGGCAGCGCATCCCAGAGTCTACAAAGAG 126 Query 213 TCAATCCAAGCCTGGGGACAAGTTCTTCTGGAAAGCCTCGATTCACCAAGTGTCGTTCCC 272 | |||||| |||| ||||||| |||||||| |||||| ||||||||||| ||||| | Sbjct 127 TTAATCCAGGCCTAGGGACAAATTCTTCTGAGAAGCCTAAGTTCACCAAGTGCCGTTCAC 186 Query 273 CTGAACTGGAGACATTTTCATGCTACTGGACAGAAGGAGATAATCCTGATTTAAAGACCC 332 ||||||| ||||| ||||||||| |||||||||| || | | || || | |||||| | Sbjct 187 CTGAACTAGAGACTTTTTCATGCCACTGGACAGATGGGGTTCGTCATGGTCTAAAGAACG 246 Query 333 CAGGATCTATTCAGCTGTACTATGCTAAAAGGGAAAGCCAACGACAAGCTGCAAGAATTG 392 ||||||| | ||||||| |||| || |||| ||| || |||||||| Sbjct 247 CAGGATCCGTACAGCTGTTCTATATTAGAAGG---AGC-----AC-----GCAAGAAT-- 291 Query 393 CTCATGAATGGACCCAGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAAAAAACA 452 |||| || || |||||||||||||| |||||||||||||| ||| |||||| Sbjct 292 ---------GGACTCAAGAGTGGAAAGAATGCCCCGATTATGTCTCTGCCGGAGAAAACA 342 Query 453 GCTGTTACTTCAACTCATCATATACCTCCATTTGGATACCCTACTGCATCAAGCTAACTA 512 |||||||||| || ||||| |||||||||||||||||||||||||| ||||||||||| | Sbjct 343 GCTGTTACTTTAATTCATCTTATACCTCCATTTGGATACCCTACTGTATCAAGCTAACCA 402 Query 513 CAAATGGTGATTTGCTGGACCAAAAATGTTTCACTGTTGACGAAATAGTGCAACCTGATC 572 ||||||| | | |||| ||||| |||||| ||||||| |||||||||||||| || | Sbjct 403 GCAATGGTGGTACGGTGGATCAAAAGTGTTTCTCTGTTGAGGAAATAGTGCAACCAGACC 462 Query 573 CACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGGGATTCGTGGAGACA 632 ||||||| |||||||||||||||||||| ||||| ||||| || || || | || ||| | Sbjct 463 CACCCATCGGCCTCAACTGGACTTTACTGAACATCAGTTTAACGGGAATCCATGCAGATA 522 Query 633 TCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGGATGGATAATTCTGG 692 |||||||||| ||| |||||||||||||||| ||||||| ||||||||||||| | || Sbjct 523 TCCAAGTGAGATGGGAACCACCACCCAATGCGGATGTTCAGAAGGGATGGATAGTCCTCA 582 Query 693 AGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGTGATGGGCCCTATAT 752 |||||||| | || ||||||||||| ||||| || | |||||| |||||| |||| ||| Sbjct 583 AGTATGAACTACAATACAAAGAAGTGAATGAGTCCCAGTGGAAAATGATGGACCCTGTAT 642 Query 753 GGTTAACATACTGTCCAGTGTACTCATTGAGAATGGATAAAGAACATGAAGTGCGGGTGA 812 | ||||| |||||| ||||| |||||| ||||||||||| |||||||||| |||| Sbjct 643 CGGCAACATCAGTTCCAGTTTACTCGTTGAGACTGGATAAAGAATATGAAGTGCGTGTGA 702 Query 813 GATCCAGACAACGGAGCTTTGAAAAGTACAGCGAGTTCAGCGAAGTCCTCCGTGTAATAT 872 |||| |||||||| | || |||||| || |||||||||| || | ||| ||||| | Sbjct 703 GATCTAGACAACGAAACTCTGAAAAATATGGCGAGTTCAGTGAGGCGCTCTATGTAACAC 762 Query 873 TTCCTCAGACGAACATATTGGAAGCATGTGAAGAAG 908 ||||||| | || ||| ||||||||||||| Sbjct 763 TTCCTCAAATGAGTCCATT---TGCATGTGAAGAAG 795 >ref|XM_526938.2| Gene info PREDICTED: Pan troglodytes hypothetical LOC471560 (GHR), mRNA Length=4418 Score = 675 bits (748), Expect = 0.0 Identities = 636/816 (77%), Gaps = 27/816 (3%) Strand=Plus/Plus Query 93 CAGGTATGGATCTTTGTCAGGTCTTCTTAACCTTGGCACTGGCAGTCACCAGCAGCACAT 152 ||||||||||||| || ||| | | || |||||||||||||||| | || | | Sbjct 39 CAGGTATGGATCTCTGGCAGCTGCTGTTGACCTTGGCACTGGCAGGATCAAGTGATGCTT 98 Query 153 TTTCTGGAAGTGAGGCTACACCAGCTACTCTTGGCAAAGCTTCCCCAGTTCTGCAAAGAA 212 |||||||||||||||| ||| |||||| ||| ||| ||| || ||||||||| Sbjct 99 TTTCTGGAAGTGAGGCCACAGCAGCTATCCTTAGCAGAGCACCCTGGAGTCTGCAAAGTG 158 Query 213 TCAATCCAAGCCTGGGGACAAGTTCTTCTGGAAAGCCTCGATTCACCAAGTGTCGTTCCC 272 | |||||| |||| ||||| ||||||| ||||| |||||||||||| ||||| | Sbjct 159 TTAATCCAGGCCTAAAGACAAATTCTTCTAAGGAGCCTAAATTCACCAAGTGCCGTTCAC 218 Query 273 CTGAACTGGAGACATTTTCATGCTACTGGACAGAAGGAGATAATCCTGATTTAAAGACCC 332 |||| | ||||| ||||||||| |||||||||| | | | ||| || | ||||| || Sbjct 219 CTGAGCGAGAGACTTTTTCATGCCACTGGACAGATGAGGTTCATCATGGTACAAAGAACC 278 Query 333 CAGGATCTATTCAGCTGTACTATGCTAAAAGGGAAAGCCAACGACAAGCTGCAAGAATTG 392 |||| | || ||||||| |||| | | |||| | | Sbjct 279 TAGGACCCATACAGCTGTTCTATACCAGAAGGAACA------------------------ 314 Query 393 CTCATGAATGGACCCAGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAAAAAACA 452 |||| |||||||| || |||||||||||||||||||||||||| |||||||| |||||| Sbjct 315 CTCAAGAATGGACTCAAGAATGGAAAGAATGCCCTGATTATGTTTCTGCTGGGGAAAACA 374 Query 453 GCTGTTACTTCAACTCATCATATACCTCCATTTGGATACCCTACTGCATCAAGCTAACTA 512 |||||||||| || ||||| | ||||||||| |||||||| || || ||||||||||||| Sbjct 375 GCTGTTACTTTAATTCATCGTTTACCTCCATCTGGATACCTTATTGTATCAAGCTAACTA 434 Query 513 CAAATGGTGATTTGCTGGACCAAAAATGTTTCACTGTTGACGAAATAGTGCAACCTGATC 572 ||||||| | |||| |||| |||||| ||||||| |||||||||||||| |||| Sbjct 435 GCAATGGTGGTACAGTGGATGAAAAGTGTTTCTCTGTTGATGAAATAGTGCAACCAGATC 494 Query 573 CACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGGGATTCGTGGAGACA 632 ||||||||| |||||||||||||||||| ||| | ||||| || ||||||| || ||| | Sbjct 495 CACCCATTGCCCTCAACTGGACTTTACTGAACGTCAGTTTAACTGGGATTCATGCAGATA 554 Query 633 TCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGGATGGATAATTCTGG 692 |||||||||| ||| || |||||| |||||||||| ||| ||| |||||||| |||||| Sbjct 555 TCCAAGTGAGATGGGAAGCACCACGCAATGCAGATATTCAGAAAGGATGGATGGTTCTGG 614 Query 693 AGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGTGATGGGCCCTATAT 752 |||||||| |||| |||||||||||||||||| | ||||||||| |||||| |||||||| Sbjct 615 AGTATGAACTTCAATACAAAGAAGTAAATGAAACTAAATGGAAAATGATGGACCCTATAT 674 Query 753 GGTTAACATACTGTCCAGTGTACTCATTGAGAATGGATAAAGAACATGAAGTGCGGGTGA 812 || ||||| ||||||||||||||||| | ||||||| ||| |||||||||| |||| Sbjct 675 TGTCAACATCAGTTCCAGTGTACTCATTGAAAGTGGATAAGGAATATGAAGTGCGTGTGA 734 Query 813 GATCCAGACAACGGAGCTTTGAAAAGTACAGCGAGTTCAGCGAAGTCCTCCGTGTAATAT 872 |||||| |||||| | || || ||| || |||||||||| || || ||| ||||| | Sbjct 735 GATCCAAACAACGAAACTCTGGAAATTATGGCGAGTTCAGTGAGGTGCTCTATGTAACAC 794 Query 873 TTCCTCAGACGAACATATTGGAAGCATGTGAAGAAG 908 ||||||||| |||| ||| |||||||||||| Sbjct 795 TTCCTCAGATGAACCAATT---TACATGTGAAGAAG 827 >ref|NM_000163.2| UniGene infoGene info Homo sapiens growth hormone receptor (GHR), mRNA Length=4370 Score = 666 bits (738), Expect = 0.0 Identities = 634/816 (77%), Gaps = 27/816 (3%) Strand=Plus/Plus Query 93 CAGGTATGGATCTTTGTCAGGTCTTCTTAACCTTGGCACTGGCAGTCACCAGCAGCACAT 152 ||||||||||||| || ||| | | || |||||||||||||||| | || | | Sbjct 39 CAGGTATGGATCTCTGGCAGCTGCTGTTGACCTTGGCACTGGCAGGATCAAGTGATGCTT 98 Query 153 TTTCTGGAAGTGAGGCTACACCAGCTACTCTTGGCAAAGCTTCCCCAGTTCTGCAAAGAA 212 |||||||||||||||| ||| |||||| ||| ||| ||| || ||||||||| Sbjct 99 TTTCTGGAAGTGAGGCCACAGCAGCTATCCTTAGCAGAGCACCCTGGAGTCTGCAAAGTG 158 Query 213 TCAATCCAAGCCTGGGGACAAGTTCTTCTGGAAAGCCTCGATTCACCAAGTGTCGTTCCC 272 | |||||| |||| ||||| ||||||| ||||| |||||||||||| ||||| | Sbjct 159 TTAATCCAGGCCTAAAGACAAATTCTTCTAAGGAGCCTAAATTCACCAAGTGCCGTTCAC 218 Query 273 CTGAACTGGAGACATTTTCATGCTACTGGACAGAAGGAGATAATCCTGATTTAAAGACCC 332 |||| | ||||| ||||||||| |||||||||| | | | ||| || | ||||| || Sbjct 219 CTGAGCGAGAGACTTTTTCATGCCACTGGACAGATGAGGTTCATCATGGTACAAAGAACC 278 Query 333 CAGGATCTATTCAGCTGTACTATGCTAAAAGGGAAAGCCAACGACAAGCTGCAAGAATTG 392 |||| | || ||||||| |||| | | |||| | | Sbjct 279 TAGGACCCATACAGCTGTTCTATACCAGAAGGAACA------------------------ 314 Query 393 CTCATGAATGGACCCAGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAAAAAACA 452 |||| |||||||| || |||||||||||||||||||||||||| |||||||| |||||| Sbjct 315 CTCAAGAATGGACTCAAGAATGGAAAGAATGCCCTGATTATGTTTCTGCTGGGGAAAACA 374 Query 453 GCTGTTACTTCAACTCATCATATACCTCCATTTGGATACCCTACTGCATCAAGCTAACTA 512 |||||||||| || ||||| | ||||||||| |||||||| || || ||||||||||||| Sbjct 375 GCTGTTACTTTAATTCATCGTTTACCTCCATCTGGATACCTTATTGTATCAAGCTAACTA 434 Query 513 CAAATGGTGATTTGCTGGACCAAAAATGTTTCACTGTTGACGAAATAGTGCAACCTGATC 572 ||||||| | |||| |||| |||||| ||||||| |||||||||||||| |||| Sbjct 435 GCAATGGTGGTACAGTGGATGAAAAGTGTTTCTCTGTTGATGAAATAGTGCAACCAGATC 494 Query 573 CACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGGGATTCGTGGAGACA 632 ||||||||| |||||||||||||||||| ||| | ||||| || ||||||| || ||| | Sbjct 495 CACCCATTGCCCTCAACTGGACTTTACTGAACGTCAGTTTAACTGGGATTCATGCAGATA 554 Query 633 TCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGGATGGATAATTCTGG 692 |||||||||| ||| || |||||| |||||||||| ||| ||| |||||||| |||||| Sbjct 555 TCCAAGTGAGATGGGAAGCACCACGCAATGCAGATATTCAGAAAGGATGGATGGTTCTGG 614 Query 693 AGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGTGATGGGCCCTATAT 752 |||||||| |||| |||||||||||||||||| | ||||||||| |||||| |||||||| Sbjct 615 AGTATGAACTTCAATACAAAGAAGTAAATGAAACTAAATGGAAAATGATGGACCCTATAT 674 Query 753 GGTTAACATACTGTCCAGTGTACTCATTGAGAATGGATAAAGAACATGAAGTGCGGGTGA 812 | ||||| ||||||||||||||||| | ||||||| ||| |||||||||| |||| Sbjct 675 TGACAACATCAGTTCCAGTGTACTCATTGAAAGTGGATAAGGAATATGAAGTGCGTGTGA 734 Query 813 GATCCAGACAACGGAGCTTTGAAAAGTACAGCGAGTTCAGCGAAGTCCTCCGTGTAATAT 872 |||||| |||||| | || || ||| || |||||||||| || || ||| ||||| | Sbjct 735 GATCCAAACAACGAAACTCTGGAAATTATGGCGAGTTCAGTGAGGTGCTCTATGTAACAC 794 Query 873 TTCCTCAGACGAACATATTGGAAGCATGTGAAGAAG 908 ||||||||| || | ||| |||||||||||| Sbjct 795 TTCCTCAGATGAGCCAATT---TACATGTGAAGAAG 827 >emb|X06562.1|HSGHR UniGene infoGeoGene info Human mRNA for growth hormone receptor Length=4414 Score = 666 bits (738), Expect = 0.0 Identities = 634/816 (77%), Gaps = 27/816 (3%) Strand=Plus/Plus Query 93 CAGGTATGGATCTTTGTCAGGTCTTCTTAACCTTGGCACTGGCAGTCACCAGCAGCACAT 152 ||||||||||||| || ||| | | || |||||||||||||||| | || | | Sbjct 39 CAGGTATGGATCTCTGGCAGCTGCTGTTGACCTTGGCACTGGCAGGATCAAGTGATGCTT 98 Query 153 TTTCTGGAAGTGAGGCTACACCAGCTACTCTTGGCAAAGCTTCCCCAGTTCTGCAAAGAA 212 |||||||||||||||| ||| |||||| ||| ||| ||| || ||||||||| Sbjct 99 TTTCTGGAAGTGAGGCCACAGCAGCTATCCTTAGCAGAGCACCCTGGAGTCTGCAAAGTG 158 Query 213 TCAATCCAAGCCTGGGGACAAGTTCTTCTGGAAAGCCTCGATTCACCAAGTGTCGTTCCC 272 | |||||| |||| ||||| ||||||| ||||| |||||||||||| ||||| | Sbjct 159 TTAATCCAGGCCTAAAGACAAATTCTTCTAAGGAGCCTAAATTCACCAAGTGCCGTTCAC 218 Query 273 CTGAACTGGAGACATTTTCATGCTACTGGACAGAAGGAGATAATCCTGATTTAAAGACCC 332 |||| | ||||| ||||||||| |||||||||| | | | ||| || | ||||| || Sbjct 219 CTGAGCGAGAGACTTTTTCATGCCACTGGACAGATGAGGTTCATCATGGTACAAAGAACC 278 Query 333 CAGGATCTATTCAGCTGTACTATGCTAAAAGGGAAAGCCAACGACAAGCTGCAAGAATTG 392 |||| | || ||||||| |||| | | |||| | | Sbjct 279 TAGGACCCATACAGCTGTTCTATACCAGAAGGAACA------------------------ 314 Query 393 CTCATGAATGGACCCAGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAAAAAACA 452 |||| |||||||| || |||||||||||||||||||||||||| |||||||| |||||| Sbjct 315 CTCAAGAATGGACTCAAGAATGGAAAGAATGCCCTGATTATGTTTCTGCTGGGGAAAACA 374 Query 453 GCTGTTACTTCAACTCATCATATACCTCCATTTGGATACCCTACTGCATCAAGCTAACTA 512 |||||||||| || ||||| | ||||||||| |||||||| || || ||||||||||||| Sbjct 375 GCTGTTACTTTAATTCATCGTTTACCTCCATCTGGATACCTTATTGTATCAAGCTAACTA 434 Query 513 CAAATGGTGATTTGCTGGACCAAAAATGTTTCACTGTTGACGAAATAGTGCAACCTGATC 572 ||||||| | |||| |||| |||||| ||||||| |||||||||||||| |||| Sbjct 435 GCAATGGTGGTACAGTGGATGAAAAGTGTTTCTCTGTTGATGAAATAGTGCAACCAGATC 494 Query 573 CACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGGGATTCGTGGAGACA 632 ||||||||| |||||||||||||||||| ||| | ||||| || ||||||| || ||| | Sbjct 495 CACCCATTGCCCTCAACTGGACTTTACTGAACGTCAGTTTAACTGGGATTCATGCAGATA 554 Query 633 TCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGGATGGATAATTCTGG 692 |||||||||| ||| || |||||| |||||||||| ||| ||| |||||||| |||||| Sbjct 555 TCCAAGTGAGATGGGAAGCACCACGCAATGCAGATATTCAGAAAGGATGGATGGTTCTGG 614 Query 693 AGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGTGATGGGCCCTATAT 752 |||||||| |||| |||||||||||||||||| | ||||||||| |||||| |||||||| Sbjct 615 AGTATGAACTTCAATACAAAGAAGTAAATGAAACTAAATGGAAAATGATGGACCCTATAT 674 Query 753 GGTTAACATACTGTCCAGTGTACTCATTGAGAATGGATAAAGAACATGAAGTGCGGGTGA 812 | ||||| ||||||||||||||||| | ||||||| ||| |||||||||| |||| Sbjct 675 TGACAACATCAGTTCCAGTGTACTCATTGAAAGTGGATAAGGAATATGAAGTGCGTGTGA 734 Query 813 GATCCAGACAACGGAGCTTTGAAAAGTACAGCGAGTTCAGCGAAGTCCTCCGTGTAATAT 872 |||||| |||||| | || || ||| || |||||||||| || || ||| ||||| | Sbjct 735 GATCCAAACAACGAAACTCTGGAAATTATGGCGAGTTCAGTGAGGTGCTCTATGTAACAC 794 Query 873 TTCCTCAGACGAACATATTGGAAGCATGTGAAGAAG 908 ||||||||| || | ||| |||||||||||| Sbjct 795 TTCCTCAGATGAGCCAATT---TACATGTGAAGAAG 827 >gb|AF150751.1|AF150751 Papio hamadryas anubis growth hormone receptor mRNA, complete cds Length=2018 Score = 657 bits (728), Expect = 0.0 Identities = 631/811 (77%), Gaps = 27/811 (3%) Strand=Plus/Plus Query 98 ATGGATCTTTGTCAGGTCTTCTTAACCTTGGCACTGGCAGTCACCAGCAGCACATTTTCT 157 |||||||| || ||| | | || |||||||||||||||| | || | |||||| Sbjct 1 ATGGATCTCTGGCAGCTGCTGTTGACCTTGGCACTGGCAGGATCAAGTGATGCTTTTTCT 60 Query 158 GGAAGTGAGGCTACACCAGCTACTCTTGGCAAAGCTTCCCCAGTTCTGCAAAGAATCAAT 217 ||||||||| | ||| |||||| ||| ||| ||| ||| ||||||||| | ||| Sbjct 61 GGAAGTGAGCCCACAGCAGCTATCCTTAGCAGAGCATCCTGGAGTCTGCAAAGTGTTAAT 120 Query 218 CCAAGCCTGGGGACAAGTTCTTCTGGAAAGCCTCGATTCACCAAGTGTCGTTCCCCTGAA 277 ||| |||| ||||| |||||| ||||| |||||||||||||||||| ||||| Sbjct 121 CCAGGCCTAAAGACAAACTCTTCTAAGGAGCCTAAATTCACCAAGTGTCGTTCACCTGAG 180 Query 278 CTGGAGACATTTTCATGCTACTGGACAGAAGGAGATAATCCTGATTTAAAGACCCCAGGA 337 | ||||| ||||||||| ||||||| || | | | ||| || || ||||| || |||| Sbjct 181 CGAGAGACTTTTTCATGCCACTGGACGGATGCGGTTCATCATGGTTCAAAGAGCCTAGGA 240 Query 338 TCTATTCAGCTGTACTATGCTAAAAGGGAAAGCCAACGACAAGCTGCAAGAATTGCTCAT 397 | || ||||||| |||| | | || |||| ||| || Sbjct 241 CCCATACAGCTGTTCTATACCAGAA-GGAAT--------------------ATT---CAA 276 Query 398 GAATGGACCCAGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAAAAAACAGCTGT 457 |||||||| || |||||||||||||||||||||||||| |||||||| ||||||||||| Sbjct 277 GAATGGACTCAAGAATGGAAAGAATGCCCTGATTATGTTTCTGCTGGGGAAAACAGCTGT 336 Query 458 TACTTCAACTCATCATATACCTCCATTTGGATACCCTACTGCATCAAGCTAACTACAAAT 517 ||||| || ||||||| ||||||| | |||||||| || || ||||||||||||| ||| Sbjct 337 TACTTTAATTCATCATTTACCTCCGTCTGGATACCTTATTGTATCAAGCTAACTAGCAAT 396 Query 518 GGTGATTTGCTGGACCAAAAATGTTTCACTGTTGACGAAATAGTGCAACCTGATCCACCC 577 |||||| |||| ||| |||||| |||||||||||||||||||||| ||||||||| Sbjct 397 GGTGATACAGTGGATGGAAAGTGTTTCTCTGTTGACGAAATAGTGCAACCAGATCCACCC 456 Query 578 ATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGGGATTCGTGGAGACATCCAA 637 |||| |||||||||||||||||| ||| | ||||| || ||||||| || ||| || ||| Sbjct 457 ATTGCCCTCAACTGGACTTTACTGAACGTCAGTTTAACTGGGATTCATGCAGATATTCAA 516 Query 638 GTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGGATGGATAATTCTGGAGTAT 697 ||||| ||| || ||||||||||||||||| ||| ||| |||||||| ||||||||||| Sbjct 517 GTGAGATGGGAAGCACCACCCAATGCAGATATTCAGAAAGGATGGATGGTTCTGGAGTAT 576 Query 698 GAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGTGATGGGCCCTATATGGTTA 757 ||| |||| |||||||||||||||||| | ||||||||| |||||| ||||||| || | Sbjct 577 GAACTTCAATACAAAGAAGTAAATGAAACTAAATGGAAAATGATGGATCCTATATTGTCA 636 Query 758 ACATACTGTCCAGTGTACTCATTGAGAATGGATAAAGAACATGAAGTGCGGGTGAGATCC 817 |||| ||||||||||||||||| | ||||||| ||| |||||||||| ||||||||| Sbjct 637 ACATCAGTTCCAGTGTACTCATTGAAAGTGGATAAGGAATATGAAGTGCGTGTGAGATCC 696 Query 818 AGACAACGGAGCTTTGAAAAGTACAGCGAGTTCAGCGAAGTCCTCCGTGTAATATTTCCT 877 | || ||| | || || ||| || |||||||||| || || ||| ||||| | ||||| Sbjct 697 AAACGACGAAACTCTGGAAATTATGGCGAGTTCAGTGAGGTGCTCTATGTAACACTTCCT 756 Query 878 CAGACGAACATATTGGAAGCATGTGAAGAAG 908 |||| |||| ||| |||||||||||| Sbjct 757 CAGATGAACCAATT---TACATGTGAAGAAG 784 >gb|U85396.1|MMU85396 UniGene infoGene info Macaca mulatta growth hormone binding protein precursor (mgGHbp) mRNA, complete cds Length=902 Score = 648 bits (718), Expect = 0.0 Identities = 628/813 (77%), Gaps = 27/813 (3%) Strand=Plus/Plus Query 97 TATGGATCTTTGTCAGGTCTTCTTAACCTTGGCACTGGCAGTCACCAGCAGCACATTTTC 156 ||||||||| || ||| | | || |||||||||||||||| | || | ||||| Sbjct 92 TATGGATCTCTGGCAGCTGCTGTTGACCTTGGCACTGGCAGGATCAAGTGATGCTTTTTC 151 Query 157 TGGAAGTGAGGCTACACCAGCTACTCTTGGCAAAGCTTCCCCAGTTCTGCAAAGAATCAA 216 |||||||||| | ||| |||||| ||| ||| ||| ||| ||||||||| | || Sbjct 152 TGGAAGTGAGCCCACAGCAGCTATCCTTAGCAGAGCATCCTGGAGTCTGCAAAGTGTTAA 211 Query 217 TCCAAGCCTGGGGACAAGTTCTTCTGGAAAGCCTCGATTCACCAAGTGTCGTTCCCCTGA 276 |||| |||| ||||| |||||| ||||| |||||||||||||||||| ||||| Sbjct 212 TCCAGGCCTAAAGACAAACTCTTCTAAGGAGCCTAAATTCACCAAGTGTCGTTCACCTGA 271 Query 277 ACTGGAGACATTTTCATGCTACTGGACAGAAGGAGATAATCCTGATTTAAAGACCCCAGG 336 | ||||| ||||||||| |||||||||| | | | ||| || || ||||| || ||| Sbjct 272 GCGAGAGACTTTTTCATGCCACTGGACAGATGCGGTTCATCATGGTTCAAAGAGCCTAGG 331 Query 337 ATCTATTCAGCTGTACTATGCTAAAAGGGAAAGCCAACGACAAGCTGCAAGAATTGCTCA 396 | | || ||||||| |||| | | |||| | | ||| |||| Sbjct 332 ACCCATACAGCTGTTCTATACCAGAAGGAATATTCAAGGACA------------------ 373 Query 397 TGAATGGACCCAGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAAAAAACAGCTG 456 ||| || |||||||||||||||||||||||||| |||||||| |||||||||| Sbjct 374 ------GACTCAAGAATGGAAAGAATGCCCTGATTATGTTTCTGCTGGGGAAAACAGCTG 427 Query 457 TTACTTCAACTCATCATATACCTCCATTTGGATACCCTACTGCATCAAGCTAACTACAAA 516 |||||| || ||||||| ||||||| | |||||||| || || ||||||||||||| || Sbjct 428 TTACTTTAATTCATCATTTACCTCCGTCTGGATACCTTATTGTATCAAGCTAACTAGCAA 487 Query 517 TGGTGATTTGCTGGACCAAAAATGTTTCACTGTTGACGAAATAGTGCAACCTGATCCACC 576 ||||||| |||| ||| |||||| |||||||||||||||||||||| |||||||| Sbjct 488 TGGTGATACAGTGGATGGAAAGTGTTTCTCTGTTGACGAAATAGTGCAACCAGATCCACC 547 Query 577 CATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGGGATTCGTGGAGACATCCA 636 ||||| |||||||||||||||||| ||| | ||||| || ||||||| || ||| || | Sbjct 548 CATTGCCCTCAACTGGACTTTACTGAACGTCAGTTTAACTGGGATTCATGCAGATATTCT 607 Query 637 AGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGGATGGATAATTCTGGAGTA 696 ||||| ||| || ||||||||||||||||| ||| ||| |||||||| |||||||||| Sbjct 608 TGTGAGATGGGAAGCACCACCCAATGCAGATATTCAGAAAGGATGGATGGTTCTGGAGTA 667 Query 697 TGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGTGATGGGCCCTATATGGTT 756 |||| |||| |||||||||||||||||| | ||||||||| |||||| ||||||| || Sbjct 668 TGAACTTCAATACAAAGAAGTAAATGAAACTAAATGGAAAATGATGGATCCTATATTGTC 727 Query 757 AACATACTGTCCAGTGTACTCATTGAGAATGGATAAAGAACATGAAGTGCGGGTGAGATC 816 ||||| ||||||||||||||||| | ||||||| ||| ||||||||| ||||||||| Sbjct 728 AACATCAGTTCCAGTGTACTCATTGAAAGTGGATAAGGAATATGAAGTGCTGGTGAGATC 787 Query 817 CAGACAACGGAGCTTTGAAAAGTACAGCGAGTTCAGCGAAGTCCTCCGTGTAATATTTCC 876 || || ||| | || | ||| || |||||||||| || || ||| ||||| | |||| Sbjct 788 CAAACGACGAAACTCTAGAAATTATGGCGAGTTCAGTGAGGTGCTCTATGTAACACTTCC 847 Query 877 TCAGACGAACATATTGGAAGCATGTGAAGAAGG 909 ||||| |||| ||| ||||||||||||| Sbjct 848 TCAGATGAACCAATT---TACATGTGAAGAAGG 877 >ref|NM_001042667.1| UniGene infoGene info Macaca mulatta growth hormone receptor (GHR), mRNA gb|U84589.1|MMU84589 UniGene infoGene info Macaca mulatta growth hormone receptor precursor (mkGHR) mRNA, complete cds Length=2119 Score = 646 bits (716), Expect = 0.0 Identities = 627/812 (77%), Gaps = 27/812 (3%) Strand=Plus/Plus Query 97 TATGGATCTTTGTCAGGTCTTCTTAACCTTGGCACTGGCAGTCACCAGCAGCACATTTTC 156 ||||||||| || ||| | | || |||||||||||||||| | || | ||||| Sbjct 92 TATGGATCTCTGGCAGCTGCTGTTGACCTTGGCACTGGCAGGATCAAGTGATGCTTTTTC 151 Query 157 TGGAAGTGAGGCTACACCAGCTACTCTTGGCAAAGCTTCCCCAGTTCTGCAAAGAATCAA 216 |||||||||| | ||| |||||| ||| ||| ||| ||| ||||||||| | || Sbjct 152 TGGAAGTGAGCCCACAGCAGCTATCCTTAGCAGAGCATCCTGGAGTCTGCAAAGTGTTAA 211 Query 217 TCCAAGCCTGGGGACAAGTTCTTCTGGAAAGCCTCGATTCACCAAGTGTCGTTCCCCTGA 276 |||| |||| ||||| |||||| ||||| |||||||||||||||||| ||||| Sbjct 212 TCCAGGCCTAAAGACAAACTCTTCTAAGGAGCCTAAATTCACCAAGTGTCGTTCACCTGA 271 Query 277 ACTGGAGACATTTTCATGCTACTGGACAGAAGGAGATAATCCTGATTTAAAGACCCCAGG 336 | ||||| ||||||||| |||||||||| | | | ||| || || ||||| || ||| Sbjct 272 GCGAGAGACTTTTTCATGCCACTGGACAGATGCGGTTCATCATGGTTCAAAGAGCCTAGG 331 Query 337 ATCTATTCAGCTGTACTATGCTAAAAGGGAAAGCCAACGACAAGCTGCAAGAATTGCTCA 396 | | || ||||||| |||| | | |||| | | ||| |||| Sbjct 332 ACCCATACAGCTGTTCTATACCAGAAGGAATATTCAAGGACA------------------ 373 Query 397 TGAATGGACCCAGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAAAAAACAGCTG 456 ||| || |||||||||||||||||||||||||| |||||||| |||||||||| Sbjct 374 ------GACTCAAGAATGGAAAGAATGCCCTGATTATGTTTCTGCTGGGGAAAACAGCTG 427 Query 457 TTACTTCAACTCATCATATACCTCCATTTGGATACCCTACTGCATCAAGCTAACTACAAA 516 |||||| || ||||||| ||||||| | |||||||| || || ||||||||||||| || Sbjct 428 TTACTTTAATTCATCATTTACCTCCGTCTGGATACCTTATTGTATCAAGCTAACTAGCAA 487 Query 517 TGGTGATTTGCTGGACCAAAAATGTTTCACTGTTGACGAAATAGTGCAACCTGATCCACC 576 ||||||| |||| ||| |||||| |||||||||||||||||||||| |||||||| Sbjct 488 TGGTGATACAGTGGATGGAAAGTGTTTCTCTGTTGACGAAATAGTGCAACCAGATCCACC 547 Query 577 CATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGGGATTCGTGGAGACATCCA 636 ||||| |||||||||||||||||| ||| | ||||| || ||||||| || ||| || | Sbjct 548 CATTGCCCTCAACTGGACTTTACTGAACGTCAGTTTAACTGGGATTCATGCAGATATTCT 607 Query 637 AGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGGATGGATAATTCTGGAGTA 696 ||||| ||| || ||||||||||||||||| ||| ||| |||||||| |||||||||| Sbjct 608 TGTGAGATGGGAAGCACCACCCAATGCAGATATTCAGAAAGGATGGATGGTTCTGGAGTA 667 Query 697 TGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGTGATGGGCCCTATATGGTT 756 |||| |||| |||||||||||||||||| | ||||||||| |||||| ||||||| || Sbjct 668 TGAACTTCAATACAAAGAAGTAAATGAAACTAAATGGAAAATGATGGATCCTATATTGTC 727 Query 757 AACATACTGTCCAGTGTACTCATTGAGAATGGATAAAGAACATGAAGTGCGGGTGAGATC 816 ||||| ||||||||||||||||| | ||||||| ||| ||||||||| ||||||||| Sbjct 728 AACATCAGTTCCAGTGTACTCATTGAAAGTGGATAAGGAATATGAAGTGCTGGTGAGATC 787 Query 817 CAGACAACGGAGCTTTGAAAAGTACAGCGAGTTCAGCGAAGTCCTCCGTGTAATATTTCC 876 || || ||| | || | ||| || |||||||||| || || ||| ||||| | |||| Sbjct 788 CAAACGACGAAACTCTAGAAATTATGGCGAGTTCAGTGAGGTGCTCTATGTAACACTTCC 847 Query 877 TCAGACGAACATATTGGAAGCATGTGAAGAAG 908 ||||| |||| ||| |||||||||||| Sbjct 848 TCAGATGAACCAATT---TACATGTGAAGAAG 876 >gb|AF339061.1|AF339061 Saimiri boliviensis growth hormone receptor mRNA, complete cds Length=1899 Score = 645 bits (714), Expect = 0.0 Identities = 626/811 (77%), Gaps = 27/811 (3%) Strand=Plus/Plus Query 98 ATGGATCTTTGTCAGGTCTTCTTAACCTTGGCACTGGCAGTCACCAGCAGCACATTTTCT 157 |||||||| || ||| | | || |||||||||||||||| | || | |||||| Sbjct 1 ATGGATCTCTGGCAGCTGCTGTTGACCTTGGCACTGGCAGGATCAAGTGATGCTTTTTCT 60 Query 158 GGAAGTGAGGCTACACCAGCTACTCTTGGCAAAGCTTCCCCAGTTCTGCAAAGAATCAAT 217 ||| |||| | ||| ||||| ||| ||| || |||| ||||| ||| | ||| Sbjct 61 GGACGTGAAACCACAGCAGCTGTCCTTAGCAGAGTATCCCAGAGTCTGCTAAGTGTTAAT 120 Query 218 CCAAGCCTGGGGACAAGTTCTTCTGGAAAGCCTCGATTCACCAAGTGTCGTTCCCCTGAA 277 ||| |||| ||||| ||||||| ||||| |||||| ||||| ||||| ||||| Sbjct 121 CCAGGCCTAAAGACAAATTCTTCTAAGGAGCCTAAATTCACGAAGTGCCGTTCACCTGAG 180 Query 278 CTGGAGACATTTTCATGCTACTGGACAGAAGGAGATAATCCTGATTTAAAGACCCCAGGA 337 || ||||| ||||||||| ||||||||| | || | ||| || |||||||| |||||| Sbjct 181 CTAGAGACTTTTTCATGCCGCTGGACAGATGCAGTTCATCATGGTTTAAAGAGTCCAGGA 240 Query 338 TCTATTCAGCTGTACTATGCTAAAAGGGAAAGCCAACGACAAGCTGCAAGAATTGCTCAT 397 | || ||||||| |||| ||| |||| | | |||| Sbjct 241 CCCATACAGCTGTTCTATACTAGAAGGAACA------------------------CTCAA 276 Query 398 GAATGGACCCAGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAAAAAACAGCTGT 457 ||| |||| || |||||||||||||| ||||||||||| |||||||| ||||||||||| Sbjct 277 GAAGGGACTCAAGAATGGAAAGAATGTCCTGATTATGTTTCTGCTGGGGAAAACAGCTGT 336 Query 458 TACTTCAACTCATCATATACCTCCATTTGGATACCCTACTGCATCAAGCTAACTACAAAT 517 || || || ||||| | ||||||||| |||||||| ||||| ||||||||||||| ||| Sbjct 337 TATTTTAATTCATCGTTTACCTCCATCTGGATACCTTACTGTATCAAGCTAACTAGCAAT 396 Query 518 GGTGATTTGCTGGACCAAAAATGTTTCACTGTTGACGAAATAGTGCAACCTGATCCACCC 577 |||| | |||| |||| |||||| |||||||| ||||||||||||| ||||||||| Sbjct 397 GGTGGTACAGTGGATGAAAAGTGTTTCTCTGTTGACCAAATAGTGCAACCAGATCCACCC 456 Query 578 ATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGGGATTCGTGGAGACATCCAA 637 |||| |||||||||||||||||| ||||| ||||| || ||| ||| || |||||||||| Sbjct 457 ATTGCCCTCAACTGGACTTTACTGAACATCAGTTTAACTGGGGTTCATGCAGACATCCAA 516 Query 638 GTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGGATGGATAATTCTGGAGTAT 697 ||||| ||| || ||||||||||||||||| ||| ||| |||||||| |||| |||||| Sbjct 517 GTGAGATGGGAAGCACCACCCAATGCAGATATTCAGAAAGGATGGATGGTTCTAGAGTAT 576 Query 698 GAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGTGATGGGCCCTATATGGTTA 757 ||| |||| |||||||||||||||||| | | |||||| |||||| |||||||| || | Sbjct 577 GAACTTCAATACAAAGAAGTAAATGAAACTCAGTGGAAAATGATGGACCCTATATTGTCA 636 Query 758 ACATACTGTCCAGTGTACTCATTGAGAATGGATAAAGAACATGAAGTGCGGGTGAGATCC 817 |||| |||| |||||||||||||| ||||||| ||| |||||||||| ||||||||| Sbjct 637 ACATCAGTTCCACTGTACTCATTGAGAGTGGATAAGGAATATGAAGTGCGTGTGAGATCC 696 Query 818 AGACAACGGAGCTTTGAAAAGTACAGCGAGTTCAGCGAAGTCCTCCGTGTAATATTTCCT 877 |||||||| | | |||||| || ||||||||||||| || || ||||| | ||||| Sbjct 697 AGACAACGAAAATCTGAAAATTATGGCGAGTTCAGCGAGGTGCTGTATGTAAAACTTCCT 756 Query 878 CAGACGAACATATTGGAAGCATGTGAAGAAG 908 |||| || | || |||||||||||| Sbjct 757 CAGATGAGCCAGTT---TACATGTGAAGAAG 784 >gb|AF247665.1|AF247665 Cavia porcellus growth hormone receptor (GHR) mRNA, complete cds Length=1892 Score = 572 bits (634), Expect = 7e-160 Identities = 614/816 (75%), Gaps = 27/816 (3%) Strand=Plus/Plus Query 93 CAGGTATGGATCTTTGTCAGGTCTTCTTAACCTTGGCACTGGCAGTCACCAGCAGCACAT 152 |||||||||||||||| ||| | | || ||||||||| ||| || | | |||| | | Sbjct 1 CAGGTATGGATCTTTGGCAGCTGCTGTTGACCTTGGCAGTGGTAGGCTCAAGCAATGCTT 60 Query 153 TTTCTGGAAGTGAGGCTACACCAGCTACTCTTGGCAAAGCTTCCCCAGTTCTGCAAAGAA 212 || ||| || ||||| ||| || || || ||| || |||||||||| Sbjct 61 TTGTTGGGAGAGAGGCCGTCACAGTCACCCTCAACAGAGCAAACCTGAGTCTGCAAAGAG 120 Query 213 TCAATCCAAGCCTGGGGACAAGTTCTTCTGGAAAGCCTCGATTCACCAAGTGTCGTTCCC 272 | || ||||||||| |||| ||||||||| || ||| |||||||||||| ||||| | Sbjct 121 TTAACGCAAGCCTGGAAACAAATTCTTCTGGGAACCCTAAATTCACCAAGTGCCGTTCAC 180 Query 273 CTGAACTGGAGACATTTTCATGCTACTGGACAGAAGGAGATAATCCTGATTTAAAGACCC 332 |||| || ||||| ||||||||| |||||||||| | | | ||| || |||||||| | Sbjct 181 CTGAGCTAGAGACTTTTTCATGCCACTGGACAGATGAGGGTCATCATGGTTTAAAGAGCA 240 Query 333 CAGGATCTATTCAGCTGTACTATGCTAAAAGGGAAAGCCAACGACAAGCTGCAAGAATTG 392 |||||| || ||| ||| |||| |||||||| | || Sbjct 241 CAGGATTCATACAGATGTTCTATACTAAAAGGAA--------------CT---------- 276 Query 393 CTCATGAATGGACCCAGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAAAAAACA 452 |||| || || ||| |||||||||||||||||||||||||||||||||||| |||| | Sbjct 277 CTCAAGAGCAGAACCAAGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAGAAAATA 336 Query 453 GCTGTTACTTCAACTCATCATATACCTCCATTTGGATACCCTACTGCATCAAGCTAACTA 512 |||||||||| ||||||||||||||||||||||||| |||||||| |||||||||||| Sbjct 337 GCTGTTACTTTAACTCATCATATACCTCCATTTGGAAGCCCTACTGTGTCAAGCTAACTA 396 Query 513 CAAATGGTGATTTGCTGGACCAAAAATGTTTCACTGTTGACGAAATAGTGCAACCTGATC 572 ||||||| | |||| |||| |||||| |||||| ||||||||||||||||||| Sbjct 397 GTAATGGTGGTAAAGTGGATGAAAAGTGTTTCTATGTTGAGGAAATAGTGCAACCTGATC 456 Query 573 CACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGGGATTCGTGGAGACA 632 |||||| ||||||||| ||||||||| | |||| |||| ||| | ||| ||| || | Sbjct 457 CACCCACTGGCCTCAATTGGACTTTAATGAACACTAGTGCGACAGCAATTTATGGGGATA 516 Query 633 TCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGGATGGATAATTCTGG 692 |||||||||| ||| | ||||||| || |||||||||| ||||||||||||||| |||| Sbjct 517 TCCAAGTGAGATGGAAGCCACCACGCAGTGCAGATGTTAAGAAGGGATGGATAATGCTGG 576 Query 693 AGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGTGATGGGCCCTATAT 752 | |||||| |||| |||| || ||||||| | |||||||| |||||| ||| || Sbjct 577 ACTATGAACTTCAAATCAAACAAACAAATGAAACTCAATGGAAAATGATGGATCCTGTAA 636 Query 753 GGTTAACATACTGTCCAGTGTACTCATTGAGAATGGATAAAGAACATGAAGTGCGGGTGA 812 || ||||| |||| |||||||| ||||| ||||||||||| |||||||||| | | Sbjct 637 CGTCAACATCAGTTCCACTGTACTCACTGAGACTGGATAAAGAATATGAAGTGCGCATAA 696 Query 813 GATCCAGACAACGGAGCTTTGAAAAGTACAGCGAGTTCAGCGAAGTCCTCCGTGTAATAT 872 ||||||||| || | || ||| || || | |||||||| ||| | ||| ||| | Sbjct 697 GATCCAGACTACAAAACTCTGATAAATATGGAGAGTTCAGTGAAATACTCTACATAACAC 756 Query 873 TTCCTCAGACGAACATATTGGAAGCATGTGAAGAAG 908 | |||||| | | | ||| |||||||||||| Sbjct 757 TCCCTCAGTCAAGCCCATT---TACATGTGAAGAAG 789 >gb|AF227186.1|AF227186 Cavia porcellus growth hormone receptor (GHR) mRNA, complete cds Length=2388 Score = 563 bits (624), Expect = 4e-157 Identities = 612/816 (75%), Gaps = 27/816 (3%) Strand=Plus/Plus Query 93 CAGGTATGGATCTTTGTCAGGTCTTCTTAACCTTGGCACTGGCAGTCACCAGCAGCACAT 152 ||| |||||||||||| ||| | | || ||||||||| ||| || | | |||| | | Sbjct 228 CAGCTATGGATCTTTGGCAGCTGCTGTTGACCTTGGCAGTGGTAGGCTCAAGCAATGCTT 287 Query 153 TTTCTGGAAGTGAGGCTACACCAGCTACTCTTGGCAAAGCTTCCCCAGTTCTGCAAAGAA 212 || ||| || ||||| ||| || || || ||| || |||||||||| Sbjct 288 TTGTTGGGAGAGAGGCCGTCACAGTCACCCTCAACAGAGCAAACCTGAGTCTGCAAAGAG 347 Query 213 TCAATCCAAGCCTGGGGACAAGTTCTTCTGGAAAGCCTCGATTCACCAAGTGTCGTTCCC 272 | || ||||||||| |||| ||||||||| || ||| |||||||||||| ||||| | Sbjct 348 TTAACGCAAGCCTGGAAACAAATTCTTCTGGGAACCCTAAATTCACCAAGTGCCGTTCAC 407 Query 273 CTGAACTGGAGACATTTTCATGCTACTGGACAGAAGGAGATAATCCTGATTTAAAGACCC 332 |||| || ||||| ||||||||| |||||||||| | | | || || |||||||| | Sbjct 408 CTGAGCTAGAGACTTTTTCATGCCACTGGACAGATGAGGGTCCTCATGGTTTAAAGAGCA 467 Query 333 CAGGATCTATTCAGCTGTACTATGCTAAAAGGGAAAGCCAACGACAAGCTGCAAGAATTG 392 |||||| || ||| ||| |||| |||||||| | || Sbjct 468 CAGGATTCATACAGATGTTCTATACTAAAAGGAA--------------CT---------- 503 Query 393 CTCATGAATGGACCCAGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAAAAAACA 452 |||| || || ||| |||||||||||||||||||||||||||||||||||| |||| | Sbjct 504 CTCAAGAGCAGAACCAAGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAGAAAATA 563 Query 453 GCTGTTACTTCAACTCATCATATACCTCCATTTGGATACCCTACTGCATCAAGCTAACTA 512 |||||||||| ||||||||||||||||||||||||| |||||||| |||||||||||| Sbjct 564 GCTGTTACTTTAACTCATCATATACCTCCATTTGGAAGCCCTACTGTGTCAAGCTAACTA 623 Query 513 CAAATGGTGATTTGCTGGACCAAAAATGTTTCACTGTTGACGAAATAGTGCAACCTGATC 572 ||||||| | |||| |||| |||||| |||||| ||||||||||||||||||| Sbjct 624 GTAATGGTGGTAAAGTGGATGAAAAGTGTTTCTATGTTGAAGAAATAGTGCAACCTGATC 683 Query 573 CACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGGGATTCGTGGAGACA 632 |||||| ||||||||| ||||||||| | |||| |||| || | | ||| ||| || | Sbjct 684 CACCCACTGGCCTCAATTGGACTTTAATGAACACTAGTGCGAACAGCATTTATGGGGATA 743 Query 633 TCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGGATGGATAATTCTGG 692 |||||||||| ||| |||| |||| || |||||||||| ||||||||||||||| |||| Sbjct 744 TCCAAGTGAGATGGAAACCCCCACGCAGTGCAGATGTTAAGAAGGGATGGATAATGCTGG 803 Query 693 AGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGTGATGGGCCCTATAT 752 | |||||| |||| |||| || ||||||| | |||||||| |||||| ||| || Sbjct 804 ACTATGAACTTCAAATCAAACAAACAAATGAAACTCAATGGAAAATGATGGATCCTGTAA 863 Query 753 GGTTAACATACTGTCCAGTGTACTCATTGAGAATGGATAAAGAACATGAAGTGCGGGTGA 812 || ||||| |||| |||||||| ||||| ||||||||||| |||||||||| | | Sbjct 864 CGTCAACATCAGTTCCACTGTACTCACTGAGACTGGATAAAGAATATGAAGTGCGCATAA 923 Query 813 GATCCAGACAACGGAGCTTTGAAAAGTACAGCGAGTTCAGCGAAGTCCTCCGTGTAATAT 872 ||||||||| || | || ||| || || | |||||||| ||| | ||| ||| | Sbjct 924 GATCCAGACTACAAAACTCTGATAAATATGGAGAGTTCAGTGAAATACTCTACATAACAC 983 Query 873 TTCCTCAGACGAACATATTGGAAGCATGTGAAGAAG 908 | |||||| | | | ||| |||||||||||| Sbjct 984 TCCCTCAGTCAAGCCCATT---TACATGTGAAGAAG 1016 >gb|AF238492.1|AF238492 Cavia porcellus growth hormone receptor mRNA, complete cds Length=1887 Score = 545 bits (604), Expect = 1e-151 Identities = 605/811 (74%), Gaps = 27/811 (3%) Strand=Plus/Plus Query 98 ATGGATCTTTGTCAGGTCTTCTTAACCTTGGCACTGGCAGTCACCAGCAGCACATTTTCT 157 |||||||| || ||| | | || ||||||||| ||| || | | |||| | ||| | Sbjct 1 ATGGATCTCTGGCAGCTGCTGTTGACCTTGGCAGTGGTAGGCTCAAGCAATGCTTTTGTT 60 Query 158 GGAAGTGAGGCTACACCAGCTACTCTTGGCAAAGCTTCCCCAGTTCTGCAAAGAATCAAT 217 || || ||||| ||| || || || ||| || |||||||||| | || Sbjct 61 GGGAGAGAGGCCGTCACAGTCACCCTCAACAGAGCAAACCTGAGTCTGCAAAGAGTTAAC 120 Query 218 CCAAGCCTGGGGACAAGTTCTTCTGGAAAGCCTCGATTCACCAAGTGTCGTTCCCCTGAA 277 ||||||||| |||| ||||||||| || ||| |||||||||||| ||||| ||||| Sbjct 121 GCAAGCCTGGAAACAAATTCTTCTGGGAACCCTAAATTCACCAAGTGCCGTTCACCTGAG 180 Query 278 CTGGAGACATTTTCATGCTACTGGACAGAAGGAGATAATCCTGATTTAAAGACCCCAGGA 337 || ||||| ||||||||| |||||||||| | | | ||| || |||||||| | ||||| Sbjct 181 CTAGAGACTTTTTCATGCCACTGGACAGATGAGGGTCATCATGGTTTAAAGAGCACAGGA 240 Query 338 TCTATTCAGCTGTACTATGCTAAAAGGGAAAGCCAACGACAAGCTGCAAGAATTGCTCAT 397 | || ||| ||| |||| |||||||| | || |||| Sbjct 241 TTCATACAGATGTTCTATACTAAAAGGAA--------------CT----------CTCAA 276 Query 398 GAATGGACCCAGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAAAAAACAGCTGT 457 || || ||| |||||||||||||||||||||||||||||||||||| |||| |||||| Sbjct 277 GAGCAGAACCAAGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAGAAAATAGCTGT 336 Query 458 TACTTCAACTCATCATATACCTCCATTTGGATACCCTACTGCATCAAGCTAACTACAAAT 517 ||||| ||||||||||||||||||||||||| |||||||| |||||||||||| ||| Sbjct 337 TACTTTAACTCATCATATACCTCCATTTGGAAGCCCTACTGTGTCAAGCTAACTAGTAAT 396 Query 518 GGTGATTTGCTGGACCAAAAATGTTTCACTGTTGACGAAATAGTGCAACCTGATCCACCC 577 |||| | |||| |||| |||||| |||||| |||||||| |||||||||||||| Sbjct 397 GGTGGTAAAGTGGATGAAAAGTGTTTCTATGTTGAGGAAATAGTCAAACCTGATCCACCC 456 Query 578 ATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGGGATTCGTGGAGACATCCAA 637 | ||||||||| ||||||||| | |||| |||| ||| | | | ||| || |||||| Sbjct 457 ACTGGCCTCAATTGGACTTTAATGAACACTAGTGCGACAGCAACTTATGGGGATATCCAA 516 Query 638 GTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGGATGGATAATTCTGGAGTAT 697 ||||| ||| | ||||||| || |||||||||| ||||||||||||||| ||||| ||| Sbjct 517 GTGAGATGGAAGCCACCACGCAGTGCAGATGTTAAGAAGGGATGGATAATGCTGGACTAT 576 Query 698 GAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGTGATGGGCCCTATATGGTTA 757 ||| |||| |||| || ||||||| | |||||||| |||||| ||| || || | Sbjct 577 GAACTTCAAATCAAACAAACAAATGAAACTCAATGGAAAATGATGGATCCTGTAACGTCA 636 Query 758 ACATACTGTCCAGTGTACTCATTGAGAATGGATAAAGAACATGAAGTGCGGGTGAGATCC 817 |||| |||| |||||||| ||||| ||||||||||| |||||||||| | |||||| Sbjct 637 ACATCAGTTCCACTGTACTCACTGAGACTGGATAAAGAATATGAAGTGCGCATAAGATCC 696 Query 818 AGACAACGGAGCTTTGAAAAGTACAGCGAGTTCAGCGAAGTCCTCCGTGTAATATTTCCT 877 |||| || | || ||| || || | |||||||| ||| | ||| ||| | | ||| Sbjct 697 AGACTACAAAACTCTGATAAATATGGAGAGTTCAGTGAAATACTCTACATAACACTCCCT 756 Query 878 CAGACGAACATATTGGAAGCATGTGAAGAAG 908 ||| | | | ||| |||||||||||| Sbjct 757 CAGTCAAGCCCATT---TACATGTGAAGAAG 784 >dbj|AK053579.1| UniGene infoGeoGene info Mus musculus 0 day neonate eyeball cDNA, RIKEN full-length enriched library, clone:E130111P21 product:growth hormone receptor, full insert sequence Length=1795 Score = 544 bits (602), Expect = 3e-151 Identities = 301/301 (100%), Gaps = 0/301 (0%) Strand=Plus/Plus Query 87 AGGTCTCAGGTATGGATCTTTGTCAGGTCTTCTTAACCTTGGCACTGGCAGTCACCAGCA 146 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 213 AGGTCTCAGGTATGGATCTTTGTCAGGTCTTCTTAACCTTGGCACTGGCAGTCACCAGCA 272 Query 147 GCACATTTTCTGGAAGTGAGGCTACACCAGCTACTCTTGGCAAAGCTTCCCCAGTTCTGC 206 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 273 GCACATTTTCTGGAAGTGAGGCTACACCAGCTACTCTTGGCAAAGCTTCCCCAGTTCTGC 332 Query 207 AAAGAATCAATCCAAGCCTGGGGACAAGTTCTTCTGGAAAGCCTCGATTCACCAAGTGTC 266 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 333 AAAGAATCAATCCAAGCCTGGGGACAAGTTCTTCTGGAAAGCCTCGATTCACCAAGTGTC 392 Query 267 GTTCCCCTGAACTGGAGACATTTTCATGCTACTGGACAGAAGGAGATAATCCTGATTTAA 