NCBI logo

Blast 2 Sequences results

PubMed Entrez BLAST OMIM Taxonomy Structure

BLAST 2 SEQUENCES RESULTS VERSION BLASTN 2.2.16 [Mar-25-2007]

Match: Mismatch: gap open: gap extension:
x_dropoff: expect: wordsize: Filter View option    
Masking character option     Masking color option    
Show CDS translation

Sequence 1: lcl|Musmusculus
Length = 935 (1 .. 935)

Sequence 2: lcl|H.sapiensGh isoforma1
Length = 822 (1 .. 822)








2 1

NOTE:Bitscore and expect value are calculated based on the size of the nr database.

NOTE:If protein translation is reversed, please repeat the search with reverse strand of the query sequence.





 Score =  337 bits (175),  Expect = 6e-89
 Identities = 524/691 (75%), Gaps = 9/691 (1%)
 Strand=Plus/Plus

Query  29   CTCAGAGTCCTGTGGACAGATCACTGCTTGGCAATGGCTACAGACTCTCGGACCTCCTGG  88
            ||||| ||||||||||||| ||||      ||||||||||||| ||| ||||| |||  |
Sbjct  30   CTCAGGGTCCTGTGGACAGCTCACCTAGCTGCAATGGCTACAGGCTCCCGGACGTCCCTG  89

Query  89   CTCCTGACCGTCAGCCTGCTCTGCCTGCTCTGGCCTCAGGAGGCTAGTGCTTTTCCCGCC  148
            |||||| |  |  ||||||||||||||| ||||| ||| ||||  ||||| || ||  ||
Sbjct  90   CTCCTGGCTTTTGGCCTGCTCTGCCTGCCCTGGCTTCAAGAGGGCAGTGCCTTCCCAACC  149

Query  149  ATGCCCTTGTCCAGTCTGTTTTCTAATGCTGTGCTCCGAGCCCAGCACCTGCACCAGCTG  208
            || ||||| ||||| || |||   || ||| ||||||| ||||| |  ||||||||||||
Sbjct  150  ATTCCCTTATCCAGGCTTTTTGACAACGCTATGCTCCGCGCCCATCGTCTGCACCAGCTG  209

Query  209  GCTGCTGACACCTACAAAGAGTTCGAGCGTGCCTACATTCCCGAGGGACAGCGCTATTC-  267
            ||   |||||||||| | ||||| ||    ||||| || ||  ||| ||||   ||||| 
Sbjct  210  GCCTTTGACACCTACCAGGAGTTTGAAGAAGCCTATATCCCAAAGGAACAGAAGTATTCA  269

Query  268  --CATTCAGAATGCCCAGGCTGCTTTCTGCTTCTCAGAGACCATCCCGGCCCCCACAGGC  325
              | | |||||  ||||| |  |  |||| ||||||||| | || ||| | ||| |   |
Sbjct  270  TTCCTGCAGAACCCCCAGACCTCCCTCTGTTTCTCAGAGTCTATTCCGACACCCTCCAAC  329

Query  326  AAGGAGGAGGCCCAGCAGAGAACCGACATGGAATTGCTTCGCTTCTCGCTGCTGCTCATC  385
            | ||||||  | || |||| | || || | ||  |||| ||| |||| ||||||||||||
Sbjct  330  AGGGAGGAAACACAACAGAAATCCAACCTAGAGCTGCTCCGCATCTCCCTGCTGCTCATC  389

Query  386  CAGTCATGGCTGGGGCCCGTGCAGTTCCTCAGCAGGATTTTCACCAACAGCCTGATGTTC  445
            ||||| ||||||| |||||||||||||||||| ||  | ||| ||||||||||| ||| |
Sbjct  390  CAGTCGTGGCTGGAGCCCGTGCAGTTCCTCAGGAGTGTCTTCGCCAACAGCCTGGTGTAC  449

Query  446  GGCACCTCGGACCGT---GTCTATGAGAAACTGAAGGACCTGGAAGAGGGCATCCAGGCT  502
            ||| |||| ||| |    ||||||||    || |||||||| || || ||||||||  | 
Sbjct  450  GGCGCCTCTGACAGCAACGTCTATGACCTCCTAAAGGACCTAGAGGAAGGCATCCAAACG  509

Query  503  CTGATGCAGGAGCTGGAAGATGGCAGCCCCCGTGTTGGGCAGATCCTCAAGCAAACCTAT  562
            ||||||  |  |||||||||||||||||||||   |||||||||| ||||||| ||||| 
Sbjct  510  CTGATGGGGAGGCTGGAAGATGGCAGCCCCCGGACTGGGCAGATCTTCAAGCAGACCTAC  569

Query  563  GACAAGTTTGACGCCAACATGCGCAGCGACGACGCGCTGCTCAAAAACTATGGGCTGCTC  622
              |||||| ||| | |||   | || ||| ||||| || ||||| ||||| |||||||||
Sbjct  570  AGCAAGTTCGACACAAACTCACACAACGATGACGCACTACTCAAGAACTACGGGCTGCTC  629

Query  623  TCCTGCTTCAAGAAGGACCTGCACAAAGCGGAGACCTACCTGCGGGTCATGAAGTGTCGC  682
            | |||||||| ||||||| || |||| |  ||||| | ||||||  || || |||   ||
Sbjct  630  TACTGCTTCAGGAAGGACATGGACAAGGTCGAGACATTCCTGCGCATCGTGCAGT---GC  686

Query  683  CGCTTTGTGGAAAGCAGCTGTGCCTTCTAGC  713
            |||| ||||||  ||||||||| ||||||||
Sbjct  687  CGCTCTGTGGAGGGCAGCTGTGGCTTCTAGC  717






 Score = 46.8 bits (24),  Expect = 0.15
 Identities = 26/27 (96%), Gaps = 0/27 (0%)
 Strand=Plus/Plus

Query  782  TTGTCCTAATAAAATTAAGATGCATCA  808
            ||||||||||||||||||| |||||||
Sbjct  796  TTGTCCTAATAAAATTAAGTTGCATCA  822


CPU time:     0.04 user secs.	    0.01 sys. secs	    0.05 total secs.