326 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 393 GTTCCCCTGAACTGGAGACATTTTCATGCTACTGGACAGAAGGAGATAATCCTGATTTAA 452 Query 327 AGACCCCAGGATCTATTCAGCTGTACTATGCTAAAAGGGAAAGCCAACGACAAGCTGCAA 386 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 453 AGACCCCAGGATCTATTCAGCTGTACTATGCTAAAAGGGAAAGCCAACGACAAGCTGCAA 512 Query 387 G 387 | Sbjct 513 G 513 >emb|X70041.1|BTGHR UniGene infoGene info B.taurus mRNA for growth hormone receptor Length=1940 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 466 bits (516), Expect = 8e-128 Identities = 405/502 (80%), Gaps = 3/502 (0%) Strand=Plus/Plus Query 407 CAGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAAAAAACAGCTGTTACTTCAAC 466 || ||||||||||||||||| ||||| ||||||||||| |||||||||||||||| || Sbjct 292 CAAGAATGGAAAGAATGCCCCGATTACGTCTCTGCTGGTGAAAACAGCTGTTACTTTAAT 351 Query 467 TCATCATATACCTCCATTTGGATACCCTACTGCATCAAGCTAACTACAAATGGTGATTTG 526 || || ||||||||| | |||| |||||||||||||||||||||| ||||| | | | Sbjct 352 TCGTCTTATACCTCCGTGTGGACCCCCTACTGCATCAAGCTAACTAGCAATGGCGGTATT 411 Query 527 CTGGACCAAAAATGTTTCACTGTTGACGAAATAGTGCAACCTGATCCACCCATTGGCCTC 586 |||| || || |||||| ||||||| || ||||| ||||| ||||||||| |||||||| Sbjct 412 GTGGATCATAAGTGTTTCTCTGTTGAGGACATAGTACAACCAGATCCACCCGTTGGCCTC 471 Query 587 AACTGGACTTTACTAAACATTAGTTTGACCGGGATTCGTGGAGACATCCAAGTGAGTTGG 646 ||||||||| |||| ||||| |||||||| | ||||| || ||||||| ||||| ||| Sbjct 472 AACTGGACTCTACTGAACATCAGTTTGACGGAGATTCATGCCGACATCCTAGTGAAATGG 531 Query 647 CAACCACCACCCAATGCAGATGTTCTGAAGGGATGGATAATTCTGGAGTATGAAATTCAG 706 |||||||||||||| |||||||| || |||||||||||| |||||||||||| | || Sbjct 532 GAACCACCACCCAATACAGATGTTAAGATGGGATGGATAATCCTGGAGTATGAACTGCAC 591 Query 707 TACAAAGAAGTAAATGAATCAAAATGGAAAGTGATGGGCCCTATATGGTTAACATACTGT 766 || |||||| ||||||| | | |||||| |||||| |||| || | |||||| | Sbjct 592 TATAAAGAACTAAATGAGACCCAGTGGAAAATGATGGACCCTTTAATGGTAACATCAGTT 651 Query 767 CCAGTGTACTCATTGAGAATGGATAAAGAACATGAAGTGCGGGTGAGATCCAGACAACGG 826 || ||||||| |||||| |||||||||| |||||||||| |||||| |||||||||| Sbjct 652 CCGATGTACTCGTTGAGACTGGATAAAGAGTATGAAGTGCGTGTGAGAACCAGACAACGA 711 Query 827 AGCTTTGAAAAGTACAGCGAGTTCAGCGAAGTCCTCCGTGTAATATTTCCTCAGACGAAC 886 | | |||||| || || ||||||| || || |||| ||| ||||||||||| |||| Sbjct 712 AACACTGAAAAATATGGCAAGTTCAGTGAGGTGCTCCTGATAACATTTCCTCAGATGAAC 771 Query 887 ATATTGGAAGCATGTGAAGAAG 908 || ||||||||||||| Sbjct 772 CCAT---CTGCATGTGAAGAAG 790 Score = 192 bits (212), Expect = 3e-45 Identities = 207/274 (75%), Gaps = 0/274 (0%) Strand=Plus/Plus Query 93 CAGGTATGGATCTTTGTCAGGTCTTCTTAACCTTGGCACTGGCAGTCACCAGCAGCACAT 152 ||||||||||||| || ||| | | || ||||||||| |||||| | |||| | | Sbjct 14 CAGGTATGGATCTCTGGCAGCTGCTGTTGACCTTGGCAGTGGCAGGCTCCAGTGATGCTT 73 Query 153 TTTCTGGAAGTGAGGCTACACCAGCTACTCTTGGCAAAGCTTCCCCAGTTCTGCAAAGAA 212 ||||||| ||||| || ||||||||| |||| || ||| || | |||||| | | Sbjct 74 TTTCTGGGAGTGAAGCCACACCAGCTTTCCTTGTCAGAGCATCTCAGAGTCTGCAGATAC 133 Query 213 TCAATCCAAGCCTGGGGACAAGTTCTTCTGGAAAGCCTCGATTCACCAAGTGTCGTTCCC 272 | ||||| ||| | ||||| ||||||||| || ||| |||||||||||| ||||| | Sbjct 134 TATATCCAGTCCTAGAGACAAATTCTTCTGGGAATCCTAAATTCACCAAGTGCCGTTCAC 193 Query 273 CTGAACTGGAGACATTTTCATGCTACTGGACAGAAGGAGATAATCCTGATTTAAAGACCC 332 ||||||||||||| || ||||| |||||||||| || | ||||| |||| ||| || Sbjct 194 CTGAACTGGAGACTTTCTCATGTCACTGGACAGATGGGGCTAATCACAGTTTACAGAGCC 253 Query 333 CAGGATCTATTCAGCTGTACTATGCTAAAAGGGA 366 |||||||| | ||| ||| |||| | |||||| Sbjct 254 CAGGATCTGTACAGATGTTCTATATCAGAAGGGA 287 >gb|AY748827.1| UniGene infoGene info Bos taurus growth hormone receptor mRNA, complete cds Length=2026 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 462 bits (512), Expect = 9e-127 Identities = 404/502 (80%), Gaps = 3/502 (0%) Strand=Plus/Plus Query 407 CAGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAAAAAACAGCTGTTACTTCAAC 466 || ||||||||||||||||| ||||| ||||||||||| |||||||||||||||| || Sbjct 352 CAAGAATGGAAAGAATGCCCCGATTACGTCTCTGCTGGTGAAAACAGCTGTTACTTTAAT 411 Query 467 TCATCATATACCTCCATTTGGATACCCTACTGCATCAAGCTAACTACAAATGGTGATTTG 526 || || |||||||| | |||| |||||||||||||||||||||| ||||| | | | Sbjct 412 TCGTCTTATACCTCTGTGTGGACCCCCTACTGCATCAAGCTAACTAGCAATGGCGGTATT 471 Query 527 CTGGACCAAAAATGTTTCACTGTTGACGAAATAGTGCAACCTGATCCACCCATTGGCCTC 586 |||| || || |||||| ||||||| || ||||| ||||| ||||||||| |||||||| Sbjct 472 GTGGATCATAAGTGTTTCTCTGTTGAGGACATAGTACAACCAGATCCACCCGTTGGCCTC 531 Query 587 AACTGGACTTTACTAAACATTAGTTTGACCGGGATTCGTGGAGACATCCAAGTGAGTTGG 646 ||||||||| |||| ||||| |||||||| | ||||| || ||||||| ||||| ||| Sbjct 532 AACTGGACTCTACTGAACATCAGTTTGACAGAGATTCATGCCGACATCCTAGTGAAATGG 591 Query 647 CAACCACCACCCAATGCAGATGTTCTGAAGGGATGGATAATTCTGGAGTATGAAATTCAG 706 |||||||||||||| |||||||| || |||||||||||| |||||||||||| | || Sbjct 592 GAACCACCACCCAATACAGATGTTAAGATGGGATGGATAATCCTGGAGTATGAACTGCAC 651 Query 707 TACAAAGAAGTAAATGAATCAAAATGGAAAGTGATGGGCCCTATATGGTTAACATACTGT 766 || |||||| ||||||| | | |||||| |||||| |||| || | |||||| | Sbjct 652 TATAAAGAACTAAATGAGACCCAGTGGAAAATGATGGACCCTTTAATGGTAACATCAGTT 711 Query 767 CCAGTGTACTCATTGAGAATGGATAAAGAACATGAAGTGCGGGTGAGATCCAGACAACGG 826 || ||||||| |||||| |||||||||| |||||||||| |||||| |||||||||| Sbjct 712 CCGATGTACTCGTTGAGACTGGATAAAGAGTATGAAGTGCGTGTGAGAACCAGACAACGA 771 Query 827 AGCTTTGAAAAGTACAGCGAGTTCAGCGAAGTCCTCCGTGTAATATTTCCTCAGACGAAC 886 | | |||||| || || ||||||| || || |||| ||| ||||||||||| |||| Sbjct 772 AACACTGAAAAATATGGCAAGTTCAGTGAGGTGCTCCTGATAACATTTCCTCAGATGAAC 831 Query 887 ATATTGGAAGCATGTGAAGAAG 908 || ||||||||||||| Sbjct 832 CCAT---CTGCATGTGAAGAAG 850 Score = 192 bits (212), Expect = 3e-45 Identities = 207/274 (75%), Gaps = 0/274 (0%) Strand=Plus/Plus Query 93 CAGGTATGGATCTTTGTCAGGTCTTCTTAACCTTGGCACTGGCAGTCACCAGCAGCACAT 152 ||||||||||||| || ||| | | || ||||||||| |||||| | |||| | | Sbjct 74 CAGGTATGGATCTCTGGCAGCTGCTGTTGACCTTGGCAGTGGCAGGCTCCAGTGATGCTT 133 Query 153 TTTCTGGAAGTGAGGCTACACCAGCTACTCTTGGCAAAGCTTCCCCAGTTCTGCAAAGAA 212 ||||||| ||||| || ||||||||| |||| || ||| || | |||||| | | Sbjct 134 TTTCTGGGAGTGAAGCCACACCAGCTTTCCTTGTCAGAGCATCTCAGAGTCTGCAGATAC 193 Query 213 TCAATCCAAGCCTGGGGACAAGTTCTTCTGGAAAGCCTCGATTCACCAAGTGTCGTTCCC 272 | ||||| ||| | ||||| ||||||||| || ||| |||||||||||| ||||| | Sbjct 194 TATATCCAGTCCTAGAGACAAATTCTTCTGGGAATCCTAAATTCACCAAGTGCCGTTCAC 253 Query 273 CTGAACTGGAGACATTTTCATGCTACTGGACAGAAGGAGATAATCCTGATTTAAAGACCC 332 ||||||||||||| || ||||| |||||||||| || | ||||| |||| ||| || Sbjct 254 CTGAACTGGAGACTTTCTCATGTCACTGGACAGATGGGGCTAATCACAGTTTACAGAGCC 313 Query 333 CAGGATCTATTCAGCTGTACTATGCTAAAAGGGA 366 |||||||| | ||| ||| |||| | |||||| Sbjct 314 CAGGATCTGTACAGATGTTCTATATCAGAAGGGA 347 >ref|NM_176608.1| UniGene infoGene info Bos taurus growth hormone receptor (GHR), mRNA gb|AF044258.1| UniGene infoGene info Bos taurus somatotropin receptor 1B precursor, mRNA, complete cds Length=2014 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 462 bits (512), Expect = 9e-127 Identities = 404/502 (80%), Gaps = 3/502 (0%) Strand=Plus/Plus Query 407 CAGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAAAAAACAGCTGTTACTTCAAC 466 || ||||||||||||||||| ||||| ||||||||||| |||||||||||||||| || Sbjct 311 CAAGAATGGAAAGAATGCCCCGATTACGTCTCTGCTGGTGAAAACAGCTGTTACTTTAAT 370 Query 467 TCATCATATACCTCCATTTGGATACCCTACTGCATCAAGCTAACTACAAATGGTGATTTG 526 || || |||||||| | |||| |||||||||||||||||||||| ||||| | | | Sbjct 371 TCGTCTTATACCTCTGTGTGGACCCCCTACTGCATCAAGCTAACTAGCAATGGCGGTATT 430 Query 527 CTGGACCAAAAATGTTTCACTGTTGACGAAATAGTGCAACCTGATCCACCCATTGGCCTC 586 |||| || || |||||| ||||||| || ||||| ||||| ||||||||| |||||||| Sbjct 431 GTGGATCATAAGTGTTTCTCTGTTGAGGACATAGTACAACCAGATCCACCCGTTGGCCTC 490 Query 587 AACTGGACTTTACTAAACATTAGTTTGACCGGGATTCGTGGAGACATCCAAGTGAGTTGG 646 ||||||||| |||| ||||| |||||||| | ||||| || ||||||| ||||| ||| Sbjct 491 AACTGGACTCTACTGAACATCAGTTTGACAGAGATTCATGCCGACATCCTAGTGAAATGG 550 Query 647 CAACCACCACCCAATGCAGATGTTCTGAAGGGATGGATAATTCTGGAGTATGAAATTCAG 706 |||||||||||||| |||||||| || |||||||||||| |||||||||||| | || Sbjct 551 GAACCACCACCCAATACAGATGTTAAGATGGGATGGATAATCCTGGAGTATGAACTGCAC 610 Query 707 TACAAAGAAGTAAATGAATCAAAATGGAAAGTGATGGGCCCTATATGGTTAACATACTGT 766 || |||||| ||||||| | | |||||| |||||| |||| || | |||||| | Sbjct 611 TATAAAGAACTAAATGAGACCCAGTGGAAAATGATGGACCCTTTAATGGTAACATCAGTT 670 Query 767 CCAGTGTACTCATTGAGAATGGATAAAGAACATGAAGTGCGGGTGAGATCCAGACAACGG 826 || ||||||| |||||| |||||||||| |||||||||| |||||| |||||||||| Sbjct 671 CCGATGTACTCGTTGAGACTGGATAAAGAGTATGAAGTGCGTGTGAGAACCAGACAACGA 730 Query 827 AGCTTTGAAAAGTACAGCGAGTTCAGCGAAGTCCTCCGTGTAATATTTCCTCAGACGAAC 886 | | |||||| || || ||||||| || || |||| ||| ||||||||||| |||| Sbjct 731 AACACTGAAAAATATGGCAAGTTCAGTGAGGTGCTCCTGATAACATTTCCTCAGATGAAC 790 Query 887 ATATTGGAAGCATGTGAAGAAG 908 || ||||||||||||| Sbjct 791 CCAT---CTGCATGTGAAGAAG 809 Score = 192 bits (212), Expect = 3e-45 Identities = 207/274 (75%), Gaps = 0/274 (0%) Strand=Plus/Plus Query 93 CAGGTATGGATCTTTGTCAGGTCTTCTTAACCTTGGCACTGGCAGTCACCAGCAGCACAT 152 ||||||||||||| || ||| | | || ||||||||| |||||| | |||| | | Sbjct 33 CAGGTATGGATCTCTGGCAGCTGCTGTTGACCTTGGCAGTGGCAGGCTCCAGTGATGCTT 92 Query 153 TTTCTGGAAGTGAGGCTACACCAGCTACTCTTGGCAAAGCTTCCCCAGTTCTGCAAAGAA 212 ||||||| ||||| || ||||||||| |||| || ||| || | |||||| | | Sbjct 93 TTTCTGGGAGTGAAGCCACACCAGCTTTCCTTGTCAGAGCATCTCAGAGTCTGCAGATAC 152 Query 213 TCAATCCAAGCCTGGGGACAAGTTCTTCTGGAAAGCCTCGATTCACCAAGTGTCGTTCCC 272 | ||||| ||| | ||||| ||||||||| || ||| |||||||||||| ||||| | Sbjct 153 TATATCCAGTCCTAGAGACAAATTCTTCTGGGAATCCTAAATTCACCAAGTGCCGTTCAC 212 Query 273 CTGAACTGGAGACATTTTCATGCTACTGGACAGAAGGAGATAATCCTGATTTAAAGACCC 332 ||||||||||||| || ||||| |||||||||| || | ||||| |||| ||| || Sbjct 213 CTGAACTGGAGACTTTCTCATGTCACTGGACAGATGGGGCTAATCACAGTTTACAGAGCC 272 Query 333 CAGGATCTATTCAGCTGTACTATGCTAAAAGGGA 366 |||||||| | ||| ||| |||| | |||||| Sbjct 273 CAGGATCTGTACAGATGTTCTATATCAGAAGGGA 306 >ref|NM_001009323.1| UniGene infoGene info Ovis aries growth hormone receptor (GHR), mRNA gb|M82912.1|SHPGHRPPP UniGene infoGene info Ovine growth hormone receptor prepropolypeptide, complete cds Length=2230 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 462 bits (512), Expect = 9e-127 Identities = 404/502 (80%), Gaps = 3/502 (0%) Strand=Plus/Plus Query 407 CAGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAAAAAACAGCTGTTACTTCAAC 466 || ||||||||||||||||| ||||| ||||||||||| |||||||||||||||| || Sbjct 469 CAAGAATGGAAAGAATGCCCCGATTACGTCTCTGCTGGTGAAAACAGCTGTTACTTTAAT 528 Query 467 TCATCATATACCTCCATTTGGATACCCTACTGCATCAAGCTAACTACAAATGGTGATTTG 526 || |||||||||||| | |||| ||||| |||||||||||||||| ||||||| | | Sbjct 529 TCGTCATATACCTCCGTGTGGACCCCCTATTGCATCAAGCTAACTAGCAATGGTGGTATT 588 Query 527 CTGGACCAAAAATGTTTCACTGTTGACGAAATAGTGCAACCTGATCCACCCATTGGCCTC 586 |||| || || |||||| ||||||| || ||||| ||||| ||||||||| |||||||| Sbjct 589 GTGGATCATAAGTGTTTCTCTGTTGAGGACATAGTACAACCAGATCCACCCGTTGGCCTC 648 Query 587 AACTGGACTTTACTAAACATTAGTTTGACCGGGATTCGTGGAGACATCCAAGTGAGTTGG 646 ||||||||| | || ||||| |||||||| | ||||| || ||||||| ||||| ||| Sbjct 649 AACTGGACTCTGCTGAACATCAGTTTGACGGAGATTCATGCCGACATCCTAGTGAAATGG 708 Query 647 CAACCACCACCCAATGCAGATGTTCTGAAGGGATGGATAATTCTGGAGTATGAAATTCAG 706 |||||||||||||| |||||||| || |||||||||||| |||||||||||| | || Sbjct 709 GAACCACCACCCAATACAGATGTTAAGATGGGATGGATAATCCTGGAGTATGAACTGCAC 768 Query 707 TACAAAGAAGTAAATGAATCAAAATGGAAAGTGATGGGCCCTATATGGTTAACATACTGT 766 || |||||| ||||||| | | |||||| |||||| |||| ||| | |||||| | Sbjct 769 TATAAAGAACTAAATGAGACCCAGTGGAAAATGATGGACCCTTTATTGGTAACATCAGTT 828 Query 767 CCAGTGTACTCATTGAGAATGGATAAAGAACATGAAGTGCGGGTGAGATCCAGACAACGG 826 || ||||||| |||||| ||||||| || |||||||||| |||||| || ||||||| Sbjct 829 CCGATGTACTCGTTGAGACTGGATAAGGAGTATGAAGTGCGTGTGAGAACCCGACAACGA 888 Query 827 AGCTTTGAAAAGTACAGCGAGTTCAGCGAAGTCCTCCGTGTAATATTTCCTCAGACGAAC 886 | | |||||| || || ||||||| || || |||| ||| ||||||||||| |||| Sbjct 889 AACACTGAAAAATATGGCAAGTTCAGTGAGGTGCTCCTGATAACATTTCCTCAGATGAAC 948 Query 887 ATATTGGAAGCATGTGAAGAAG 908 || ||||||||||||| Sbjct 949 CCAT---CTGCATGTGAAGAAG 967 Score = 183 bits (202), Expect = 1e-42 Identities = 205/274 (74%), Gaps = 0/274 (0%) Strand=Plus/Plus Query 93 CAGGTATGGATCTTTGTCAGGTCTTCTTAACCTTGGCACTGGCAGTCACCAGCAGCACAT 152 ||||||||||||| || ||| | | || ||||||||| |||||| | |||| | | Sbjct 191 CAGGTATGGATCTCTGGCAGCTGCTGTTGACCTTGGCAGTGGCAGGCTCCAGTGATGCTT 250 Query 153 TTTCTGGAAGTGAGGCTACACCAGCTACTCTTGGCAAAGCTTCCCCAGTTCTGCAAAGAA 212 ||||||| ||||| || ||||||||| ||| || ||| || | |||||| | | Sbjct 251 TTTCTGGGAGTGAAGCCACACCAGCTTTCTTTGTCAGAGCATCTCAGAGTCTGCAGATAC 310 Query 213 TCAATCCAAGCCTGGGGACAAGTTCTTCTGGAAAGCCTCGATTCACCAAGTGTCGTTCCC 272 | ||||| |||| | ||||| |||||| || || | | |||||||||||| ||||| | Sbjct 311 TATATCCAGGCCTAGAGACAAATTCTTCCGGGAATCTTAAATTCACCAAGTGCCGTTCAC 370 Query 273 CTGAACTGGAGACATTTTCATGCTACTGGACAGAAGGAGATAATCCTGATTTAAAGACCC 332 ||||||||||||| || ||||| |||||||||| || | ||||| |||| ||| || Sbjct 371 CTGAACTGGAGACTTTCTCATGTCACTGGACAGATGGGGCTAATCACAGTTTACAGAGCC 430 Query 333 CAGGATCTATTCAGCTGTACTATGCTAAAAGGGA 366 |||||||| | ||| ||| |||| | |||||| Sbjct 431 CAGGATCTGTACAGATGTTCTATATCAGAAGGGA 464 >gb|AY608917.1| Bubalus bubalis growth hormone receptor-like (GHR) mRNA, complete sequence Length=1904 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 457 bits (506), Expect = 4e-125 Identities = 403/502 (80%), Gaps = 3/502 (0%) Strand=Plus/Plus Query 407 CAGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAAAAAACAGCTGTTACTTCAAC 466 || ||||||||||||||||| ||||| ||||||||||| |||||||||||||||| || Sbjct 274 CAAGAATGGAAAGAATGCCCCGATTACGTCTCTGCTGGTGAAAACAGCTGTTACTTTAAT 333 Query 467 TCATCATATACCTCCATTTGGATACCCTACTGCATCAAGCTAACTACAAATGGTGATTTG 526 || || |||||||| | |||| |||||||||||||||||||||| |||||||| | | Sbjct 334 TCGTCTTATACCTCTGTGTGGACCCCCTACTGCATCAAGCTAACTAGAAATGGTGGTATT 393 Query 527 CTGGACCAAAAATGTTTCACTGTTGACGAAATAGTGCAACCTGATCCACCCATTGGCCTC 586 |||| || || |||||| ||||||| || ||||| ||||| ||||||||| | |||||| Sbjct 394 GTGGATCATAAGTGTTTCTCTGTTGAGGACATAGTACAACCAGATCCACCCGTGGGCCTC 453 Query 587 AACTGGACTTTACTAAACATTAGTTTGACCGGGATTCGTGGAGACATCCAAGTGAGTTGG 646 ||||||||| |||| ||||| |||||||| | ||||| || ||||||| ||||| ||| Sbjct 454 AACTGGACTCTACTGAACATCAGTTTGACGGAGATTCATGCCGACATCCTAGTGAAATGG 513 Query 647 CAACCACCACCCAATGCAGATGTTCTGAAGGGATGGATAATTCTGGAGTATGAAATTCAG 706 |||||||||||||| |||||||| || |||||||||||| |||||||||||| | || Sbjct 514 GAACCACCACCCAATACAGATGTTAAGATGGGATGGATAATCCTGGAGTATGAACTGCAC 573 Query 707 TACAAAGAAGTAAATGAATCAAAATGGAAAGTGATGGGCCCTATATGGTTAACATACTGT 766 || |||||| | ||||| | | |||||| |||||| |||| || | |||||| | Sbjct 574 TATAAAGAACTGAATGAGACCCAGTGGAAAATGATGGACCCTTTAATGGTAACATCAGTT 633 Query 767 CCAGTGTACTCATTGAGAATGGATAAAGAACATGAAGTGCGGGTGAGATCCAGACAACGG 826 || ||||||| |||||| |||||||||| |||||||||| |||||| |||||||||| Sbjct 634 CCGATGTACTCGTTGAGACTGGATAAAGAGTATGAAGTGCGTGTGAGAACCAGACAACGA 693 Query 827 AGCTTTGAAAAGTACAGCGAGTTCAGCGAAGTCCTCCGTGTAATATTTCCTCAGACGAAC 886 | | |||||| || || ||||||| || || |||| ||| ||||||||||| || | Sbjct 694 AACACTGAAAAATATGGCAAGTTCAGTGAGGTGCTCCTGATAACATTTCCTCAGATGAGC 753 Query 887 ATATTGGAAGCATGTGAAGAAG 908 || ||||||||||||| Sbjct 754 CCAT---CTGCATGTGAAGAAG 772 Score = 179 bits (198), Expect = 2e-41 Identities = 201/269 (74%), Gaps = 0/269 (0%) Strand=Plus/Plus Query 98 ATGGATCTTTGTCAGGTCTTCTTAACCTTGGCACTGGCAGTCACCAGCAGCACATTTTCT 157 |||||||| || ||| | | || ||||||||| |||||| | |||| | |||||| Sbjct 1 ATGGATCTCTGGCAGCTGCTGTTGACCTTGGCAGTGGCAGGCTCCAGTGATGCTTTTTCT 60 Query 158 GGAAGTGAGGCTACACCAGCTACTCTTGGCAAAGCTTCCCCAGTTCTGCAAAGAATCAAT 217 || ||||| || ||||||||| |||| || ||| || | |||||| | | | || Sbjct 61 GGGAGTGAAGCCACACCAGCTTTCCTTGTCAGAGCATCTCAGAGTCTGCAGATACTATAT 120 Query 218 CCAAGCCTGGGGACAAGTTCTTCTGGAAAGCCTCGATTCACCAAGTGTCGTTCCCCTGAA 277 ||| ||| | ||||| ||||||||| || ||| |||||||||||| ||||| |||| | Sbjct 121 CCAGTCCTAGAGACAAATTCTTCTGGGAATCCTAAATTCACCAAGTGCCGTTCACCTGGA 180 Query 278 CTGGAGACATTTTCATGCTACTGGACAGAAGGAGATAATCCTGATTTAAAGACCCCAGGA 337 |||||||| || ||||| |||||||||| || | ||||| ||| ||| ||||||| Sbjct 181 CTGGAGACTTTCTCATGTCACTGGACAGATGGGGCTAATCACAGTTTGCAGAGCCCAGGA 240 Query 338 TCTATTCAGCTGTACTATGCTAAAAGGGA 366 ||| | ||| ||| |||| | | |||||| Sbjct 241 TCTGTACAGATGTTCTATACCAGAAGGGA 269 >gb|AF467545.1| UniGene info Trichosurus vulpecula growth hormone receptor mRNA, partial cds Length=1705 Score = 419 bits (464), Expect = 1e-113 Identities = 380/476 (79%), Gaps = 2/476 (0%) Strand=Plus/Plus Query 410 GAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAAAAAACAGCTGTTACTTCAACTCA 469 |||||||||||||||||||||||||||||||||||| ||||||||||||| ||||| ||| Sbjct 83 GAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAGAAAACAGCTGTTATTTCAATTCA 142 Query 470 TCATATACCTCCATTTGGATACCCTACTGCATCAAGCTAACTACAAATGGTGATTTGCTG 529 ||||||||||||||||||| |||||| || |||||||||| | | | || || | || Sbjct 143 TCATATACCTCCATTTGGACACCCTATTGTATCAAGCTAAGGAATATTAGTCATGAGTTG 202 Query 530 GACCAAAAATGTTTCACTGTTGACGAAATAGTGCAACCTGATCCACCCATTGGCCTCAAC 589 || ||| ||||||||||||||| |||||||| ||||| ||||||||||||||||||||| Sbjct 203 GAGAAAAGATGTTTCACTGTTGATGAAATAGTACAACCAGATCCACCCATTGGCCTCAAC 262 Query 590 TGGACTTTACTAAACATTAGTTTGACCGGGATTCGTGGAGACATCCAAGTGAGTTGGCAA 649 |||||||| || |||| || | || ||||| | || |||||||| ||||| ||| Sbjct 263 TGGACTTTGCTGAACACCAGCCTCACGGGGATCCATGCCGACATCCAGGTGAGATGGGGG 322 Query 650 CCACCACCCAATGCAGATGTTCTGAAGGGATGGATAATTCTGGAGTATGAAATTCAGTAC 709 ||||| |||||||||||||||| ||| |||||||| | |||||||||| |||||||| Sbjct 323 CCACCTCCCAATGCAGATGTTCAGAAAGGATGGATCCTCTTGGAGTATGAGCTTCAGTAC 382 Query 710 AAAGAAGTAAATGAATCAAAATGGAAAGTGATGGGCCCTATATGGTTAACATACTG-TCC 768 |||||| ||||||| | |||||||| ||||| | || | | |||| ||| ||| Sbjct 383 AAAGAAATAAATGACACCCAATGGAAAAAGATGGATCTCGTACGCTCTACAT-CTGTTCC 441 Query 769 AGTGTACTCATTGAGAATGGATAAAGAACATGAAGTGCGGGTGAGATCCAGACAACGGAG 828 ||||||||| |||| |||||| |||| ||||| | || || |||||||||||||| | Sbjct 442 AGTGTACTCCCTGAGGTTGGATAGAGAATATGAAATACGAGTCAGATCCAGACAACGTAC 501 Query 829 CTTTGAAAAGTACAGCGAGTTCAGCGAAGTCCTCCGTGTAATATTTCCTCAGACGA 884 || || || | | |||||||| ||| | || ||||| ||||| |||| || Sbjct 502 CTCGGATAAATTTGGGGAGTTCAGTGAAATACTTTATGTAACTTTTCCCCAGATGA 557 >ref|NM_001032976.1| UniGene infoGene info Monodelphis domestica growth hormone receptor (GHR), mRNA gb|AF238491.1|AF238491 UniGene infoGene info Monodelphis domestica growth hormone receptor (GHR) mRNA, complete cds Length=1827 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 405 bits (448), Expect = 2e-109 Identities = 377/476 (79%), Gaps = 2/476 (0%) Strand=Plus/Plus Query 410 GAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAAAAAACAGCTGTTACTTCAACTCA 469 || |||||||||||||| |||||||||||||||||| ||||||||||||| ||||| ||| Sbjct 205 GAGTGGAAAGAATGCCCCGATTATGTCTCTGCTGGAGAAAACAGCTGTTATTTCAATTCA 264 Query 470 TCATATACCTCCATTTGGATACCCTACTGCATCAAGCTAACTACAAATGGTGATTTGCTG 529 ||||||||||||||||||| |||||| || |||||||| | | | | || || | || Sbjct 265 TCATATACCTCCATTTGGACACCCTATTGTATCAAGCTGAGAAATATTAGTCATGAGTTG 324 Query 530 GACCAAAAATGTTTCACTGTTGACGAAATAGTGCAACCTGATCCACCCATTGGCCTCAAC 589 || ||| |||||||||||||| |||||||| ||||| ||||||||||||||||||||| Sbjct 325 GAGAAAAGGTGTTTCACTGTTGATGAAATAGTACAACCAGATCCACCCATTGGCCTCAAC 384 Query 590 TGGACTTTACTAAACATTAGTTTGACCGGGATTCGTGGAGACATCCAAGTGAGTTGGCAA 649 |||||||| || |||| || |||| | || | || |||||||| ||||| ||| Sbjct 385 TGGACTTTGCTGAACACCAGCCTGACAGCAATCCATGCCGACATCCAGGTGAGATGGGGG 444 Query 650 CCACCACCCAATGCAGATGTTCTGAAGGGATGGATAATTCTGGAGTATGAAATTCAGTAC 709 ||||| |||||||||||||||| ||| |||||||| || |||| |||||| |||| ||| Sbjct 445 CCACCTCCCAATGCAGATGTTCAGAAAGGATGGATTCTTTTGGAATATGAACTTCAATAC 504 Query 710 AAAGAAGTAAATGAATCAAAATGGAAAGTGATGGGCCCTATATGGTTAACATACTGT-CC 768 |||||| ||||||| | |||||||| ||||| | || | | |||| |||| || Sbjct 505 AAAGAAATAAATGATACCCAATGGAAAAAGATGGAACTCGTACGCTCTACAT-CTGTCCC 563 Query 769 AGTGTACTCATTGAGAATGGATAAAGAACATGAAGTGCGGGTGAGATCCAGACAACGGAG 828 ||||||||| ||||| |||||| |||| ||||| | || || ||||| |||||||| | Sbjct 564 AGTGTACTCCTTGAGGTTGGATAGAGAATATGAAATACGAGTCAGATCAAGACAACGTAC 623 Query 829 CTTTGAAAAGTACAGCGAGTTCAGCGAAGTCCTCCGTGTAATATTTCCTCAGACGA 884 || ||||| | | |||||||| ||| | || ||||| |||||| |||| || Sbjct 624 CTCAGAAAAATTTGGGGAGTTCAGTGAAATACTTTATGTAACATTTCCCCAGATGA 679 Score = 73.4 bits (80), Expect = 2e-09 Identities = 58/70 (82%), Gaps = 0/70 (0%) Strand=Plus/Plus Query 237 CTTCTGGAAAGCCTCGATTCACCAAGTGTCGTTCCCCTGAACTGGAGACATTTTCATGCT 296 ||||||| ||||||| | || ||||| ||||| || ||||| ||||| |||||||||| Sbjct 74 CTTCTGGGAAGCCTCAGTATACTAAGTGCCGTTCACCCGAACTAGAGACGTTTTCATGCT 133 Query 297 ACTGGACAGA 306 ||||||| || Sbjct 134 ACTGGACCGA 143 >gb|AC161799.5| Download subject sequence spanning the HSP Mus musculus chromosome 15, clone RP23-304B13, complete sequence Length=188284 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 327 bits (362), Expect = 5e-86 Identities = 181/181 (100%), Gaps = 0/181 (0%) Strand=Plus/Minus Query 559 AGTGCAACCTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGG 618 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 22227 AGTGCAACCTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGG 22168 Query 619 GATTCGTGGAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGG 678 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 22167 GATTCGTGGAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGG 22108 Query 679 ATGGATAATTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGT 738 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 22107 ATGGATAATTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGT 22048 Query 739 G 739 | Sbjct 22047 G 22047 Score = 316 bits (350), Expect = 9e-83 Identities = 175/175 (100%), Gaps = 0/175 (0%) Strand=Plus/Minus Query 386 AGAATTGCTCATGAATGGACCCAGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGA 445 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 29793 AGAATTGCTCATGAATGGACCCAGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGA 29734 Query 446 AAAAACAGCTGTTACTTCAACTCATCATATACCTCCATTTGGATACCCTACTGCATCAAG 505 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 29733 AAAAACAGCTGTTACTTCAACTCATCATATACCTCCATTTGGATACCCTACTGCATCAAG 29674 Query 506 CTAACTACAAATGGTGATTTGCTGGACCAAAAATGTTTCACTGTTGACGAAATAG 560 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 29673 CTAACTACAAATGGTGATTTGCTGGACCAAAAATGTTTCACTGTTGACGAAATAG 29619 Score = 309 bits (342), Expect = 1e-80 Identities = 171/171 (100%), Gaps = 0/171 (0%) Strand=Plus/Minus Query 739 GATGGGCCCTATATGGTTAACATACTGTCCAGTGTACTCATTGAGAATGGATAAAGAACA 798 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 16843 GATGGGCCCTATATGGTTAACATACTGTCCAGTGTACTCATTGAGAATGGATAAAGAACA 16784 Query 799 TGAAGTGCGGGTGAGATCCAGACAACGGAGCTTTGAAAAGTACAGCGAGTTCAGCGAAGT 858 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 16783 TGAAGTGCGGGTGAGATCCAGACAACGGAGCTTTGAAAAGTACAGCGAGTTCAGCGAAGT 16724 Query 859 CCTCCGTGTAATATTTCCTCAGACGAACATATTGGAAGCATGTGAAGAAGG 909 ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 16723 CCTCCGTGTAATATTTCCTCAGACGAACATATTGGAAGCATGTGAAGAAGG 16673 Score = 297 bits (328), Expect = 8e-77 Identities = 166/167 (99%), Gaps = 0/167 (0%) Strand=Plus/Minus Query 907 AGGAACCAAGTCCAATTCTCAGCACCCACATCAAGAGATTGACAACCACCTGTATCACCA 966 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 16388 AGGAACCAAGTCCAATTCTCAGCACCCACATCAAGAGATTGACAACCACCTGTATCACCA 16329 Query 967 GCTTCAGAGGATCCGCCATCCCTAGCCTTGTGGGCACCTGCATTCATATGCACATACATG 1026 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 16328 GCTTCAGAGGATCCGCCATCCCTAGCCTTGTGGGCACCTGCATTCATATGCACATACATG 16269 Query 1027 CATACGCATAATTCAAAATAATAAAATAAAATTTTAAAAATTAAAAA 1073 |||||||||||||||||||||||||||||||||||||||||||| || Sbjct 16268 CATACGCATAATTCAAAATAATAAAATAAAATTTTAAAAATTAACAA 16222 Score = 237 bits (262), Expect = 7e-59 Identities = 133/134 (99%), Gaps = 0/134 (0%) Strand=Plus/Minus Query 231 CAAGTTCTTCTGGAAAGCCTCGATTCACCAAGTGTCGTTCCCCTGAACTGGAGACATTTT 290 || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 36304 CAGGTTCTTCTGGAAAGCCTCGATTCACCAAGTGTCGTTCCCCTGAACTGGAGACATTTT 36245 Query 291 CATGCTACTGGACAGAAGGAGATAATCCTGATTTAAAGACCCCAGGATCTATTCAGCTGT 350 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 36244 CATGCTACTGGACAGAAGGAGATAATCCTGATTTAAAGACCCCAGGATCTATTCAGCTGT 36185 Query 351 ACTATGCTAAAAGG 364 |||||||||||||| Sbjct 36184 ACTATGCTAAAAGG 36171 Score = 163 bits (180), Expect = 1e-36 Identities = 90/90 (100%), Gaps = 0/90 (0%) Strand=Plus/Minus Query 1 CGCACCAAGAAATAACCAGGAAACGTCTACAAAATTTCAACCCTAGCTTCTCTACCAGAT 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 160187 CGCACCAAGAAATAACCAGGAAACGTCTACAAAATTTCAACCCTAGCTTCTCTACCAGAT 160128 Query 61 TTTAACTAAACGAGATCTTCTTGCAAAGGT 90 |||||||||||||||||||||||||||||| Sbjct 160127 TTTAACTAAACGAGATCTTCTTGCAAAGGT 160098 Score = 149 bits (164), Expect = 3e-32 Identities = 87/89 (97%), Gaps = 2/89 (2%) Strand=Plus/Minus Query 79 TCTTGCAAAGGTCTCAGGTATGGATCTTTGTCAGGTCTTCTTAACCTTGGCACTGGCAGT 138 ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 146716 TCTTGCA--GGTCTCAGGTATGGATCTTTGTCAGGTCTTCTTAACCTTGGCACTGGCAGT 146659 Query 139 CACCAGCAGCACATTTTCTGGAAGTGAGG 167 ||||||||||||||||||||||||||||| Sbjct 146658 CACCAGCAGCACATTTTCTGGAAGTGAGG 146630 Score = 125 bits (138), Expect = 3e-25 Identities = 69/69 (100%), Gaps = 0/69 (0%) Strand=Plus/Minus Query 167 GCTACACCAGCTACTCTTGGCAAAGCTTCCCCAGTTCTGCAAAGAATCAATCCAAGCCTG 226 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 77414 GCTACACCAGCTACTCTTGGCAAAGCTTCCCCAGTTCTGCAAAGAATCAATCCAAGCCTG 77355 Query 227 GGGACAAGT 235 ||||||||| Sbjct 77354 GGGACAAGT 77346 Score = 48.2 bits (52), Expect = 0.068 Identities = 26/26 (100%), Gaps = 0/26 (0%) Strand=Plus/Minus Query 362 AGGGAAAGCCAACGACAAGCTGCAAG 387 |||||||||||||||||||||||||| Sbjct 35234 AGGGAAAGCCAACGACAAGCTGCAAG 35209 >gb|AC121307.7| Download subject sequence spanning the HSP Mus musculus chromosome 15, clone RP24-209E20, complete sequence Length=165154 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 327 bits (362), Expect = 5e-86 Identities = 181/181 (100%), Gaps = 0/181 (0%) Strand=Plus/Plus Query 559 AGTGCAACCTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGG 618 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 60104 AGTGCAACCTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGG 60163 Query 619 GATTCGTGGAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGG 678 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 60164 GATTCGTGGAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGG 60223 Query 679 ATGGATAATTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGT 738 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 60224 ATGGATAATTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGT 60283 Query 739 G 739 | Sbjct 60284 G 60284 Score = 316 bits (350), Expect = 9e-83 Identities = 175/175 (100%), Gaps = 0/175 (0%) Strand=Plus/Plus Query 386 AGAATTGCTCATGAATGGACCCAGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGA 445 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 52538 AGAATTGCTCATGAATGGACCCAGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGA 52597 Query 446 AAAAACAGCTGTTACTTCAACTCATCATATACCTCCATTTGGATACCCTACTGCATCAAG 505 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 52598 AAAAACAGCTGTTACTTCAACTCATCATATACCTCCATTTGGATACCCTACTGCATCAAG 52657 Query 506 CTAACTACAAATGGTGATTTGCTGGACCAAAAATGTTTCACTGTTGACGAAATAG 560 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 52658 CTAACTACAAATGGTGATTTGCTGGACCAAAAATGTTTCACTGTTGACGAAATAG 52712 Score = 309 bits (342), Expect = 1e-80 Identities = 171/171 (100%), Gaps = 0/171 (0%) Strand=Plus/Plus Query 739 GATGGGCCCTATATGGTTAACATACTGTCCAGTGTACTCATTGAGAATGGATAAAGAACA 798 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 65488 GATGGGCCCTATATGGTTAACATACTGTCCAGTGTACTCATTGAGAATGGATAAAGAACA 65547 Query 799 TGAAGTGCGGGTGAGATCCAGACAACGGAGCTTTGAAAAGTACAGCGAGTTCAGCGAAGT 858 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 65548 TGAAGTGCGGGTGAGATCCAGACAACGGAGCTTTGAAAAGTACAGCGAGTTCAGCGAAGT 65607 Query 859 CCTCCGTGTAATATTTCCTCAGACGAACATATTGGAAGCATGTGAAGAAGG 909 ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 65608 CCTCCGTGTAATATTTCCTCAGACGAACATATTGGAAGCATGTGAAGAAGG 65658 Score = 297 bits (328), Expect = 8e-77 Identities = 166/167 (99%), Gaps = 0/167 (0%) Strand=Plus/Plus Query 907 AGGAACCAAGTCCAATTCTCAGCACCCACATCAAGAGATTGACAACCACCTGTATCACCA 966 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 65943 AGGAACCAAGTCCAATTCTCAGCACCCACATCAAGAGATTGACAACCACCTGTATCACCA 66002 Query 967 GCTTCAGAGGATCCGCCATCCCTAGCCTTGTGGGCACCTGCATTCATATGCACATACATG 1026 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 66003 GCTTCAGAGGATCCGCCATCCCTAGCCTTGTGGGCACCTGCATTCATATGCACATACATG 66062 Query 1027 CATACGCATAATTCAAAATAATAAAATAAAATTTTAAAAATTAAAAA 1073 |||||||||||||||||||||||||||||||||||||||||||| || Sbjct 66063 CATACGCATAATTCAAAATAATAAAATAAAATTTTAAAAATTAACAA 66109 Score = 237 bits (262), Expect = 7e-59 Identities = 133/134 (99%), Gaps = 0/134 (0%) Strand=Plus/Plus Query 231 CAAGTTCTTCTGGAAAGCCTCGATTCACCAAGTGTCGTTCCCCTGAACTGGAGACATTTT 290 || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 46027 CAGGTTCTTCTGGAAAGCCTCGATTCACCAAGTGTCGTTCCCCTGAACTGGAGACATTTT 46086 Query 291 CATGCTACTGGACAGAAGGAGATAATCCTGATTTAAAGACCCCAGGATCTATTCAGCTGT 350 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 46087 CATGCTACTGGACAGAAGGAGATAATCCTGATTTAAAGACCCCAGGATCTATTCAGCTGT 46146 Query 351 ACTATGCTAAAAGG 364 |||||||||||||| Sbjct 46147 ACTATGCTAAAAGG 46160 Score = 125 bits (138), Expect = 3e-25 Identities = 69/69 (100%), Gaps = 0/69 (0%) Strand=Plus/Plus Query 167 GCTACACCAGCTACTCTTGGCAAAGCTTCCCCAGTTCTGCAAAGAATCAATCCAAGCCTG 226 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4917 GCTACACCAGCTACTCTTGGCAAAGCTTCCCCAGTTCTGCAAAGAATCAATCCAAGCCTG 4976 Query 227 GGGACAAGT 235 ||||||||| Sbjct 4977 GGGACAAGT 4985 Score = 48.2 bits (52), Expect = 0.068 Identities = 26/26 (100%), Gaps = 0/26 (0%) Strand=Plus/Plus Query 362 AGGGAAAGCCAACGACAAGCTGCAAG 387 |||||||||||||||||||||||||| Sbjct 47097 AGGGAAAGCCAACGACAAGCTGCAAG 47122 >gb|AF120486.1|MMGHRBPG07 Gene info Mus musculus growth hormone receptor/binding protein, exon 6 Length=371 Score = 327 bits (362), Expect = 5e-86 Identities = 181/181 (100%), Gaps = 0/181 (0%) Strand=Plus/Plus Query 559 AGTGCAACCTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGG 618 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 9 AGTGCAACCTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGG 68 Query 619 GATTCGTGGAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGG 678 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 69 GATTCGTGGAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGG 128 Query 679 ATGGATAATTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGT 738 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 129 ATGGATAATTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGT 188 Query 739 G 739 | Sbjct 189 G 189 >gb|U15011.1|MMGHBP01 Gene info Mus musculus growth hormone receptor/binding protein gene, exon 6 Length=201 Score = 327 bits (362), Expect = 5e-86 Identities = 181/181 (100%), Gaps = 0/181 (0%) Strand=Plus/Plus Query 559 AGTGCAACCTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGG 618 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 9 AGTGCAACCTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGG 68 Query 619 GATTCGTGGAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGG 678 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 69 GATTCGTGGAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGG 128 Query 679 ATGGATAATTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGT 738 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 129 ATGGATAATTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGT 188 Query 739 G 739 | Sbjct 189 G 189 >gb|U49268.1|U49267S2 Gene info Mus musculus growth hormone receptor/binding protein gene, exon 6 Length=511 Score = 322 bits (356), Expect = 2e-84 Identities = 180/181 (99%), Gaps = 0/181 (0%) Strand=Plus/Plus Query 559 AGTGCAACCTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGG 618 ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| Sbjct 182 AGTGCAACCTGATCCACCCATTGCCCTCAACTGGACTTTACTAAACATTAGTTTGACCGG 241 Query 619 GATTCGTGGAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGG 678 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 242 GATTCGTGGAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGG 301 Query 679 ATGGATAATTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGT 738 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 302 ATGGATAATTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGT 361 Query 739 G 739 | Sbjct 362 G 362 >gb|AF120485.1|MMGHRBPG06 Gene info Mus musculus growth hormone receptor/binding protein, exon 5 Length=922 Score = 316 bits (350), Expect = 9e-83 Identities = 175/175 (100%), Gaps = 0/175 (0%) Strand=Plus/Plus Query 386 AGAATTGCTCATGAATGGACCCAGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGA 445 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 445 AGAATTGCTCATGAATGGACCCAGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGA 504 Query 446 AAAAACAGCTGTTACTTCAACTCATCATATACCTCCATTTGGATACCCTACTGCATCAAG 505 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 505 AAAAACAGCTGTTACTTCAACTCATCATATACCTCCATTTGGATACCCTACTGCATCAAG 564 Query 506 CTAACTACAAATGGTGATTTGCTGGACCAAAAATGTTTCACTGTTGACGAAATAG 560 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 565 CTAACTACAAATGGTGATTTGCTGGACCAAAAATGTTTCACTGTTGACGAAATAG 619 >gb|AF120487.1|MMGHRBPG08 Gene info Mus musculus growth hormone receptor/binding protein, exons 7 and 8A and complete cds, alternatively spliced Length=1029 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 309 bits (342), Expect = 1e-80 Identities = 171/171 (100%), Gaps = 0/171 (0%) Strand=Plus/Plus Query 739 GATGGGCCCTATATGGTTAACATACTGTCCAGTGTACTCATTGAGAATGGATAAAGAACA 798 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 99 GATGGGCCCTATATGGTTAACATACTGTCCAGTGTACTCATTGAGAATGGATAAAGAACA 158 Query 799 TGAAGTGCGGGTGAGATCCAGACAACGGAGCTTTGAAAAGTACAGCGAGTTCAGCGAAGT 858 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 159 TGAAGTGCGGGTGAGATCCAGACAACGGAGCTTTGAAAAGTACAGCGAGTTCAGCGAAGT 218 Query 859 CCTCCGTGTAATATTTCCTCAGACGAACATATTGGAAGCATGTGAAGAAGG 909 ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 219 CCTCCGTGTAATATTTCCTCAGACGAACATATTGGAAGCATGTGAAGAAGG 269 Score = 297 bits (328), Expect = 8e-77 Identities = 164/164 (100%), Gaps = 0/164 (0%) Strand=Plus/Plus Query 907 AGGAACCAAGTCCAATTCTCAGCACCCACATCAAGAGATTGACAACCACCTGTATCACCA 966 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 539 AGGAACCAAGTCCAATTCTCAGCACCCACATCAAGAGATTGACAACCACCTGTATCACCA 598 Query 967 GCTTCAGAGGATCCGCCATCCCTAGCCTTGTGGGCACCTGCATTCATATGCACATACATG 1026 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 599 GCTTCAGAGGATCCGCCATCCCTAGCCTTGTGGGCACCTGCATTCATATGCACATACATG 658 Query 1027 CATACGCATAATTCAAAATAATAAAATAAAATTTTAAAAATTAA 1070 |||||||||||||||||||||||||||||||||||||||||||| Sbjct 659 CATACGCATAATTCAAAATAATAAAATAAAATTTTAAAAATTAA 702 >gb|U43933.1|U49267S3 GeoGene info Mus musculus growth hormone receptor/binding protein gene, exons 7, 8 and 8A, and partial cds Length=2590 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 309 bits (342), Expect = 1e-80 Identities = 171/171 (100%), Gaps = 0/171 (0%) Strand=Plus/Plus Query 739 GATGGGCCCTATATGGTTAACATACTGTCCAGTGTACTCATTGAGAATGGATAAAGAACA 798 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 167 GATGGGCCCTATATGGTTAACATACTGTCCAGTGTACTCATTGAGAATGGATAAAGAACA 226 Query 799 TGAAGTGCGGGTGAGATCCAGACAACGGAGCTTTGAAAAGTACAGCGAGTTCAGCGAAGT 858 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 227 TGAAGTGCGGGTGAGATCCAGACAACGGAGCTTTGAAAAGTACAGCGAGTTCAGCGAAGT 286 Query 859 CCTCCGTGTAATATTTCCTCAGACGAACATATTGGAAGCATGTGAAGAAGG 909 ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 287 CCTCCGTGTAATATTTCCTCAGACGAACATATTGGAAGCATGTGAAGAAGG 337 Score = 297 bits (328), Expect = 8e-77 Identities = 166/167 (99%), Gaps = 0/167 (0%) Strand=Plus/Plus Query 907 AGGAACCAAGTCCAATTCTCAGCACCCACATCAAGAGATTGACAACCACCTGTATCACCA 966 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 622 AGGAACCAAGTCCAATTCTCAGCACCCACATCAAGAGATTGACAACCACCTGTATCACCA 681 Query 967 GCTTCAGAGGATCCGCCATCCCTAGCCTTGTGGGCACCTGCATTCATATGCACATACATG 1026 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 682 GCTTCAGAGGATCCGCCATCCCTAGCCTTGTGGGCACCTGCATTCATATGCACATACATG 741 Query 1027 CATACGCATAATTCAAAATAATAAAATAAAATTTTAAAAATTAAAAA 1073 |||||||||||||||||||||||||||||||||||||||||||| || Sbjct 742 CATACGCATAATTCAAAATAATAAAATAAAATTTTAAAAATTAACAA 788 >gb|U15013.1|MMGHBP02 Gene info Mus musculus growth hormone receptor/binding protein gene, exons 7 and 8a Length=1027 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 304 bits (336), Expect = 6e-79 Identities = 170/171 (99%), Gaps = 0/171 (0%) Strand=Plus/Plus Query 739 GATGGGCCCTATATGGTTAACATACTGTCCAGTGTACTCATTGAGAATGGATAAAGAACA 798 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 99 GATGGGCCCTATATGGTTAACATACTGTCCAGTGTACTCATTGAGAATGGATAAAGAACA 158 Query 799 TGAAGTGCGGGTGAGATCCAGACAACGGAGCTTTGAAAAGTACAGCGAGTTCAGCGAAGT 858 ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Sbjct 159 TGAAGTGCGGGTGAGATTCAGACAACGGAGCTTTGAAAAGTACAGCGAGTTCAGCGAAGT 218 Query 859 CCTCCGTGTAATATTTCCTCAGACGAACATATTGGAAGCATGTGAAGAAGG 909 ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 219 CCTCCGTGTAATATTTCCTCAGACGAACATATTGGAAGCATGTGAAGAAGG 269 Score = 297 bits (328), Expect = 8e-77 Identities = 164/164 (100%), Gaps = 0/164 (0%) Strand=Plus/Plus Query 907 AGGAACCAAGTCCAATTCTCAGCACCCACATCAAGAGATTGACAACCACCTGTATCACCA 966 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 537 AGGAACCAAGTCCAATTCTCAGCACCCACATCAAGAGATTGACAACCACCTGTATCACCA 596 Query 967 GCTTCAGAGGATCCGCCATCCCTAGCCTTGTGGGCACCTGCATTCATATGCACATACATG 1026 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 597 GCTTCAGAGGATCCGCCATCCCTAGCCTTGTGGGCACCTGCATTCATATGCACATACATG 656 Query 1027 CATACGCATAATTCAAAATAATAAAATAAAATTTTAAAAATTAA 1070 |||||||||||||||||||||||||||||||||||||||||||| Sbjct 657 CATACGCATAATTCAAAATAATAAAATAAAATTTTAAAAATTAA 700 >gb|AF211173.1|AF211173 Pelodiscus sinensis japonicus liver growth hormone receptor mRNA, complete cds Length=1866 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 300 bits (332), Expect = 7e-78 Identities = 329/432 (76%), Gaps = 8/432 (1%) Strand=Plus/Plus Query 410 GAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAAAAAACAGCTGTTACTTCAACTCA 469 |||||||||||||| || |||||| | |||| ||| ||||||||||||| |||||| || Sbjct 214 GAATGGAAAGAATGTCCCGATTATATAACTGCCGGAGAAAACAGCTGTTATTTCAACACA 273 Query 470 TCATATACCTCCATTTGGATACCCTACTGCATCAAGCTAACTACAAATGGTGATTTGCTG 529 ||||| ||||| ||||||||| | || || | ||||| | | || | ||| | | Sbjct 274 TCATACACCTCTATTTGGATAACTTATTGTGTTAAGCTTATCAATAAAGATGACGTATTA 333 Query 530 GACCAAAAATGTTTCACTGTTGACGAAATAGTGCAACCTGATCCACCCATTGGCCTCAAC 589 || ||||||| |||| |||||| ||||||||||||||||||||||| |||| |||||| Sbjct 334 GATGAAAAATGCTTCAGTGTTGATGAAATAGTGCAACCTGATCCACCTGTTGGTCTCAAC 393 Query 590 TGGACTTTACTAAACATTAGTTTGACCGGGATTCGTGGAGACATCCAAGTGAGTTGGCAA 649 ||||| |||| |||| || ||||| |||| | || ||||||||||||||| ||| | Sbjct 394 TGGACCCTACTGAACACCAGCCTGACCAGGATCCATGCAGACATCCAAGTGAGATGGGAC 453 Query 650 CCACCACCCAATGCAGATGTTCTGAAGGGATGGATAATTCTGGAGTATGAAATTCAGTAC 709 ||||| || |||||||| | |||||||||||| | |||||||||||| | |||||| Sbjct 454 CCACCGCCATCAGCAGATGTACAGAAGGGATGGATTACACTGGAGTATGAACTGCAGTAC 513 Query 710 AAAGAAGTAAATGAATCAAAATGGAAAGTGATGG-GCCCTATATGGTTAACATACTG--T 766 |||||||||||||| | ||||||| | | ||| |||| ||| | | | | || | Sbjct 514 AAAGAAGTAAATGAGACGAAATGGAGGGAGCTGGAGCCC---ATGCTCACAACAGTGGTT 570 Query 767 CCAGTGTACTCATTGAGAATGGATAAAGAACATGAAGTGCGGGTGAGATCCAGACAACGG 826 ||| |||| || |||| | | | | ||| |||| | || || |||| ||||||| | Sbjct 571 CCATTGTATTCTTTGAAATTAGGAAGAGACTATGAGATTCGAGTACGATCAAGACAAC-G 629 Query 827 AGCTT-TGAAAA 837 |||| |||||| Sbjct 630 TGCTTCTGAAAA 641 Score = 42.8 bits (46), Expect = 2.9 Identities = 32/38 (84%), Gaps = 0/38 (0%) Strand=Plus/Plus Query 269 TCCCCTGAACTGGAGACATTTTCATGCTACTGGACAGA 306 || ||||||| ||| ||||||||||| ||||||| || Sbjct 109 TCACCTGAACAGGAAACATTTTCATGTCACTGGACTGA 146 >ref|NM_001001293.1| UniGene infoGene info Gallus gallus growth hormone receptor (GHR), mRNA gb|M74057.1|CHKGHRECEP UniGene infoGene info Chicken growth hormone receptor mRNA, complete cds Length=2057 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 286 bits (316), Expect = 1e-73 Identities = 335/453 (73%), Gaps = 0/453 (0%) Strand=Plus/Plus Query 410 GAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAAAAAACAGCTGTTACTTCAACTCA 469 || ||||||||||| || |||||| || |||| ||| |||| ||||||||||||||| || Sbjct 237 GACTGGAAAGAATGTCCGGATTATATCACTGCAGGAGAAAATAGCTGTTACTTCAACACA 296 Query 470 TCATATACCTCCATTTGGATACCCTACTGCATCAAGCTAACTACAAATGGTGATTTGCTG 529 || || ||||| ||||||||||| || || | ||||| | | || | ||| | | Sbjct 297 TCCTACACCTCGATTTGGATACCATATTGTGTTAAGCTTGCCAATAAAGATGAAGTATTT 356 Query 530 GACCAAAAATGTTTCACTGTTGACGAAATAGTGCAACCTGATCCACCCATTGGCCTCAAC 589 ||| |||| ||||||| |||||| |||||||| | ||||||||| || | ||| ||| Sbjct 357 GACGAAAAGTGTTTCAGTGTTGATGAAATAGTACTACCTGATCCCCCTGTGCACCTTAAC 416 Query 590 TGGACTTTACTAAACATTAGTTTGACCGGGATTCGTGGAGACATCCAAGTGAGTTGGCAA 649 |||||| | ||||| | |||| || ||||| | ||| || || ||||| | ||| | Sbjct 417 TGGACTCTGCTAAATACTAGTCAAACTGGGATCCATGGGGATATTCAAGTACGATGGGAT 476 Query 650 CCACCACCCAATGCAGATGTTCTGAAGGGATGGATAATTCTGGAGTATGAAATTCAGTAC 709 |||||||| | |||||||||| ||| |||||||| | ||||||||||||| | |||||| Sbjct 477 CCACCACCAACAGCAGATGTTCAGAAAGGATGGATTACTCTGGAGTATGAATTGCAGTAC 536 Query 710 AAAGAAGTAAATGAATCAAAATGGAAAGTGATGGGCCCTATATGGTTAACATACTGTCCA 769 |||||||| ||||| |||||||||| | | | | || | | |||| |||| Sbjct 537 AAAGAAGTTAATGAGACAAAATGGAAGGAGTTAGAACCCAGGCTCTCAACAGTGGTTCCA 596 Query 770 GTGTACTCATTGAGAATGGATAAAGAACATGAAGTGCGGGTGAGATCCAGACAACGGAGC 829 |||| || ||| |||| | ||| |||| | || || |||| |||||||| | | Sbjct 597 CTGTATTCTCTGAAGATGGGAAGAGATTATGAGATCCGAGTCCGATCAAGACAACGTACC 656 Query 830 TTTGAAAAGTACAGCGAGTTCAGCGAAGTCCTC 862 | ||||||| | |||||||| ||| ||||| Sbjct 657 TCCGAAAAGTTTGGGGAGTTCAGTGAAATCCTC 689 Score = 53.6 bits (58), Expect = 0.002 Identities = 50/64 (78%), Gaps = 0/64 (0%) Strand=Plus/Plus Query 247 GCCTCGATTCACCAAGTGTCGTTCCCCTGAACTGGAGACATTTTCATGCTACTGGACAGA 306 ||| | | ||| |||||| | || ||||| |||||||||||||| || || ||||| || Sbjct 119 GCCACAAATCAGCAAGTGCAGGTCACCTGAGCTGGAGACATTTTCGTGTTATTGGACTGA 178 Query 307 AGGA 310 ||| Sbjct 179 TGGA 182 >dbj|D84308.1| Columba livia mRNA for growth hormone receptor, complete cds Length=2384 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 275 bits (304), Expect = 3e-70 Identities = 352/483 (72%), Gaps = 8/483 (1%) Strand=Plus/Plus Query 410 GAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAAAAAACAGCTGTTACTTCAACTCA 469 || ||||||||||| ||||||||| || |||| ||| ||||||||||||| |||||| | Sbjct 466 GACTGGAAAGAATGTCCTGATTATATCACTGCAGGAGAAAACAGCTGTTATTTCAACACG 525 Query 470 TCATATACCTCCATTTGGATACCCTACTGCATCAAGCTA---ACTACAAATGGTG-ATTT 525 || || ||||| ||||||||||| || || | ||||| | || | ||| | |||| Sbjct 526 TCCTACACCTCTATTTGGATACCATATTGTGTTAAGCTTGTCAATAAAGATGAAGTATTT 585 Query 526 GCTGGACCAAAAATGTTTCACTGTTGACGAAATAGTGCAACCTGATCCACCCATTGGCCT 585 | || |||||||||||| ||||| |||||||| | |||||| || || | || Sbjct 586 GATG----AAAAATGTTTCAGCGTTGATGAAATAGTACTACCTGACCCCCCTGTCCATCT 641 Query 586 CAACTGGACTTTACTAAACATTAGTTTGACCGGGATTCGTGGAGACATCCAAGTGAGTTG 645 ||||||||| | ||||| | |||| || ||||| | ||| || || ||||| || || Sbjct 642 TAACTGGACTCTGCTAAATACTAGTCAAACTGGGATCCATGGGGATATTCAAGTAAGATG 701 Query 646 GCAACCACCACCCAATGCAGATGTTCTGAAGGGATGGATAATTCTGGAGTATGAAATTCA 705 | | || ||||| | |||||||||| |||||||||||| | ||||||||||||| | || Sbjct 702 GGATCCGCCACCAACAGCAGATGTTCAGAAGGGATGGATTACTCTGGAGTATGAATTGCA 761 Query 706 GTACAAAGAAGTAAATGAATCAAAATGGAAAGTGATGGGCCCTATATGGTTAACATACTG 765 |||||||||||| ||||| |||||||||| | | | | || | | |||| Sbjct 762 GTACAAAGAAGTTAATGAGACAAAATGGAAGGAGTTAGAACCCAGGCTCTCAACAATGGT 821 Query 766 TCCAGTGTACTCATTGAGAATGGATAAAGAACATGAAGTGCGGGTGAGATCCAGACAACG 825 |||| ||||||| ||| || | | ||| |||| | || || |||| |||||||| Sbjct 822 TCCACTGTACTCTCTGAAGATAGGAAGAGATTATGAGATACGAGTCCGATCAAGACAACG 881 Query 826 GAGCTTTGAAAAGTACAGCGAGTTCAGCGAAGTCCTCCGTGTAATATTTCCTCAGACGAA 885 | || |||||| | | |||||||| ||| |||| |||| ||| |||| || | Sbjct 882 TACCTCTGAAAAATTTGGGGAGTTCAGTGAAATCCTTTATGTATCTTTTTCTCAAGCGGA 941 Query 886 CAT 888 ||| Sbjct 942 CAT 944 Score = 59.0 bits (64), Expect = 4e-05 Identities = 53/67 (79%), Gaps = 0/67 (0%) Strand=Plus/Plus Query 247 GCCTCGATTCACCAAGTGTCGTTCCCCTGAACTGGAGACATTTTCATGCTACTGGACAGA 306 ||| | | ||| |||||| | || |||||||||||||| |||||||| || ||||| || Sbjct 339 GCCACAAATCAGCAAGTGCAGATCACCTGAACTGGAGACGTTTTCATGTTATTGGACTGA 398 Query 307 AGGAGAT 313 ||| || Sbjct 399 CGGAAAT 405 >gb|U20353.1|CLU20353 Columba livia growth hormone receptor (ghr) mRNA, complete cds Length=1983 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 271 bits (300), Expect = 3e-69 Identities = 346/474 (72%), Gaps = 8/474 (1%) Strand=Plus/Plus Query 410 GAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAAAAAACAGCTGTTACTTCAACTCA 469 || ||||||||||| ||||||||| || |||| ||| ||||||||||||| |||||| | Sbjct 257 GACTGGAAAGAATGTCCTGATTATATCACTGCAGGAGAAAACAGCTGTTATTTCAACACG 316 Query 470 TCATATACCTCCATTTGGATACCCTACTGCATCAAGCTA---ACTACAAATGGTG-ATTT 525 || || ||||| ||||||||||| || || | ||||| | || | ||| | |||| Sbjct 317 TCCTACACCTCTATTTGGATACCATATTGTGTTAAGCTTGTCAATAAAGATGAAGTATTT 376 Query 526 GCTGGACCAAAAATGTTTCACTGTTGACGAAATAGTGCAACCTGATCCACCCATTGGCCT 585 | || |||||||||||| ||||| |||||||| | |||||| || || | || Sbjct 377 GATG----AAAAATGTTTCAGCGTTGATGAAATAGTACTACCTGACCCCCCTGTCCATCT 432 Query 586 CAACTGGACTTTACTAAACATTAGTTTGACCGGGATTCGTGGAGACATCCAAGTGAGTTG 645 ||||||||| | ||||| | |||| || ||||| | ||| || || ||||| || || Sbjct 433 TAACTGGACTCTGCTAAATACTAGTCAAACTGGGATCCATGGGGATATTCAAGTAAGATG 492 Query 646 GCAACCACCACCCAATGCAGATGTTCTGAAGGGATGGATAATTCTGGAGTATGAAATTCA 705 | | || ||||| | |||||||||| |||||||||||| | ||||||||||||| | || Sbjct 493 GGATCCGCCACCAACAGCAGATGTTCAGAAGGGATGGATTACTCTGGAGTATGAATTGCA 552 Query 706 GTACAAAGAAGTAAATGAATCAAAATGGAAAGTGATGGGCCCTATATGGTTAACATACTG 765 |||||||||||| ||||| |||||||||| | | | | || | | |||| Sbjct 553 GTACAAAGAAGTTAATGAGACAAAATGGAAGGAGTTAGAACCCAGGCTCTCAACAATGGT 612 Query 766 TCCAGTGTACTCATTGAGAATGGATAAAGAACATGAAGTGCGGGTGAGATCCAGACAACG 825 |||| ||||||| ||| || | | ||| |||| | || || |||| |||||||| Sbjct 613 TCCACTGTACTCTCTGAAGATAGGAAGAGATTATGAGATACGAGTCCGATCAAGACAACG 672 Query 826 GAGCTTTGAAAAGTACAGCGAGTTCAGCGAAGTCCTCCGTGTAATATTTCCTCA 879 | || |||||| | | |||||||| ||| |||| |||| ||| |||| Sbjct 673 TACCTCTGAAAAATTTGGGGAGTTCAGTGAAATCCTTTATGTATCTTTTTCTCA 726 Score = 59.0 bits (64), Expect = 4e-05 Identities = 53/67 (79%), Gaps = 0/67 (0%) Strand=Plus/Plus Query 247 GCCTCGATTCACCAAGTGTCGTTCCCCTGAACTGGAGACATTTTCATGCTACTGGACAGA 306 ||| | | ||| |||||| | || |||||||||||||| |||||||| || ||||| || Sbjct 130 GCCACAAATCAGCAAGTGCAGATCACCTGAACTGGAGACGTTTTCATGTTATTGGACTGA 189 Query 307 AGGAGAT 313 ||| || Sbjct 190 CGGAAAT 196 >dbj|AK148440.1| UniGene infoGene info Mus musculus B16 F10Y cells cDNA, RIKEN full-length enriched library, clone:G370148O21 product:unclassifiable, full insert sequence Length=2480 Score = 268 bits (296), Expect = 4e-68 Identities = 148/148 (100%), Gaps = 0/148 (0%) Strand=Plus/Plus Query 87 AGGTCTCAGGTATGGATCTTTGTCAGGTCTTCTTAACCTTGGCACTGGCAGTCACCAGCA 146 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 438 AGGTCTCAGGTATGGATCTTTGTCAGGTCTTCTTAACCTTGGCACTGGCAGTCACCAGCA 497 Query 147 GCACATTTTCTGGAAGTGAGGCTACACCAGCTACTCTTGGCAAAGCTTCCCCAGTTCTGC 206 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 498 GCACATTTTCTGGAAGTGAGGCTACACCAGCTACTCTTGGCAAAGCTTCCCCAGTTCTGC 557 Query 207 AAAGAATCAATCCAAGCCTGGGGACAAG 234 |||||||||||||||||||||||||||| Sbjct 558 AAAGAATCAATCCAAGCCTGGGGACAAG 585 >gb|DQ138367.1| UniGene infoGene info Gallus gallus growth hormone binding protein (GHBP) mRNA, complete cds, alternatively spliced Length=1184 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 264 bits (292), Expect = 5e-67 Identities = 254/326 (77%), Gaps = 0/326 (0%) Strand=Plus/Plus Query 410 GAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAAAAAACAGCTGTTACTTCAACTCA 469 || ||||||||||| || |||||| || |||| ||| |||| ||||||||||||||| || Sbjct 330 GACTGGAAAGAATGTCCGGATTATATCACTGCAGGAGAAAATAGCTGTTACTTCAACACA 389 Query 470 TCATATACCTCCATTTGGATACCCTACTGCATCAAGCTAACTACAAATGGTGATTTGCTG 529 || || ||||| ||||||||||| || || | ||||| | | || | ||| | | Sbjct 390 TCCTACACCTCGATTTGGATACCATATTGTGTTAAGCTTGCCAATAAAGATGAAGTATTT 449 Query 530 GACCAAAAATGTTTCACTGTTGACGAAATAGTGCAACCTGATCCACCCATTGGCCTCAAC 589 ||| |||| ||||||| |||||| |||||||| | ||||||||| || | ||| ||| Sbjct 450 GACGAAAAGTGTTTCAGTGTTGATGAAATAGTACTACCTGATCCCCCTGTGCACCTTAAC 509 Query 590 TGGACTTTACTAAACATTAGTTTGACCGGGATTCGTGGAGACATCCAAGTGAGTTGGCAA 649 |||||| | ||||| | |||| || ||||| | ||| || || ||||| | ||| | Sbjct 510 TGGACTCTGCTAAATACTAGTCAAACTGGGATCCATGGGGATATTCAAGTACGATGGGAT 569 Query 650 CCACCACCCAATGCAGATGTTCTGAAGGGATGGATAATTCTGGAGTATGAAATTCAGTAC 709 |||||||| | |||||||||| ||| |||||||| | ||||||||||||| | |||||| Sbjct 570 CCACCACCAACAGCAGATGTTCAGAAAGGATGGATTACTCTGGAGTATGAATTGCAGTAC 629 Query 710 AAAGAAGTAAATGAATCAAAATGGAA 735 |||||||| ||||| |||||||||| Sbjct 630 AAAGAAGTTAATGAGACAAAATGGAA 655 Score = 57.2 bits (62), Expect = 1e-04 Identities = 51/64 (79%), Gaps = 0/64 (0%) Strand=Plus/Plus Query 247 GCCTCGATTCACCAAGTGTCGTTCCCCTGAACTGGAGACATTTTCATGCTACTGGACAGA 306 ||| | | ||| |||||| | || ||||| |||||||||||||| || || |||||||| Sbjct 212 GCCACAAATCAGCAAGTGCAGGTCACCTGAGCTGGAGACATTTTCGTGTTATTGGACAGA 271 Query 307 AGGA 310 ||| Sbjct 272 TGGA 275 >gb|U44722.1|RNGHRBP01 GeoGene info Rattus norvegicus growth hormone receptor/binding protein (GHR/BP) gene, exons 7, 8A, and partial cds, alternatively spliced Length=996 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 246 bits (272), Expect = 1e-61 Identities = 151/161 (93%), Gaps = 0/161 (0%) Strand=Plus/Plus Query 907 AGGAACCAAGTCCAATTCTCAGCACCCACATCAAGAGATTGACAACCACCTGTATCACCA 966 |||| |||||| |||||| ||||||||||||||||||||||||||||||||||| ||||| Sbjct 466 AGGACCCAAGTTCAATTCCCAGCACCCACATCAAGAGATTGACAACCACCTGTAACACCA 525 Query 967 GCTTCAGAGGATCCGCCATCCCTAGCCTTGTGGGCACCTGCATTCATATGCACATACATG 1026 ||| ||||||||| |||||||||||||||| ||||||||||||||||||||||||||||| Sbjct 526 GCTCCAGAGGATCTGCCATCCCTAGCCTTGCGGGCACCTGCATTCATATGCACATACATG 585 Query 1027 CATACGCATAATTCAAAATAATAAAATAAAATTTTAAAAAT 1067 ||||| ||||||| ||| ||||||||||||||||||||||| Sbjct 586 CATACACATAATTAAAATTAATAAAATAAAATTTTAAAAAT 626 Score = 203 bits (224), Expect = 1e-48 Identities = 149/171 (87%), Gaps = 2/171 (1%) Strand=Plus/Plus Query 740 ATGGGCCCTATATGGTTAACATACTGTCC-AGTGTACTCATTGAGAATGGATAAAGAACA 798 ||| |||| ||||||| ||||| | |||| | |||||||| ||||| |||||||||| || Sbjct 1 ATGAGCCCGATATGGTCAACAT-CAGTCCCACTGTACTCACTGAGACTGGATAAAGAGCA 59 Query 799 TGAAGTGCGGGTGAGATCCAGACAACGGAGCTTTGAAAAGTACAGCGAGTTCAGCGAAGT 858 |||||||| ||||||||||||||||||||||| |||||||||||||||||||| ||||| Sbjct 60 CGAAGTGCGTGTGAGATCCAGACAACGGAGCTTCGAAAAGTACAGCGAGTTCAGTGAAGT 119 Query 859 CCTCCGTGTAATATTTCCTCAGACGAACATATTGGAAGCATGTGAAGAAGG 909 |||||||||| |||||||||| | ||| | ||| ||||||||||||||| Sbjct 120 ACTCCGTGTAACGTTTCCTCAGATGGACACACTGGCAGCATGTGAAGAAGG 170 >gb|AF120483.1|MMGHRBPG04 Gene info Mus musculus growth hormone receptor/binding protein, exon 4 Length=652 Score = 237 bits (262), Expect = 7e-59 Identities = 133/134 (99%), Gaps = 0/134 (0%) Strand=Plus/Plus Query 231 CAAGTTCTTCTGGAAAGCCTCGATTCACCAAGTGTCGTTCCCCTGAACTGGAGACATTTT 290 || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 268 CAGGTTCTTCTGGAAAGCCTCGATTCACCAAGTGTCGTTCCCCTGAACTGGAGACATTTT 327 Query 291 CATGCTACTGGACAGAAGGAGATAATCCTGATTTAAAGACCCCAGGATCTATTCAGCTGT 350 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 328 CATGCTACTGGACAGAAGGAGATAATCCTGATTTAAAGACCCCAGGATCTATTCAGCTGT 387 Query 351 ACTATGCTAAAAGG 364 |||||||||||||| Sbjct 388 ACTATGCTAAAAGG 401 >gb|U49267.1|U49267S1 Gene info Mus musculus growth hormone receptor/binding protein gene, exon 4, and partial cds Length=530 Score = 237 bits (262), Expect = 7e-59 Identities = 133/134 (99%), Gaps = 0/134 (0%) Strand=Plus/Plus Query 231 CAAGTTCTTCTGGAAAGCCTCGATTCACCAAGTGTCGTTCCCCTGAACTGGAGACATTTT 290 || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 194 CAGGTTCTTCTGGAAAGCCTCGATTCACCAAGTGTCGTTCCCCTGAACTGGAGACATTTT 253 Query 291 CATGCTACTGGACAGAAGGAGATAATCCTGATTTAAAGACCCCAGGATCTATTCAGCTGT 350 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 254 CATGCTACTGGACAGAAGGAGATAATCCTGATTTAAAGACCCCAGGATCTATTCAGCTGT 313 Query 351 ACTATGCTAAAAGG 364 |||||||||||||| Sbjct 314 ACTATGCTAAAAGG 327 >dbj|AB267378.1| Pelodiscus sinensis GHR mRNA for growth hormone receptor, partial cds Length=464 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 235 bits (260), Expect = 2e-58 Identities = 217/275 (78%), Gaps = 0/275 (0%) Strand=Plus/Plus Query 410 GAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAAAAAACAGCTGTTACTTCAACTCA 469 |||||||||||||| || |||||| | |||| ||| ||||||||||||| |||||| || Sbjct 186 GAATGGAAAGAATGTCCCGATTATATAACTGCCGGAGAAAACAGCTGTTATTTCAACACA 245 Query 470 TCATATACCTCCATTTGGATACCCTACTGCATCAAGCTAACTACAAATGGTGATTTGCTG 529 ||||| ||||| ||||||||| | || || | ||||| | | || | ||| | | Sbjct 246 TCATACACCTCTATTTGGATAACTTATTGTGTTAAGCTTATCAATAAAGATGACGTATTA 305 Query 530 GACCAAAAATGTTTCACTGTTGACGAAATAGTGCAACCTGATCCACCCATTGGCCTCAAC 589 || ||||||| |||| |||||| ||||||||||||||||||||||| |||| |||||| Sbjct 306 GATGAAAAATGCTTCAGTGTTGATGAAATAGTGCAACCTGATCCACCTGTTGGTCTCAAC 365 Query 590 TGGACTTTACTAAACATTAGTTTGACCGGGATTCGTGGAGACATCCAAGTGAGTTGGCAA 649 ||||| |||| |||| || ||||| |||| | || ||||||||||||||| ||| | Sbjct 366 TGGACCCTACTGAACACCAGCCTGACCAGGATCCATGCAGACATCCAAGTGAGATGGGAC 425 Query 650 CCACCACCCAATGCAGATGTTCTGAAGGGATGGAT 684 ||||| || |||||||| | |||||||||||| Sbjct 426 CCACCGCCATCAGCAGATGTACAGAAGGGATGGAT 460 Score = 42.8 bits (46), Expect = 2.9 Identities = 32/38 (84%), Gaps = 0/38 (0%) Strand=Plus/Plus Query 269 TCCCCTGAACTGGAGACATTTTCATGCTACTGGACAGA 306 || ||||||| ||| ||||||||||| ||||||| || Sbjct 81 TCACCTGAACAGGAAACATTTTCATGTCACTGGACTGA 118 >gb|DQ530432.1| Anser anser growth hormone receptor mRNA, partial cds Length=345 Score = 224 bits (248), Expect = 4e-55 Identities = 217/279 (77%), Gaps = 0/279 (0%) Strand=Plus/Plus Query 457 TTACTTCAACTCATCATATACCTCCATTTGGATACCCTACTGCATCAAGCTAACTACAAA 516 |||||||||| |||| || ||||| || |||||||| || || | ||||| | | || Sbjct 1 TTACTTCAACACATCCTACACCTCTATATGGATACCATATTGTGTTAAGCTTGCCAATAA 60 Query 517 TGGTGATTTGCTGGACCAAAAATGTTTCACTGTTGACGAAATAGTGCAACCTGATCCACC 576 | ||| | | || |||||||||||| |||||| |||||||| | ||||||||| || Sbjct 61 AGATGAAGTATTTGATGAAAAATGTTTCAGTGTTGATGAAATAGTACTACCTGATCCCCC 120 Query 577 CATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGGGATTCGTGGAGACATCCA 636 | ||| ||||||||| | ||||| | |||| || ||||| | ||| || ||||| Sbjct 121 TGTCCACCTTAACTGGACTCTGCTAAATACTAGTCAAACTGGGATCCATGGGGATATCCA 180 Query 637 AGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGGATGGATAATTCTGGAGTA 696 ||| || ||| | |||||||| | |||||||||| |||||||||||| | ||||||||| Sbjct 181 AGTAAGATGGGATCCACCACCAACAGCAGATGTTCAGAAGGGATGGATTACTCTGGAGTA 240 Query 697 TGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAA 735 |||| | |||||||||||||| ||||| |||||||||| Sbjct 241 TGAATTGCAGTACAAAGAAGTTAATGAGACAAAATGGAA 279 >gb|DQ137140.1| Anas platyrhynchos growth hormone receptor protein mRNA, partial cds Length=345 Score = 219 bits (242), Expect = 2e-53 Identities = 216/279 (77%), Gaps = 0/279 (0%) Strand=Plus/Plus Query 457 TTACTTCAACTCATCATATACCTCCATTTGGATACCCTACTGCATCAAGCTAACTACAAA 516 |||||||||| |||| || ||||| || |||||||| ||||| | ||||| | | || Sbjct 1 TTACTTCAACACATCCTACACCTCTATATGGATACCATACTGTGTTAAGCTTGCCAATAA 60 Query 517 TGGTGATTTGCTGGACCAAAAATGTTTCACTGTTGACGAAATAGTGCAACCTGATCCACC 576 | ||| | | || |||||||||||| |||||| |||||||| | ||||||||| || Sbjct 61 AGATGAAGTATTTGATGAAAAATGTTTCAGTGTTGATGAAATAGTACTACCTGATCCCCC 120 Query 577 CATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGGGATTCGTGGAGACATCCA 636 | ||| ||||||||| | ||||| | |||| || ||||| | ||| || ||||| Sbjct 121 TGTCCACCTTAACTGGACTCTGCTAAATACTAGTCAAACTGGGATCCATGGGGATATCCA 180 Query 637 AGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGGATGGATAATTCTGGAGTA 696 ||| || ||| | |||||||| | |||||||||| |||||||||||| | ||||||||| Sbjct 181 AGTAAGATGGGATCCACCACCAACAGCAGATGTTCAGAAGGGATGGATTACTCTGGAGTA 240 Query 697 TGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAA 735 ||| | ||||||| |||||| ||||| |||||||||| Sbjct 241 TGAGTTGCAGTACACAGAAGTTAATGAGACAAAATGGAA 279 >gb|AC093260.2| Download subject sequence spanning the HSP Homo sapiens chromosome 5 clone RP11-237B16, complete sequence Length=168521 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 219 bits (242), Expect = 2e-53 Identities = 157/181 (86%), Gaps = 0/181 (0%) Strand=Plus/Plus Query 559 AGTGCAACCTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGG 618 ||||||||| ||||||||||||| |||||||||||||||||| ||| | ||||| || || Sbjct 44735 AGTGCAACCAGATCCACCCATTGCCCTCAACTGGACTTTACTGAACGTCAGTTTAACTGG 44794 Query 619 GATTCGTGGAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGG 678 ||||| || ||| ||||||||||| ||| || |||||| |||||||||| ||| ||| || Sbjct 44795 GATTCATGCAGATATCCAAGTGAGATGGGAAGCACCACGCAATGCAGATATTCAGAAAGG 44854 Query 679 ATGGATAATTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGT 738 |||||| |||||||||||||| |||| |||||||||||||||||| | ||||||||| | Sbjct 44855 ATGGATGGTTCTGGAGTATGAACTTCAATACAAAGAAGTAAATGAAACTAAATGGAAAAT 44914 Query 739 G 739 | Sbjct 44915 G 44915 Score = 187 bits (206), Expect = 1e-43 Identities = 142/168 (84%), Gaps = 0/168 (0%) Strand=Plus/Plus Query 393 CTCATGAATGGACCCAGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAAAAAACA 452 |||| |||||||| || |||||||||||||||||||||||||| |||||||| |||||| Sbjct 39831 CTCAAGAATGGACTCAAGAATGGAAAGAATGCCCTGATTATGTTTCTGCTGGGGAAAACA 39890 Query 453 GCTGTTACTTCAACTCATCATATACCTCCATTTGGATACCCTACTGCATCAAGCTAACTA 512 |||||||||| || ||||| | ||||||||| |||||||| || || ||||||||||||| Sbjct 39891 GCTGTTACTTTAATTCATCGTTTACCTCCATCTGGATACCTTATTGTATCAAGCTAACTA 39950 Query 513 CAAATGGTGATTTGCTGGACCAAAAATGTTTCACTGTTGACGAAATAG 560 ||||||| | |||| |||| |||||| ||||||| ||||||| Sbjct 39951 GCAATGGTGGTACAGTGGATGAAAAGTGTTTCTCTGTTGATGAAATAG 39998 Score = 140 bits (154), Expect = 1e-29 Identities = 134/171 (78%), Gaps = 3/171 (1%) Strand=Plus/Plus Query 739 GATGGGCCCTATATGGTTAACATACTGTCCAGTGTACTCATTGAGAATGGATAAAGAACA 798 ||||| |||||||| | ||||| ||||||||||||||||| | ||||||| ||| | Sbjct 56119 GATGGACCCTATATTGACAACATCAGTTCCAGTGTACTCATTGAAAGTGGATAAGGAATA 56178 Query 799 TGAAGTGCGGGTGAGATCCAGACAACGGAGCTTTGAAAAGTACAGCGAGTTCAGCGAAGT 858 ||||||||| |||||||||| |||||| | || || ||| || |||||||||| || || Sbjct 56179 TGAAGTGCGTGTGAGATCCAAACAACGAAACTCTGGAAATTATGGCGAGTTCAGTGAGGT 56238 Query 859 CCTCCGTGTAATATTTCCTCAGACGAACATATTGGAAGCATGTGAAGAAGG 909 ||| ||||| | ||||||||| || | ||| ||||||||||||| Sbjct 56239 GCTCTATGTAACACTTCCTCAGATGAGCCAATT---TACATGTGAAGAAGG 56286 Score = 95.1 bits (104), Expect = 5e-16 Identities = 99/130 (76%), Gaps = 0/130 (0%) Strand=Plus/Plus Query 235 TTCTTCTGGAAAGCCTCGATTCACCAAGTGTCGTTCCCCTGAACTGGAGACATTTTCATG 294 ||||||| ||||| |||||||||||| ||||| ||||| | ||||| |||||||| Sbjct 33800 TTCTTCTAAGGAGCCTAAATTCACCAAGTGCCGTTCACCTGAGCGAGAGACTTTTTCATG 33859 Query 295 CTACTGGACAGAAGGAGATAATCCTGATTTAAAGACCCCAGGATCTATTCAGCTGTACTA 354 | |||||||||| | | | ||| || | ||||| || |||| | || ||||||| ||| Sbjct 33860 CCACTGGACAGATGAGGTTCATCATGGTACAAAGAACCTAGGACCCATACAGCTGTTCTA 33919 Query 355 TGCTAAAAGG 364 | | | |||| Sbjct 33920 TACCAGAAGG 33929 >gb|AC113368.3| Download subject sequence spanning the HSP Homo sapiens chromosome 5 clone RP11-116B13, complete sequence Length=155354 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 219 bits (242), Expect = 2e-53 Identities = 157/181 (86%), Gaps = 0/181 (0%) Strand=Plus/Plus Query 559 AGTGCAACCTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGG 618 ||||||||| ||||||||||||| |||||||||||||||||| ||| | ||||| || || Sbjct 66530 AGTGCAACCAGATCCACCCATTGCCCTCAACTGGACTTTACTGAACGTCAGTTTAACTGG 66589 Query 619 GATTCGTGGAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGG 678 ||||| || ||| ||||||||||| ||| || |||||| |||||||||| ||| ||| || Sbjct 66590 GATTCATGCAGATATCCAAGTGAGATGGGAAGCACCACGCAATGCAGATATTCAGAAAGG 66649 Query 679 ATGGATAATTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGT 738 |||||| |||||||||||||| |||| |||||||||||||||||| | ||||||||| | Sbjct 66650 ATGGATGGTTCTGGAGTATGAACTTCAATACAAAGAAGTAAATGAAACTAAATGGAAAAT 66709 Query 739 G 739 | Sbjct 66710 G 66710 Score = 187 bits (206), Expect = 1e-43 Identities = 142/168 (84%), Gaps = 0/168 (0%) Strand=Plus/Plus Query 393 CTCATGAATGGACCCAGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAAAAAACA 452 |||| |||||||| || |||||||||||||||||||||||||| |||||||| |||||| Sbjct 61630 CTCAAGAATGGACTCAAGAATGGAAAGAATGCCCTGATTATGTTTCTGCTGGGGAAAACA 61689 Query 453 GCTGTTACTTCAACTCATCATATACCTCCATTTGGATACCCTACTGCATCAAGCTAACTA 512 |||||||||| || ||||| | ||||||||| |||||||| || || ||||||||||||| Sbjct 61690 GCTGTTACTTTAATTCATCGTTTACCTCCATCTGGATACCTTATTGTATCAAGCTAACTA 61749 Query 513 CAAATGGTGATTTGCTGGACCAAAAATGTTTCACTGTTGACGAAATAG 560 ||||||| | |||| |||| |||||| ||||||| ||||||| Sbjct 61750 GCAATGGTGGTACAGTGGATGAAAAGTGTTTCTCTGTTGATGAAATAG 61797 Score = 140 bits (154), Expect = 1e-29 Identities = 134/171 (78%), Gaps = 3/171 (1%) Strand=Plus/Plus Query 739 GATGGGCCCTATATGGTTAACATACTGTCCAGTGTACTCATTGAGAATGGATAAAGAACA 798 ||||| |||||||| | ||||| ||||||||||||||||| | ||||||| ||| | Sbjct 77914 GATGGACCCTATATTGACAACATCAGTTCCAGTGTACTCATTGAAAGTGGATAAGGAATA 77973 Query 799 TGAAGTGCGGGTGAGATCCAGACAACGGAGCTTTGAAAAGTACAGCGAGTTCAGCGAAGT 858 ||||||||| |||||||||| |||||| | || || ||| || |||||||||| || || Sbjct 77974 TGAAGTGCGTGTGAGATCCAAACAACGAAACTCTGGAAATTATGGCGAGTTCAGTGAGGT 78033 Query 859 CCTCCGTGTAATATTTCCTCAGACGAACATATTGGAAGCATGTGAAGAAGG 909 ||| ||||| | ||||||||| || | ||| ||||||||||||| Sbjct 78034 GCTCTATGTAACACTTCCTCAGATGAGCCAATT---TACATGTGAAGAAGG 78081 Score = 95.1 bits (104), Expect = 5e-16 Identities = 99/130 (76%), Gaps = 0/130 (0%) Strand=Plus/Plus Query 235 TTCTTCTGGAAAGCCTCGATTCACCAAGTGTCGTTCCCCTGAACTGGAGACATTTTCATG 294 ||||||| ||||| |||||||||||| ||||| ||||| | ||||| |||||||| Sbjct 55599 TTCTTCTAAGGAGCCTAAATTCACCAAGTGCCGTTCACCTGAGCGAGAGACTTTTTCATG 55658 Query 295 CTACTGGACAGAAGGAGATAATCCTGATTTAAAGACCCCAGGATCTATTCAGCTGTACTA 354 | |||||||||| | | | ||| || | ||||| || |||| | || ||||||| ||| Sbjct 55659 CCACTGGACAGATGAGGTTCATCATGGTACAAAGAACCTAGGACCCATACAGCTGTTCTA 55718 Query 355 TGCTAAAAGG 364 | | | |||| Sbjct 55719 TACCAGAAGG 55728 >gb|AY958720.1| Pygathrix nemaeus growth hormone receptor (GHR) gene, exon 6 and partial cds Length=239 Score = 219 bits (242), Expect = 2e-53 Identities = 157/181 (86%), Gaps = 0/181 (0%) Strand=Plus/Plus Query 559 AGTGCAACCTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGG 618 ||||||||| ||||||||||||| |||||||||||||||||| ||| | ||||| || || Sbjct 28 AGTGCAACCAGATCCACCCATTGCCCTCAACTGGACTTTACTGAACGTCAGTTTAACTGG 87 Query 619 GATTCGTGGAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGG 678 ||||| || ||| || |||||||| ||| || ||||||||||||||||| ||| ||| || Sbjct 88 GATTCATGCAGATATTCAAGTGAGATGGGAAGCACCACCCAATGCAGATATTCAGAAAGG 147 Query 679 ATGGATAATTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGT 738 |||||| |||||||||||||| |||| |||||||||||||||||| | ||||||||| | Sbjct 148 ATGGATGGTTCTGGAGTATGAACTTCAATACAAAGAAGTAAATGAAACTAAATGGAAAAT 207 Query 739 G 739 | Sbjct 208 G 208 >gb|AY958719.1| Pygathrix roxellana growth hormone receptor (GHR) gene, exon 6 and partial cds Length=232 Score = 219 bits (242), Expect = 2e-53 Identities = 157/181 (86%), Gaps = 0/181 (0%) Strand=Plus/Plus Query 559 AGTGCAACCTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGG 618 ||||||||| ||||||||||||| |||||||||||||||||| ||| | ||||| || || Sbjct 27 AGTGCAACCAGATCCACCCATTGCCCTCAACTGGACTTTACTGAACGTCAGTTTAACTGG 86 Query 619 GATTCGTGGAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGG 678 ||||| || ||| || |||||||| ||| || ||||||||||||||||| ||| ||| || Sbjct 87 GATTCATGCAGATATTCAAGTGAGATGGGAAGCACCACCCAATGCAGATATTCAGAAAGG 146 Query 679 ATGGATAATTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGT 738 |||||| |||||||||||||| |||| |||||||||||||||||| | ||||||||| | Sbjct 147 ATGGATGGTTCTGGAGTATGAACTTCAATACAAAGAAGTAAATGAAACTAAATGGAAAAT 206 Query 739 G 739 | Sbjct 207 G 207 >gb|M28462.1|HUMGHRA05 Human growth hormone receptor gene, exon 6 Length=277 Score = 219 bits (242), Expect = 2e-53 Identities = 157/181 (86%), Gaps = 0/181 (0%) Strand=Plus/Plus Query 559 AGTGCAACCTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGG 618 ||||||||| ||||||||||||| |||||||||||||||||| ||| | ||||| || || Sbjct 54 AGTGCAACCAGATCCACCCATTGCCCTCAACTGGACTTTACTGAACGTCAGTTTAACTGG 113 Query 619 GATTCGTGGAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGG 678 ||||| || ||| ||||||||||| ||| || |||||| |||||||||| ||| ||| || Sbjct 114 GATTCATGCAGATATCCAAGTGAGATGGGAAGCACCACGCAATGCAGATATTCAGAAAGG 173 Query 679 ATGGATAATTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGT 738 |||||| |||||||||||||| |||| |||||||||||||||||| | ||||||||| | Sbjct 174 ATGGATGGTTCTGGAGTATGAACTTCAATACAAAGAAGTAAATGAAACTAAATGGAAAAT 233 Query 739 G 739 | Sbjct 234 G 234 >dbj|AB254885.1| Eudromia elegans GHR mRNA for growth hormone receptor, partial cds, 5'portion Length=464 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 217 bits (240), Expect = 6e-53 Identities = 213/275 (77%), Gaps = 0/275 (0%) Strand=Plus/Plus Query 410 GAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAAAAAACAGCTGTTACTTCAACTCA 469 || ||||||||||| ||||||||| || |||| ||| |||| |||||||| |||||| | Sbjct 186 GACTGGAAAGAATGTCCTGATTATATCACTGCAGGAGAAAATAGCTGTTATTTCAACACG 245 Query 470 TCATATACCTCCATTTGGATACCCTACTGCATCAAGCTAACTACAAATGGTGATTTGCTG 529 || || ||||| ||||||||||| || || | ||||| | | || | ||| | | Sbjct 246 TCTTACACCTCTATTTGGATACCATATTGTGTTAAGCTTGCCAATAAAGATGAAGTATTT 305 Query 530 GACCAAAAATGTTTCACTGTTGACGAAATAGTGCAACCTGATCCACCCATTGGCCTCAAC 589 || |||||||||||| |||||| |||||||| | ||||||||| || | ||| ||| Sbjct 306 GATGAAAAATGTTTCAGTGTTGATGAAATAGTACTACCTGATCCCCCTGTCCACCTTAAC 365 Query 590 TGGACTTTACTAAACATTAGTTTGACCGGGATTCGTGGAGACATCCAAGTGAGTTGGCAA 649 |||||| | ||||| | |||| ||| ||||| | ||| || |||||||| || ||| | Sbjct 366 TGGACTCTGCTAAATACTAGTCAGACTGGGATCCATGGGGATATCCAAGTAAGATGGGAT 425 Query 650 CCACCACCCAATGCAGATGTTCTGAAGGGATGGAT 684 |||||||| | |||||||||| |||||||||||| Sbjct 426 CCACCACCAACAGCAGATGTTCAGAAGGGATGGAT 460 Score = 73.4 bits (80), Expect = 2e-09 Identities = 87/118 (73%), Gaps = 0/118 (0%) Strand=Plus/Plus Query 247 GCCTCGATTCACCAAGTGTCGTTCCCCTGAACTGGAGACATTTTCATGCTACTGGACAGA 306 ||| | | ||| |||||| | || |||||||||||||| |||||||| || ||||| || Sbjct 59 GCCACAAATCAGCAAGTGCAGATCACCTGAACTGGAGACGTTTTCATGTTATTGGACTGA 118 Query 307 AGGAGATAATCCTGATTTAAAGACCCCAGGATCTATTCAGCTGTACTATGCTAAAAGG 364 ||| ||| | | || ||| | |||||| | || ||||||| ||| |||||| Sbjct 119 TGGAAATATTTATAATCTAACTGCTCCAGGAACAATACAGCTGTTGTATATGAAAAGG 176 >dbj|AB254869.1| Struthio camelus GHR mRNA for growth hormone receptor, partial cds, 5'portion Length=464 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 217 bits (240), Expect = 6e-53 Identities = 213/275 (77%), Gaps = 0/275 (0%) Strand=Plus/Plus Query 410 GAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAAAAAACAGCTGTTACTTCAACTCA 469 || ||||||||||| ||||||||| || |||| ||| |||| |||||||| |||||| | Sbjct 186 GACTGGAAAGAATGTCCTGATTATATCACTGCAGGAGAAAATAGCTGTTATTTCAACACG 245 Query 470 TCATATACCTCCATTTGGATACCCTACTGCATCAAGCTAACTACAAATGGTGATTTGCTG 529 || || ||||| ||||||||||| || || | ||||| | | || | ||| | | Sbjct 246 TCTTACACCTCTATTTGGATACCATATTGTGTTAAGCTTGCCAGTAAAGATGAAGTATTT 305 Query 530 GACCAAAAATGTTTCACTGTTGACGAAATAGTGCAACCTGATCCACCCATTGGCCTCAAC 589 || |||||||||||| |||||| |||||||| | ||||||||| || | ||| ||| Sbjct 306 GATGAAAAATGTTTCAGTGTTGATGAAATAGTACTACCTGATCCCCCTGTCCACCTTAAC 365 Query 590 TGGACTTTACTAAACATTAGTTTGACCGGGATTCGTGGAGACATCCAAGTGAGTTGGCAA 649 |||||| | ||||| | |||| ||| ||||| | ||| || |||||||| || ||| | Sbjct 366 TGGACTCTGCTAAATACTAGTCAGACTGGGATCCATGGGGATATCCAAGTAAGATGGGAT 425 Query 650 CCACCACCCAATGCAGATGTTCTGAAGGGATGGAT 684 |||||||| | |||||||||| |||||||||||| Sbjct 426 CCACCACCAACAGCAGATGTTCAGAAGGGATGGAT 460 Score = 57.2 bits (62), Expect = 1e-04 Identities = 75/104 (72%), Gaps = 0/104 (0%) Strand=Plus/Plus Query 247 GCCTCGATTCACCAAGTGTCGTTCCCCTGAACTGGAGACATTTTCATGCTACTGGACAGA 306 ||| | | ||| |||||| | || || ||||||||||| |||||||| || ||||| || Sbjct 59 GCCACAAATCAGCAAGTGCAGGTCACCGGAACTGGAGACGTTTTCATGTTATTGGACTGA 118 Query 307 AGGAGATAATCCTGATTTAAAGACCCCAGGATCTATTCAGCTGT 350 ||| || | | | | | | |||||||| || ||||||| Sbjct 119 TGGAAATTTTTATAACCTCACTGCTCCAGGATCAATACAGCTGT 162 >gb|AY958718.1| Pithecia pithecia growth hormone receptor (GHR) gene, exon 6 and partial cds Length=236 Score = 214 bits (236), Expect = 8e-52 Identities = 156/181 (86%), Gaps = 0/181 (0%) Strand=Plus/Plus Query 559 AGTGCAACCTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGG 618 ||||||||| ||||||||||||| |||||||||||||||||| ||||| ||||| || || Sbjct 25 AGTGCAACCAGATCCACCCATTGCCCTCAACTGGACTTTACTGAACATCAGTTTAACTGG 84 Query 619 GATTCGTGGAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGG 678 | ||| || ||| ||||||||||| ||| || ||||||||||||||||| ||| ||| || Sbjct 85 GGTTCATGCAGATATCCAAGTGAGATGGGAAGCACCACCCAATGCAGATATTCAGAAAGG 144 Query 679 ATGGATAATTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGT 738 |||||| |||||||||||||| |||| |||||||||||||||||| | | |||||| | Sbjct 145 ATGGATGGTTCTGGAGTATGAACTTCAATACAAAGAAGTAAATGAAACTCAGTGGAAAAT 204 Query 739 G 739 | Sbjct 205 G 205 >gb|AY579204.1|AY579203S2 Gene info Homo sapiens growth hormone receptor variant gene, exon 9 and partial cds Length=209 Score = 214 bits (236), Expect = 8e-52 Identities = 156/181 (86%), Gaps = 0/181 (0%) Strand=Plus/Plus Query 559 AGTGCAACCTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGG 618 ||||||||| ||||||||||||| |||||||||||||||||| ||| ||||| || || Sbjct 14 AGTGCAACCAGATCCACCCATTGCCCTCAACTGGACTTTACTGAACGCCAGTTTAACTGG 73 Query 619 GATTCGTGGAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGG 678 ||||| || ||| ||||||||||| ||| || |||||| |||||||||| ||| ||| || Sbjct 74 GATTCATGCAGATATCCAAGTGAGATGGGAAGCACCACGCAATGCAGATATTCAGAAAGG 133 Query 679 ATGGATAATTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGT 738 |||||| |||||||||||||| |||| |||||||||||||||||| | ||||||||| | Sbjct 134 ATGGATGGTTCTGGAGTATGAACTTCAATACAAAGAAGTAAATGAAACTAAATGGAAAAT 193 Query 739 G 739 | Sbjct 194 G 194 >gb|AY958717.1| Alouatta seniculus growth hormone receptor (GHR) gene, exon 6 and partial cds Length=216 Score = 201 bits (222), Expect = 5e-48 Identities = 153/181 (84%), Gaps = 0/181 (0%) Strand=Plus/Plus Query 559 AGTGCAACCTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGG 618 ||||||||| ||||||||||||| |||||||||||||||||| ||||| ||||| || || Sbjct 14 AGTGCAACCAGATCCACCCATTGCCCTCAACTGGACTTTACTGAACATCAGTTTAACTGG 73 Query 619 GATTCGTGGAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGG 678 | ||| || ||| ||||||||||| ||| || ||||||||| ||||||| ||| ||| || Sbjct 74 GGTTCATGCAGATATCCAAGTGAGATGGGAAGCACCACCCAGTGCAGATATTCGGAAAGG 133 Query 679 ATGGATAATTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGT 738 |||| | ||||||||||||| |||| |||||||||||||||||| | | |||||| | Sbjct 134 ATGGGTGGCTCTGGAGTATGAACTTCAATACAAAGAAGTAAATGAAACTCAGTGGAAAAT 193 Query 739 G 739 | Sbjct 194 G 194 >gb|AY958716.1| Pygathrix nemaeus growth hormone receptor (GHR) gene, exon 5 and partial cds Length=254 Score = 196 bits (216), Expect = 2e-46 Identities = 144/168 (85%), Gaps = 0/168 (0%) Strand=Plus/Plus Query 393 CTCATGAATGGACCCAGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAAAAAACA 452 |||| |||||||| || |||||||||||||||||||||||||| |||||||| |||||| Sbjct 42 CTCAAGAATGGACTCAAGAATGGAAAGAATGCCCTGATTATGTTTCTGCTGGGGAAAACA 101 Query 453 GCTGTTACTTCAACTCATCATATACCTCCATTTGGATACCCTACTGCATCAAGCTAACTA 512 |||||||||| || ||||||| ||||||||| |||||||| || || ||||||||||||| Sbjct 102 GCTGTTACTTTAATTCATCATTTACCTCCATCTGGATACCTTATTGTATCAAGCTAACTA 161 Query 513 CAAATGGTGATTTGCTGGACCAAAAATGTTTCACTGTTGACGAAATAG 560 ||||||| | |||| |||| |||||| ||||||||||||||| Sbjct 162 GCAATGGTGGTACAATGGATGAAAAGTGTTTCTCTGTTGACGAAATAG 209 >gb|AY958715.1| Pygathrix roxellana growth hormone receptor (GHR) gene, exon 5 and partial cds Length=249 Score = 196 bits (216), Expect = 2e-46 Identities = 144/168 (85%), Gaps = 0/168 (0%) Strand=Plus/Plus Query 393 CTCATGAATGGACCCAGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAAAAAACA 452 |||| | |||||| || |||||||||||||||||||||||||| |||||||| |||||| Sbjct 44 CTCAAGGATGGACTCAAGAATGGAAAGAATGCCCTGATTATGTTTCTGCTGGGGAAAACA 103 Query 453 GCTGTTACTTCAACTCATCATATACCTCCATTTGGATACCCTACTGCATCAAGCTAACTA 512 |||||||||| |||||||||| ||||||||| |||||||| || || ||||||||||||| Sbjct 104 GCTGTTACTTTAACTCATCATTTACCTCCATCTGGATACCTTATTGTATCAAGCTAACTA 163 Query 513 CAAATGGTGATTTGCTGGACCAAAAATGTTTCACTGTTGACGAAATAG 560 ||||||| | |||| |||| |||||| ||||||||||||||| Sbjct 164 GCAATGGTGGTACAATGGATGAAAAGTGTTTCTCTGTTGACGAAATAG 211 >gb|EF207442.2| Bos indicus growth hormone receptor (GHR) gene, complete cds Length=3876 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 187 bits (206), Expect = 1e-43 Identities = 150/181 (82%), Gaps = 0/181 (0%) Strand=Plus/Plus Query 559 AGTGCAACCTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGG 618 ||| ||||| ||||||||| ||||||||||||||||| |||| ||||| |||||||| | Sbjct 1319 AGTACAACCAGATCCACCCGTTGGCCTCAACTGGACTCTACTGAACATCAGTTTGACGGA 1378 Query 619 GATTCGTGGAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGG 678 ||||| || ||||||| ||||| ||| |||||||||||||| |||||||| || ||| Sbjct 1379 GATTCATGCCGACATCCTAGTGAAATGGGAACCACCACCCAATACAGATGTTAAGATGGG 1438 Query 679 ATGGATAATTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGT 738 ||||||||| |||||||||||| | || || |||||| ||||||| | | |||||| | Sbjct 1439 ATGGATAATCCTGGAGTATGAACTGCACTATAAAGAACTAAATGAGACCCAGTGGAAAAT 1498 Query 739 G 739 | Sbjct 1499 G 1499 Score = 156 bits (172), Expect = 2e-34 Identities = 127/154 (82%), Gaps = 0/154 (0%) Strand=Plus/Plus Query 407 CAGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAAAAAACAGCTGTTACTTCAAC 466 || ||||||||||||||||| ||||| ||||||||||| |||||||||||||||| || Sbjct 942 CAAGAATGGAAAGAATGCCCCGATTACGTCTCTGCTGGTGAAAACAGCTGTTACTTTAAT 1001 Query 467 TCATCATATACCTCCATTTGGATACCCTACTGCATCAAGCTAACTACAAATGGTGATTTG 526 || || |||||||| | |||| |||||||||||||||||||||| ||||| | | | Sbjct 1002 TCGTCTTATACCTCTGTGTGGACCCCCTACTGCATCAAGCTAACTAGCAATGGCGGTATT 1061 Query 527 CTGGACCAAAAATGTTTCACTGTTGACGAAATAG 560 |||| || || |||||| ||||||| || |||| Sbjct 1062 GTGGATCATAAGTGTTTCTCTGTTGAGGACATAG 1095 Score = 127 bits (140), Expect = 9e-26 Identities = 131/171 (76%), Gaps = 3/171 (1%) Strand=Plus/Plus Query 739 GATGGGCCCTATATGGTTAACATACTGTCCAGTGTACTCATTGAGAATGGATAAAGAACA 798 ||||| |||| || | |||||| ||| ||||||| |||||| |||||||||| | Sbjct 1611 GATGGACCCTTTAATGGTAACATCAGTTCCGATGTACTCGTTGAGACTGGATAAAGAGTA 1670 Query 799 TGAAGTGCGGGTGAGATCCAGACAACGGAGCTTTGAAAAGTACAGCGAGTTCAGCGAAGT 858 ||||||||| |||||| |||||||||| | | |||||| || || ||||||| || || Sbjct 1671 TGAAGTGCGTGTGAGAACCAGACAACGAAACACTGAAAAATATGGCAAGTTCAGTGAGGT 1730 Query 859 CCTCCGTGTAATATTTCCTCAGACGAACATATTGGAAGCATGTGAAGAAGG 909 |||| ||| ||||||||||| |||| || |||||||||||||| Sbjct 1731 GCTCCTGATAACATTTCCTCAGATGAACCCAT---CTGCATGTGAAGAAGG 1778 Score = 114 bits (126), Expect = 6e-22 Identities = 98/121 (80%), Gaps = 0/121 (0%) Strand=Plus/Plus Query 235 TTCTTCTGGAAAGCCTCGATTCACCAAGTGTCGTTCCCCTGAACTGGAGACATTTTCATG 294 ||||||||| || ||| |||||||||||| ||||| |||||||||||||| || ||||| Sbjct 676 TTCTTCTGGGAATCCTAAATTCACCAAGTGCCGTTCACCTGAACTGGAGACTTTCTCATG 735 Query 295 CTACTGGACAGAAGGAGATAATCCTGATTTAAAGACCCCAGGATCTATTCAGCTGTACTA 354 |||||||||| || | ||||| |||| ||| |||||||||| | ||| ||| ||| Sbjct 736 TCACTGGACAGATGGGGCTAATCACAGTTTACAGAGCCCAGGATCTGTACAGATGTTCTA 795 Query 355 T 355 | Sbjct 796 T 796 Score = 55.4 bits (60), Expect = 5e-04 Identities = 56/73 (76%), Gaps = 0/73 (0%) Strand=Plus/Plus Query 93 CAGGTATGGATCTTTGTCAGGTCTTCTTAACCTTGGCACTGGCAGTCACCAGCAGCACAT 152 ||||||||||||| || ||| | | || ||||||||| |||||| | |||| | | Sbjct 206 CAGGTATGGATCTCTGGCAGCTGCTGTTGACCTTGGCAGTGGCAGGCTCCAGTGATGCTT 265 Query 153 TTTCTGGAAGTGA 165 ||||||| ||||| Sbjct 266 TTTCTGGGAGTGA 278 >emb|AM161140.1| Gene info Bos taurus GHR gene for growth hormone receptor, exons 2-10, Finnish Ayrshire Breed Length=8201 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 187 bits (206), Expect = 1e-43 Identities = 150/181 (82%), Gaps = 0/181 (0%) Strand=Plus/Plus Query 559 AGTGCAACCTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGG 618 ||| ||||| ||||||||| ||||||||||||||||| |||| ||||| |||||||| | Sbjct 3267 AGTACAACCAGATCCACCCGTTGGCCTCAACTGGACTCTACTGAACATCAGTTTGACAGA 3326 Query 619 GATTCGTGGAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGG 678 ||||| || ||||||| ||||| ||| |||||||||||||| |||||||| || ||| Sbjct 3327 GATTCATGCCGACATCCTAGTGAAATGGGAACCACCACCCAATACAGATGTTAAGATGGG 3386 Query 679 ATGGATAATTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGT 738 ||||||||| |||||||||||| | || || |||||| ||||||| | | |||||| | Sbjct 3387 ATGGATAATCCTGGAGTATGAACTGCACTATAAAGAACTAAATGAGACCCAGTGGAAAAT 3446 Query 739 G 739 | Sbjct 3447 G 3447 Score = 156 bits (172), Expect = 2e-34 Identities = 127/154 (82%), Gaps = 0/154 (0%) Strand=Plus/Plus Query 407 CAGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAAAAAACAGCTGTTACTTCAAC 466 || ||||||||||||||||| ||||| ||||||||||| |||||||||||||||| || Sbjct 2341 CAAGAATGGAAAGAATGCCCCGATTACGTCTCTGCTGGTGAAAACAGCTGTTACTTTAAT 2400 Query 467 TCATCATATACCTCCATTTGGATACCCTACTGCATCAAGCTAACTACAAATGGTGATTTG 526 || || |||||||| | |||| |||||||||||||||||||||| ||||| | | | Sbjct 2401 TCGTCTTATACCTCTGTGTGGACCCCCTACTGCATCAAGCTAACTAGCAATGGCGGTATT 2460 Query 527 CTGGACCAAAAATGTTTCACTGTTGACGAAATAG 560 |||| || || |||||| ||||||| || |||| Sbjct 2461 GTGGATCATAAGTGTTTCTCTGTTGAGGACATAG 2494 Score = 127 bits (140), Expect = 9e-26 Identities = 131/171 (76%), Gaps = 3/171 (1%) Strand=Plus/Plus Query 739 GATGGGCCCTATATGGTTAACATACTGTCCAGTGTACTCATTGAGAATGGATAAAGAACA 798 ||||| |||| || | |||||| ||| ||||||| |||||| |||||||||| | Sbjct 3925 GATGGACCCTTTAATGGTAACATCAGTTCCGATGTACTCGTTGAGACTGGATAAAGAGTA 3984 Query 799 TGAAGTGCGGGTGAGATCCAGACAACGGAGCTTTGAAAAGTACAGCGAGTTCAGCGAAGT 858 ||||||||| |||||| |||||||||| | | |||||| || || ||||||| || || Sbjct 3985 TGAAGTGCGTGTGAGAACCAGACAACGAAACACTGAAAAATATGGCAAGTTCAGTGAGGT 4044 Query 859 CCTCCGTGTAATATTTCCTCAGACGAACATATTGGAAGCATGTGAAGAAGG 909 |||| ||| ||||||||||| |||| || |||||||||||||| Sbjct 4045 GCTCCTGATAACATTTCCTCAGATGAACCCAT---CTGCATGTGAAGAAGG 4092 Score = 111 bits (122), Expect = 7e-21 Identities = 97/121 (80%), Gaps = 0/121 (0%) Strand=Plus/Plus Query 235 TTCTTCTGGAAAGCCTCGATTCACCAAGTGTCGTTCCCCTGAACTGGAGACATTTTCATG 294 ||||||||| || ||| |||||||||||| ||||| |||||||||||||| || ||||| Sbjct 1713 TTCTTCTGGGAATCCTAAATTCACCAAGTGCCGTTCACCTGAACTGGAGACTTTCTCATG 1772 Query 295 CTACTGGACAGAAGGAGATAATCCTGATTTAAAGACCCCAGGATCTATTCAGCTGTACTA 354 |||||||||| | | ||||| |||| ||| |||||||||| | ||| ||| ||| Sbjct 1773 TCACTGGACAGATGTGGCTAATCACAGTTTACAGAGCCCAGGATCTGTACAGATGTTCTA 1832 Query 355 T 355 | Sbjct 1833 T 1833 Score = 55.4 bits (60), Expect = 5e-04 Identities = 56/73 (76%), Gaps = 0/73 (0%) Strand=Plus/Plus Query 93 CAGGTATGGATCTTTGTCAGGTCTTCTTAACCTTGGCACTGGCAGTCACCAGCAGCACAT 152 ||||||||||||| || ||| | | || ||||||||| |||||| | |||| | | Sbjct 223 CAGGTATGGATCTCTGGCAGCTGCTGTTGACCTTGGCAGTGGCAGGCTCCAGTGATGCTT 282 Query 153 TTTCTGGAAGTGA 165 ||||||| ||||| Sbjct 283 TTTCTGGGAGTGA 295 >gb|M28461.1|HUMGHRA04 Human growth hormone receptor gene, exon 5 Length=289 Score = 187 bits (206), Expect = 1e-43 Identities = 142/168 (84%), Gaps = 0/168 (0%) Strand=Plus/Plus Query 393 CTCATGAATGGACCCAGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAAAAAACA 452 |||| |||||||| || |||||||||||||||||||||||||| |||||||| |||||| Sbjct 64 CTCAAGAATGGACTCAAGAATGGAAAGAATGCCCTGATTATGTTTCTGCTGGGGAAAACA 123 Query 453 GCTGTTACTTCAACTCATCATATACCTCCATTTGGATACCCTACTGCATCAAGCTAACTA 512 |||||||||| || ||||| | ||||||||| |||||||| || || ||||||||||||| Sbjct 124 GCTGTTACTTTAATTCATCGTTTACCTCCATCTGGATACCTTATTGTATCAAGCTAACTA 183 Query 513 CAAATGGTGATTTGCTGGACCAAAAATGTTTCACTGTTGACGAAATAG 560 ||||||| | |||| |||| |||||| ||||||| ||||||| Sbjct 184 GCAATGGTGGTACAGTGGATGAAAAGTGTTTCTCTGTTGATGAAATAG 231 >gb|AF097588.1|AF097588 Equus caballus growth hormone receptor precursor (GHR) gene, partial cds Length=155 Score = 185 bits (204), Expect = 4e-43 Identities = 128/145 (88%), Gaps = 0/145 (0%) Strand=Plus/Plus Query 579 TTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGGGATTCGTGGAGACATCCAAG 638 ||||||||||||||||| |||| ||||| ||||| |||||||||| || ||| ||||||| Sbjct 1 TTGGCCTCAACTGGACTCTACTGAACATCAGTTTAACCGGGATTCATGCAGATATCCAAG 60 Query 639 TGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGGATGGATAATTCTGGAGTATG 698 |||| ||| |||||||||||||||||||||||| |||||| |||||| | |||||||||| Sbjct 61 TGAGGTGGGAACCACCACCCAATGCAGATGTTCAGAAGGGGTGGATAGTCCTGGAGTATG 120 Query 699 AAATTCAGTACAAAGAAGTAAATGA 723 || | || ||||||||| ||||||| Sbjct 121 AACTGCAATACAAAGAACTAAATGA 145 >gb|DQ179242.1|DQ179241S2 Capra hircus growth hormone receptor gene, exon 6 Length=310 Score = 183 bits (202), Expect = 1e-42 Identities = 149/181 (82%), Gaps = 0/181 (0%) Strand=Plus/Plus Query 559 AGTGCAACCTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGG 618 ||| ||||| ||||||||| ||||||||||||||||| | || ||||| |||||||| | Sbjct 73 AGTACAACCAGATCCACCCGTTGGCCTCAACTGGACTCTGCTGAACATCAGTTTGACGGA 132 Query 619 GATTCGTGGAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGG 678 ||||| || ||||||| ||||| ||| |||||||||||||| |||||||| || ||| Sbjct 133 GATTCATGCCGACATCCTAGTGAAATGGGAACCACCACCCAATACAGATGTTAAGATGGG 192 Query 679 ATGGATAATTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGT 738 ||||||||| |||||||||||| | || || |||||| ||||||| | | |||||| | Sbjct 193 ATGGATAATCCTGGAGTATGAACTGCACTATAAAGAACTAAATGAGACCCAGTGGAAAAT 252 Query 739 G 739 | Sbjct 253 G 253 >gb|EF030077.1| Capra hircus breed Gaddi growth hormone receptor variant B (GHR) gene, exon 6 and partial cds Length=220 Score = 181 bits (200), Expect = 5e-42 Identities = 148/181 (81%), Gaps = 0/181 (0%) Strand=Plus/Plus Query 559 AGTGCAACCTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGG 618 ||| ||||| ||||||||| ||||||||||||||||| | || ||||| ||||||| | Sbjct 23 AGTACAACCAGATCCACCCGTTGGCCTCAACTGGACTCTGCTGAACATCGGTTTGACGGA 82 Query 619 GATTCGTGGAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGG 678 ||||| || ||||||| ||||| || |||||||||||||| |||||||| || ||| Sbjct 83 GATTCATGCCGACATCCTAGTGAAATGNGAACCACCACCCAATNCAGATGTTAAGATGGG 142 Query 679 ATGGATAATTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGT 738 ||||||||| |||||||||||| |||| || |||||| ||||||| | | |||||| | Sbjct 143 ATGGATAATCCTGGAGTATGAACTTCACTATAAAGAACTAAATGAGACCCAGTGGAAAAT 202 Query 739 G 739 | Sbjct 203 G 203 >gb|EF030087.1| Capra hircus breed Jakhrana growth hormone receptor variant A (GHR) gene, exon 6 and partial cds Length=220 Score = 179 bits (198), Expect = 2e-41 Identities = 138/165 (83%), Gaps = 0/165 (0%) Strand=Plus/Plus Query 559 AGTGCAACCTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGG 618 ||| ||||| ||||||||| ||||||||||||||||| | || ||||| |||||||| | Sbjct 23 AGTACAACCAGATCCACCCTTTGGCCTCAACTGGACTCTGCTGAACATCAGTTTGACGGA 82 Query 619 GATTCGTGGAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGG 678 |||| || ||||||| ||||| ||| |||||||||||||| |||||||| || ||| Sbjct 83 GATTNATGCCGACATCCTAGTGAAATGGGAACCACCACCCAATACAGATGTTAAGATGGG 142 Query 679 ATGGATAATTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGA 723 ||||||||| |||||||||||| | || || |||||| ||||||| Sbjct 143 ATGGATAATCCTGGAGTATGAACTNCACTATAAAGAACTAAATGA 187 >gb|EF207441.2| Bubalus bubalis growth hormone receptor (GHR) gene, complete cds Length=3872 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Score = 178 bits (196), Expect = 6e-41 Identities = 146/178 (82%), Gaps = 0/178 (0%) Strand=Plus/Plus Query 559 AGTGCAACCTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGG 618 ||| ||||| ||||||||| | ||||||||||||||| |||| ||||| |||||||| | Sbjct 1314 AGTACAACCAGATCCACCCGTGGGCCTCAACTGGACTCTACTGAACATCAGTTTGACGGA 1373 Query 619 GATTCGTGGAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGG 678 ||||| || ||||||| ||||| ||| |||||||||||||| |||||||| || ||| Sbjct 1374 GATTCATGCCGACATCCTAGTGAAATGGGAACCACCACCCAATACAGATGTTAAGATGGG 1433 Query 679 ATGGATAATTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAA 736 ||||||||| |||||||||||| | || || |||||| | ||||| | | |||||| Sbjct 1434 ATGGATAATCCTGGAGTATGAACTGCACTATAAAGAACTGAATGAGACCCAGTGGAAA 1491 Score = 161 bits (178), Expect = 4e-36 Identities = 128/154 (83%), Gaps = 0/154 (0%) Strand=Plus/Plus Query 407 CAGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAAAAAACAGCTGTTACTTCAAC 466 || ||||||||||||||||| ||||| ||||||||||| |||||||||||||||| || Sbjct 937 CAAGAATGGAAAGAATGCCCCGATTACGTCTCTGCTGGTGAAAACAGCTGTTACTTTAAT 996 Query 467 TCATCATATACCTCCATTTGGATACCCTACTGCATCAAGCTAACTACAAATGGTGATTTG 526 || || |||||||| | |||| |||||||||||||||||||||| |||||| | | | Sbjct 997 TCGTCTTATACCTCTGTGTGGACCCCCTACTGCATCAAGCTAACTAGAAATGGCGGTATT 1056 Query 527 CTGGACCAAAAATGTTTCACTGTTGACGAAATAG 560 |||| || || |||||| ||||||| || |||| Sbjct 1057 GTGGATCATAAGTGTTTCTCTGTTGAGGACATAG 1090 Score = 122 bits (134), Expect = 4e-24 Identities = 130/171 (76%), Gaps = 3/171 (1%) Strand=Plus/Plus Query 739 GATGGGCCCTATATGGTTAACATACTGTCCAGTGTACTCATTGAGAATGGATAAAGAACA 798 ||||| |||| || | |||||| ||| ||||||| |||||| |||||||||| | Sbjct 1606 GATGGACCCTTTAATGGTAACATCAGTTCCGATGTACTCGTTGAGACTGGATAAAGAGTA 1665 Query 799 TGAAGTGCGGGTGAGATCCAGACAACGGAGCTTTGAAAAGTACAGCGAGTTCAGCGAAGT 858 ||||||||| |||||| |||||||||| | | |||||| || || ||||||| || || Sbjct 1666 TGAAGTGCGTGTGAGAACCAGACAACGAAACACTGAAAAATATGGCAAGTTCAGTGAGGT 1725 Query 859 CCTCCGTGTAATATTTCCTCAGACGAACATATTGGAAGCATGTGAAGAAGG 909 |||| ||| ||||||||||| || | || |||||||||||||| Sbjct 1726 GCTCCTGATAACATTTCCTCAGATGAGCCCAT---CTGCATGTGAAGAAGG 1773 Score = 114 bits (126), Expect = 6e-22 Identities = 98/121 (80%), Gaps = 0/121 (0%) Strand=Plus/Plus Query 235 TTCTTCTGGAAAGCCTCGATTCACCAAGTGTCGTTCCCCTGAACTGGAGACATTTTCATG 294 ||||||||| || ||| |||||||||||| ||||| |||||||||||||| || ||||| Sbjct 671 TTCTTCTGGGAATCCTAAATTCACCAAGTGCCGTTCACCTGAACTGGAGACTTTCTCATG 730 Query 295 CTACTGGACAGAAGGAGATAATCCTGATTTAAAGACCCCAGGATCTATTCAGCTGTACTA 354 |||||||||| || | ||||| |||| ||| |||||||||| | ||| ||| ||| Sbjct 731 TCACTGGACAGATGGGGCTAATCACAGTTTACAGAGCCCAGGATCTGTACAGATGTTCTA 790 Query 355 T 355 | Sbjct 791 T 791 Score = 55.4 bits (60), Expect = 5e-04 Identities = 56/73 (76%), Gaps = 0/73 (0%) Strand=Plus/Plus Query 93 CAGGTATGGATCTTTGTCAGGTCTTCTTAACCTTGGCACTGGCAGTCACCAGCAGCACAT 152 ||||||||||||| || ||| | | || ||||||||| |||||| | |||| | | Sbjct 206 CAGGTATGGATCTCTGGCAGCTGCTGTTGACCTTGGCAGTGGCAGGCTCCAGTGATGCTT 265 Query 153 TTTCTGGAAGTGA 165 ||||||| ||||| Sbjct 266 TTTCTGGGAGTGA 278 >gb|EF030088.1| Capra hircus breed Jakhrana growth hormone receptor variant B (GHR) gene, exon 6 and partial cds Length=220 Score = 178 bits (196), Expect = 6e-41 Identities = 148/181 (81%), Gaps = 0/181 (0%) Strand=Plus/Plus Query 559 AGTGCAACCTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGG 618 ||| ||||| |||||||| ||||||||||||||||| | || ||||| |||||||| | Sbjct 23 AGTACAACCAGATCCACCTTTTGGCCTCAACTGGACTCTGCTGAACATCAGTTTGACGGA 82 Query 619 GATTCGTGGAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGG 678 ||||| || ||||||| ||||| ||| |||||||||||||| |||||||| || ||| Sbjct 83 GATTCATGCCGACATCCTAGTGAAATGGGAACCACCACCCAATACAGATGTTAAGATGGG 142 Query 679 ATGGATAATTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGT 738 ||||||||| |||||||||||| | || || |||||| ||||||| | | |||||| | Sbjct 143 ATGGATAATCCTGGAGTATGAACTGCACTATAAAGAACTAAATGAGACCCAGTGGAAAAT 202 Query 739 G 739 | Sbjct 203 G 203 >gb|AY958714.1| Pithecia pithecia growth hormone receptor (GHR) gene, exon 5 and partial cds Length=272 Score = 178 bits (196), Expect = 6e-41 Identities = 140/168 (83%), Gaps = 0/168 (0%) Strand=Plus/Plus Query 393 CTCATGAATGGACCCAGGAATGGAAAGAATGCCCTGATTATGTCTCTGCTGGAAAAAACA 452 |||| ||| |||| || |||||||||||||||||||||||||| |||||||| |||||| Sbjct 55 CTCAGGAAGGGACTCAAGAATGGAAAGAATGCCCTGATTATGTTTCTGCTGGGGAAAACA 114 Query 453 GCTGTTACTTCAACTCATCATATACCTCCATTTGGATACCCTACTGCATCAAGCTAACTA 512 |||||||||| || ||||| | ||||||||| |||||||| ||||| ||||||||||| | Sbjct 115 GCTGTTACTTTAATTCATCGTTTACCTCCATCTGGATACCTTACTGTATCAAGCTAACCA 174 Query 513 CAAATGGTGATTTGCTGGACCAAAAATGTTTCACTGTTGACGAAATAG 560 ||||||| ||||| |||| |||||| ||||| || |||||| Sbjct 175 GCAATGGTGGAACACTGGATGAAAAGTGTTTCTCTGTTAACCAAATAG 222 >gb|EF030089.1| Capra hircus breed Jakhrana growth hormone receptor variant C (GHR) gene, exon 6 and partial cds Length=220 Score = 176 bits (194), Expect = 2e-40 Identities = 147/181 (81%), Gaps = 0/181 (0%) Strand=Plus/Plus Query 559 AGTGCAACCTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGG 618 ||| ||||| |||||||| ||||||||||||||||| | || ||||| |||||||| | Sbjct 23 AGTACAACCAGATCCACCTTTTGGCCTCAACTGGACTCTGCTGAACATCAGTTTGACGGA 82 Query 619 GATTCGTGGAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGG 678 ||||| || ||||||| ||||| ||| |||||||||||||| |||||||| || ||| Sbjct 83 GATTCATGCCGACATCCTAGTGAAATGGGAACCACCACCCAATACAGATGTTAAGATGGG 142 Query 679 ATGGATAATTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGT 738 ||||||||| |||||||||||| | | || |||||| ||||||| | | |||||| | Sbjct 143 ATGGATAATCCTGGAGTATGAACTGCNCTATAAAGAACTAAATGAGACCCAGTGGAAAAT 202 Query 739 G 739 | Sbjct 203 G 203 >gb|EF030074.1| Ovis aries breed Gaddi growth hormone receptor variant C (GHR) gene, exon 6 and partial cds Length=220 Score = 176 bits (194), Expect = 2e-40 Identities = 147/181 (81%), Gaps = 0/181 (0%) Strand=Plus/Plus Query 559 AGTGCAACCTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGG 618 ||| ||||| |||||||| ||||||||||||||||| | || ||||| |||||||| | Sbjct 23 AGTACAACCAGATCCACCTTTTGGCCTCAACTGGACTCTGCTGAACATAAGTTTGACGGA 82 Query 619 GATTCGTGGAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGG 678 ||||| || ||||||| ||||| ||| |||||||||||||| |||||||| || ||| Sbjct 83 GATTCATGCCGACATCCTAGTGAAATGGGAACCACCACCCAATACAGATGTTAAGATGGG 142 Query 679 ATGGATAATTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGT 738 ||||||||| |||||||||||| | || || |||||| |||||| | | |||||| | Sbjct 143 ATGGATAATCCTGGAGTATGAACTGCACTATAAAGAACTAAATGNGACCCAGTGGAAAAT 202 Query 739 G 739 | Sbjct 203 G 203 >gb|EF030067.1| Ovis aries breed Gurej growth hormone receptor variant H (GHR) gene, exon 6 and partial cds Length=220 Score = 174 bits (192), Expect = 7e-40 Identities = 146/181 (80%), Gaps = 0/181 (0%) Strand=Plus/Plus Query 559 AGTGCAACCTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGG 618 ||| ||||| ||||||||| ||||||||||||||||| | || ||||| |||||||| | Sbjct 23 AGTACAACCAGATCCACCCGTTGGCCTCAACTGGACTCTGCTGAACATGAGTTTGACGGA 82 Query 619 GATTCGTGGAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGG 678 |||| || ||||| | ||||| ||| |||||||||||||| |||||||| || ||| Sbjct 83 GATTNATGCCGACATNCTAGTGAAATGGGAACCACCACCCAATNCAGATGTTAAGATGGG 142 Query 679 ATGGATAATTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGT 738 ||||||||| |||||||||||| | | || |||||| ||||||| | | |||||| | Sbjct 143 ATGGATAATCCTGGAGTATGAATTGCCCTATAAAGAACTAAATGAGACCCAGTGGAAAAT 202 Query 739 G 739 | Sbjct 203 G 203 >gb|EF030090.1| Capra hircus breed Jakhrana growth hormone receptor variant D (GHR) gene, exon 6 and partial cds Length=220 Score = 172 bits (190), Expect = 2e-39 Identities = 146/181 (80%), Gaps = 0/181 (0%) Strand=Plus/Plus Query 559 AGTGCAACCTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGG 618 ||| ||||| ||||||||| ||||||||||||||||| | || ||||| |||||||| | Sbjct 23 AGTACAACCAGATCCACCCTTTGGCCTCAACTGGACTCTGCTGAACATCAGTTTGACGGA 82 Query 619 GATTCGTGGAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGG 678 |||| || ||||||| ||||| || |||||||||||||| |||||||| || ||| Sbjct 83 GATTNATGCCGACATCCTAGTGAAATGNGAACCACCACCCAATACAGATGTTAAGATGGG 142 Query 679 ATGGATAATTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGT 738 ||||||||| |||||||||||| | | || |||||| ||||||| | | |||||| | Sbjct 143 ATGGATAATCCTGGAGTATGAACTGCCCTATAAAGAACTAAATGAGACCCAGTGGAAAAT 202 Query 739 G 739 | Sbjct 203 G 203 >gb|EF030085.1| Capra hircus breed Marwari growth hormone receptor variant E (GHR) gene, exon 6 and partial cds Length=220 Score = 172 bits (190), Expect = 2e-39 Identities = 137/165 (83%), Gaps = 0/165 (0%) Strand=Plus/Plus Query 559 AGTGCAACCTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGG 618 ||| ||||| ||||||||| ||||||||||||||||| |||| ||||| |||||||| | Sbjct 23 AGTACAACCAGATCCACCCGTTGGCCTCAACTGGACTCTACTGAACATCAGTTTGACGGA 82 Query 619 GATTCGTGGAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGG 678 ||||| || ||||||| ||||| ||| | ||||||||||| |||||||| || ||| Sbjct 83 GATTCATGCCGACATCCTAGTGAAATGGGAGACACCACCCAATACAGATGTTAAGATGGG 142 Query 679 ATGGATAATTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGA 723 ||||||||| |||||||||||| | | || |||||| ||||||| Sbjct 143 ATGGATAATCCTGGAGTATGAACTGCCCTATAAAGAACTAAATGA 187 >gb|EF030084.1| Capra hircus breed Marwari growth hormone receptor variant D (GHR) gene, exon 6 and partial cds Length=220 Score = 172 bits (190), Expect = 2e-39 Identities = 137/165 (83%), Gaps = 0/165 (0%) Strand=Plus/Plus Query 559 AGTGCAACCTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGG 618 ||| ||||| ||||||||| ||||||||||||||||| |||| ||||| |||||||| | Sbjct 23 AGTACAACCAGATCCACCCGTTGGCCTCAACTGGACTCTACTGAACATCAGTTTGACGGA 82 Query 619 GATTCGTGGAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGG 678 ||||| || ||||| | ||||| ||| |||||||||||||| |||||||| || ||| Sbjct 83 GATTCATGCCGACATTCTAGTGAAATGGGAACCACCACCCAATACAGATGTTAAGATGGG 142 Query 679 ATGGATAATTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGA 723 ||||||||| |||||| |||| | || || |||||| ||||||| Sbjct 143 ATGGATAATCGTGGAGTGTGAACTGCACTATAAAGAACTAAATGA 187 >gb|EF030083.1| Capra hircus breed Marwari growth hormone receptor variant C (GHR) gene, exon 6 and partial cds Length=220 Score = 172 bits (190), Expect = 2e-39 Identities = 136/165 (82%), Gaps = 0/165 (0%) Strand=Plus/Plus Query 559 AGTGCAACCTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGG 618 ||| ||||| ||||||||| ||||||||||||||||| |||| ||||| |||||||| | Sbjct 23 AGTACAACCAGATCCACCCGTTGGCCTCAACTGGACTCTACTGAACATCAGTTTGACGGA 82 Query 619 GATTCGTGGAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGG 678 |||| || ||||||| ||||| ||| |||||||||||||| |||||||| || ||| Sbjct 83 GATTNATGCCGACATCCTAGTGAAATGGGAACCACCACCCAATACAGATGTTAAGATGGG 142 Query 679 ATGGATAATTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGA 723 ||||||||| |||||| |||| | | || |||||| ||||||| Sbjct 143 ATGGATAATCNTGGAGTGTGAACTNCCCTATAAAGAACTAAATGA 187 >gb|EF030079.1| Capra hircus breed Gaddi growth hormone receptor variant D (GHR) gene, exon 6 and partial cds Length=220 Score = 172 bits (190), Expect = 2e-39 Identities = 146/181 (80%), Gaps = 0/181 (0%) Strand=Plus/Plus Query 559 AGTGCAACCTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGG 618 ||| ||||| |||||||| ||||||||||||||||| | || ||||| |||||||| | Sbjct 23 AGTACAACCAGATCCACCTGTTGGCCTCAACTGGACTCTGCTGAACATCAGTTTGACGGA 82 Query 619 GATTCGTGGAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGG 678 ||||| || ||||||| ||||| || |||||||||||||| |||||||| || ||| Sbjct 83 GATTCATGCCGACATCCTAGTGAAATGCGAACCACCACCCAATACAGATGTTAAGATGGG 142 Query 679 ATGGATAATTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGT 738 ||||||||| |||||||||||| | | || |||||| ||||||| | | |||||| | Sbjct 143 ATGGATAATCCTGGAGTATGAACTNCNCTATAAAGAACTAAATGAGACCCAGTGGAAAAT 202 Query 739 G 739 | Sbjct 203 G 203 >gb|EF030078.1| Capra hircus breed Gaddi growth hormone receptor variant C (GHR) gene, exon 6 and partial cds Length=220 Score = 172 bits (190), Expect = 2e-39 Identities = 146/181 (80%), Gaps = 0/181 (0%) Strand=Plus/Plus Query 559 AGTGCAACCTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGG 618 ||| ||||| |||||||| ||||||||||||||||| | || ||||| |||||||| | Sbjct 23 AGTACAACCAGATCCACCTGTTGGCCTCAACTGGACTCTGCTGAACATCAGTTTGACGGA 82 Query 619 GATTCGTGGAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGG 678 ||||| || ||||||| ||||| || |||||||||||||| |||||||| || ||| Sbjct 83 GATTCATGCCGACATCCTAGTGAAATGCGAACCACCACCCAATACAGATGTTAAGATGGG 142 Query 679 ATGGATAATTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGT 738 ||||||||| |||||||||||| | | || |||||| ||||||| | | |||||| | Sbjct 143 ATGGATAATCCTGGAGTATGAACTNCNCTATAAAGAACTAAATGAGACCCAGTGGAAAAT 202 Query 739 G 739 | Sbjct 203 G 203 >gb|EF030073.1| Ovis aries breed Gaddi growth hormone receptor variant B (GHR) gene, exon 6 and partial cds Length=220 Score = 172 bits (190), Expect = 2e-39 Identities = 136/164 (82%), Gaps = 0/164 (0%) Strand=Plus/Plus Query 559 AGTGCAACCTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGG 618 ||| ||||| ||||||||| ||||||||||||||||| | || ||||| |||||||| | Sbjct 23 AGTACAACCAGATCCACCCTTTGGCCTCAACTGGACTCTGCTGAACATAAGTTTGACGGA 82 Query 619 GATTCGTGGAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGG 678 ||||| || ||||||| ||||| || |||||||||||||| |||||||| || ||| Sbjct 83 GATTCATGCCGACATCCTAGTGAAATGCGAACCACCACCCAATACAGATGTTAAGATGGG 142 Query 679 ATGGATAATTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATG 722 ||||||||| |||||||||||| | | || |||||| |||||| Sbjct 143 ATGGATAATCCTGGAGTATGAACTGCNCTATAAAGAACTAAATG 186 >gb|EF030072.1| Ovis aries breed Gaddi growth hormone receptor variant A (GHR) gene, exon 6 and partial cds Length=220 Score = 172 bits (190), Expect = 2e-39 Identities = 136/164 (82%), Gaps = 0/164 (0%) Strand=Plus/Plus Query 559 AGTGCAACCTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGG 618 ||| ||||| ||||||||| ||||||||||||||||| | || ||||| |||||||| | Sbjct 23 AGTACAACCAGATCCACCCTTTGGCCTCAACTGGACTCTGCTGAACATAAGTTTGACGGA 82 Query 619 GATTCGTGGAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGG 678 ||||| || ||||||| ||||| || |||||||||||||| |||||||| || ||| Sbjct 83 GATTCATGCCGACATCCTAGTGAAATGCGAACCACCACCCAATACAGATGTTAAGATGGG 142 Query 679 ATGGATAATTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATG 722 ||||||||| |||||||||||| | | || |||||| |||||| Sbjct 143 ATGGATAATCCTGGAGTATGAACTGCNCTATAAAGAACTAAATG 186 >gb|EF030069.1| Ovis aries breed Karnah growth hormone receptor variant A (GHR) gene, exon 6 and partial cds Length=220 Score = 172 bits (190), Expect = 2e-39 Identities = 137/165 (83%), Gaps = 0/165 (0%) Strand=Plus/Plus Query 559 AGTGCAACCTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGG 618 ||| ||||| ||||||||| ||||||||||||||||| | || ||||| |||||||| | Sbjct 23 AGTACAACCAGATCCACCCGTTGGCCTCAACTGGACTCTGCTGAACATCAGTTTGACGGA 82 Query 619 GATTCGTGGAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGG 678 ||||| || ||||||| ||||| || |||||||||||||| |||||||| || ||| Sbjct 83 GATTCATGCCGACATCCTAGTGAAATGCGAACCACCACCCAATACAGATGTTAAGATGGG 142 Query 679 ATGGATAATTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGA 723 ||||||||| |||||||||||| | | || |||||| ||||||| Sbjct 143 ATGGATAATCCTGGAGTATGAACTGCCCTATAAAGAACTAAATGA 187 >gb|EF030075.1| Ovis aries breed Gaddi growth hormone receptor variant D (GHR) gene, exon 6 and partial cds Length=220 Score = 170 bits (188), Expect = 8e-39 Identities = 146/181 (80%), Gaps = 0/181 (0%) Strand=Plus/Plus Query 559 AGTGCAACCTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGG 618 ||| ||||| ||||||||| ||||||||||||||||| | || ||||| |||||||| | Sbjct 23 AGTACAACCAGATCCACCCTTTGGCCTCAACTGGACTCTGCTGAACATCAGTTTGACGGA 82 Query 619 GATTCGTGGAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGG 678 ||||| || ||||||| ||||| || |||||||||||||| |||||||| || ||| Sbjct 83 GATTCATGCCGACATCCTAGTGAAATGCGAACCACCACCCAATACAGATGTTAAGATGGG 142 Query 679 ATGGATAATTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGT 738 ||||||||| |||||||||||| | | || |||||| |||||| | | |||||| | Sbjct 143 ATGGATAATCCTGGAGTATGAACTGCCCTATAAAGAACTAAATGNGACCCAGTGGAAAAT 202 Query 739 G 739 | Sbjct 203 G 203 >gb|EF030086.1| Capra hircus breed Marwari growth hormone receptor variant F (GHR) gene, exon 6 and partial cds Length=220 Score = 169 bits (186), Expect = 3e-38 Identities = 136/165 (82%), Gaps = 0/165 (0%) Strand=Plus/Plus Query 559 AGTGCAACCTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGG 618 ||| ||||| |||||||| ||||||||||||||||| |||| ||||| |||||||| | Sbjct 23 AGTACAACCAGATCCACCTGTTGGCCTCAACTGGACTCTACTGAACATCAGTTTGACGGA 82 Query 619 GATTCGTGGAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGG 678 ||||| || ||||| | ||||| ||| |||||||||||||| |||||||| || ||| Sbjct 83 GATTCATGCCGACATTCTAGTGAAATGGGAACCACCACCCAATACAGATGTTAAGATGGG 142 Query 679 ATGGATAATTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGA 723 ||||||||| |||||| |||| | || || |||||| ||||||| Sbjct 143 ATGGATAATCNTGGAGTGTGAACTGCACTATAAAGAACTAAATGA 187 >gb|EF030080.1| Capra hircus breed Gaddi growth hormone receptor variant E (GHR) gene, exon 6 and partial cds Length=220 Score = 169 bits (186), Expect = 3e-38 Identities = 145/181 (80%), Gaps = 0/181 (0%) Strand=Plus/Plus Query 559 AGTGCAACCTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGG 618 ||| ||||| ||||||||| ||||||||||||||||| | || ||||| ||||||| | Sbjct 23 AGTACAACCAGATCCACCCGTTGGCCTCAACTGGACTCTGCTGAACATCNGTTTGACGGA 82 Query 619 GATTCGTGGAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGG 678 ||||| || ||||||| ||||| || | ||||||||||| |||||||| || ||| Sbjct 83 GATTCATGCCGACATCCTAGTGAAATGNGAGACACCACCCAATACAGATGTTAAGATGGG 142 Query 679 ATGGATAATTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGT 738 ||||||||| |||||||||||| | || || |||||| ||||||| | | |||||| | Sbjct 143 ATGGATAATCCTGGAGTATGAACTGCACTATAAAGAACTAAATGAGACCCAGTGGAAAAT 202 Query 739 G 739 | Sbjct 203 G 203 >gb|EF030076.1| Capra hircus breed Gaddi growth hormone receptor variant A (GHR) gene, exon 6 and partial cds Length=220 Score = 169 bits (186), Expect = 3e-38 Identities = 146/181 (80%), Gaps = 0/181 (0%) Strand=Plus/Plus Query 559 AGTGCAACCTGATCCACCCATTGGCCTCAACTGGACTTTACTAAACATTAGTTTGACCGG 618 ||| ||||| ||||||||| ||||||||||||||||| |||| ||||| ||||||| | Sbjct 23 AGTACAACCAGATCCACCCGTTGGCCTCAACTGGACTCTACTGAACATCGGTTTGACGGA 82 Query 619 GATTCGTGGAGACATCCAAGTGAGTTGGCAACCACCACCCAATGCAGATGTTCTGAAGGG 678 ||||| || ||||||| |||| || | |||||||||||| |||||||| || ||| Sbjct 83 GATTCATGCCGACATCCTGGTGAAATGCGAGCCACCACCCAATACAGATGTTAAGATGGG 142 Query 679 ATGGATAATTCTGGAGTATGAAATTCAGTACAAAGAAGTAAATGAATCAAAATGGAAAGT 738 ||||||||| |||||||||||| | || || |||||| ||||||| | | |||||| | Sbjct 143 ATGGATAATCCTGGAGTATGAACTGCACTATAAAGAACTAAATGAGACCCAGTGGAAAAT 202 Query 739 G 739 | Sbjct 203 G 203
  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS,environmental 
samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Jun 3, 2007  5:46 PM
  Number of letters in database: -695,076,606
  Number of sequences in database:  5,322,174
Lambda     K      H
   0.634    0.408    0.912 
Gapped
Lambda     K      H
   0.634    0.408    0.912 
Matrix: blastn matrix:2 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 5322174
Number of Hits to DB: 11716109
Number of extensions: 648636
Number of successful extensions: 17872
Number of sequences better than 10: 434
Number of HSP's better than 10 without gapping: 0
Number of HSP's gapped: 17842
Number of HSP's successfully gapped: 531
Length of query: 1080
Length of database: 20779759870
Length adjustment: 36
Effective length of query: 1044
Effective length of database: 20588161606
Effective search space: 21494040716664
Effective search space used: 21494040716664
A: 0
X1: 22 (20.1 bits)
X2: 33 (29.8 bits)
X3: 55 (49.6 bits)
S1: 29 (27.4 bits)
S2: 45 (41.9 bits)