spacer

ClustalW Results


Results of search
Number of sequences 18
Alignment score 714313
Sequence format Pearson
Sequence type nt
ClustalW version 1.83
JalView
Output file clustalw-20070604-10000308.output
Alignment file clustalw-20070604-10000308.aln
Guide tree file clustalw-20070604-10000308.dnd
Your input file clustalw-20070604-10000308.input

To save a result file right-click the file link in the above table and choose "Save Target As".
If you cannot see the JalView button, reload the page and check your browser settings to enable Java Applets.




Alignment

CLUSTAL W (1.83) multiple sequence alignment


Mus                ------------------------------------------------------------
Rattus             ------------------------------------------------------------
Cavia              ------------------------------------------------------------
Bostaurus          -----------------------------------------------------------T 1
Bosgrunniens       ------------------------------------------------------------
Bosindicus         ------------------------------------------------------------
Bubalus            ------------------------------------------------------------
Ovis               ------------------------------------------------------------
Lama               ------------------------------------------------------------
Camelus            ------------------------------------------------------------
Pig                TTTTTTTTTTTGGTGGGGAAGAGGACTTTTATTGGGATGTTAGTGGGGGACTCCAGGGAA 60
Equus              ------------------------------------------------------------
Ailuropoda         ------------------------------------------------------------
Mink               ------------------------------------------------------------
Felis              ------------------------------------------------------------
C.familiaris       ------------------------------------------------------------
HomeChorionic      -------AAGCAGGGAGAGAGAACTGGCCAGGGTATAAAAAGGGCCCACAAGAGACCGGC 53
HomeGh             ------------------------------------------------------------
                                                                               

Mus                ---AGCATCCTAGAGTCCAGATTCC-AAACTGCTCAGAGTCCTGTGGACAGATCACTGCT 56
Rattus             ---AGCACCCTCGAGCCCAGATTCC-AAACTGCTCAG-GTCCTGTGGACAGATCACTGAG 55
Cavia              -----------------CAGTTCCCGAAACCAGTCAGGGTCCTGTGGACAGCTCACTCAG 43
Bostaurus          TCCAGGATCCCAGGACCCAGTTCACCAGACGACTCAGGGTCCTGTGGACAGCTCACC-AG 60
Bosgrunniens       -------------GACCCAGTTCACCAGACGACTCAGGGTCCTGTGGACAGCTCACC-AG 46
Bosindicus         -------------------GTTCACCAGACGACTCAGGGTCCTGTGGACAGCTCACC-AG 40
Bubalus            ------------------------------------------------------------
Ovis               ------------------------------------------------------------
Lama               ----TGATCCCAGGGCCTAGCTCCCCAAACCGCTCAGGGTCCTGTGGACAGCTCGCC-AG 55
Camelus            ------------------------------------------------------------
Pig                CAACAAACACTAGGACCCAGCTCCCCAGACCACTCAGGGACCTGTGGACAGCTCACC-GG 119
Equus              ------------------------------------------------------------
Ailuropoda         --------------------------------------------------------CTGG 4
Mink               --------------------------------CTCAGGGTCCTGTGGACAGCTCACCTGG 28
Felis              -------------CCAAGGCCCAACTCCCGAACACTCAGGGTCTGTGCGAGCTCACCTAG 47
C.familiaris       ------------------------------------------------------------
HomeChorionic      TCTAGGATCCCAAGGCCCAACTCCCCGAACCACTCAGGGTCCTGTGGACAGCTCACCTAG 113
HomeGh             ----------------------CCCCGAACCACTCAGGGTCCTGTGGACAGCTCACCTAG 38
                                                                               

Mus                TGGCAATGGCTACAGACTCTCGGACCTCCTGGCTCCTGACCGTCAGCCTGCTCTGCCTGC 116
Rattus             TGGCGATGGCTGCAGACTCTCAGACTCCCTGGCTCCTGACCTTCAGCCTGCTCTGCCTGC 115
Cavia              CTGCAATGGCTGCAGGCTCTCAGGCCACCTGGCTCCTCATCTTCGCCCTGCTCTGCCTGC 103
Bostaurus          CTATGATGGCTGCAGGCCCCCGGACCTCCCTGCTCCTGGCTTTCGCCCTGCTCTGCCTGC 120
Bosgrunniens       CTATGATGGCTGCAGGCCCCCGGACCTCCCTGCTCCTGGCTTTCGCCCTGCTCTGCCTGC 106
Bosindicus         CTATGATGGCTGCAGGCCCCCGGACCTCCCTGCTCCTGGCTTTCGCCCTGCTCTGCCTGC 100
Bubalus            --ATGATGGCTGCAGGCCCCCGGACCTCCCTGCTCCTGGCTTTCGCCCTGCTCTGCCTGC 58
Ovis               --ATGATGGCTGCAGGCCCCCGGACCTCCCTGCTCCTGGCTTTCACCCTGCTCTGCCTGC 58
Lama               CTGTGATGGCTGCAGGCCCTCGGACCTCCATGCTCCTGGCTTTCACCCTGCTCTGCCTGC 115
Camelus            ------------------------------------------------------------
Pig                CTGTGATGGCTGCAGGCCCTCGGACCTCCGTGCTCCTGGCTTTCGCCCTGCTCTGCCTGC 179
Equus              -----ATGGCTGCAGGTCCTAGGACCTCCGTGCTCCTGGCTTTCGGCCTGCTCTGCCTGC 55
Ailuropoda         CTGCAATGGCTGCAGACCCTCAGAGCTCTGTGCTCCTGGCCTTCGCCCTGCTCTGCCTGC 64
Mink               CTGCAATGGCTGCTGGTCCTCGGAACTCCATGCTCCTGGTGTTCGCCCTGCTCAGCCTGC 88
Felis              C-GCAATGGCTGCAGGCCCCCGGACCTCTGTGCTCCTGGCGTTTGCCCTGCTCTGCCTGC 106
C.familiaris       -----ATGGCTGCAGGCCCCCGGACCTCTGTGCTCCTGGCCTTCGCCTTGCTCTGCCTGC 55
HomeChorionic      TGGCAATGGCTCCAGGCTCCCGGACGTCCCTGCTCCTGGCTTTTGCCCTGCTCTGCCTGC 173
HomeGh             CTGCAATGGCTACAGGCTCCCGGACGTCCCTGCTCCTGGCTTTTGGCCTGCTCTGCCTGC 98
                                                                               

Mus                TCTGGCCTCAGGAGGCTAGTGCTTTTCCCGCCATGCCCTTGTCCAGTCTGTTTTCTAATG 176
Rattus             TGTGGCCTCAAGAGGCTGGTGCTTTACCTGCCATGCCCTTGTCCAGTCTGTTTGCCAATG 175
Cavia              CCTGGCCTAAGGAGGTCCGTGGTTTCCCGGCCATGCCTTTGTCCAGCCTTTTTGGCAACG 163
Bostaurus          CCTGGACTCAGGTGGTGGGCGCCTTCCCAGCCATGTCCTTGTCCGGCCTGTTTGCCAACG 180
Bosgrunniens       CCTGGACTCAGGTGGTGGGCGCCTTCCCAGCCATGTCCTTGTCCGGCCTGTTTGCCAACG 166
Bosindicus         CCTGGACTCAGGTGGTGGGCGCCTTCCCAGCCATGTCCTTGTCCGGCCTGTTTGCCAACG 160
Bubalus            CCTGGACTCAGGTGGTGGGCGCCTTCCCAGCCATGTCCTTGTCCAGCCTGTTTGCCAACG 118
Ovis               CCTGGACTCAGGTGGTGGGCGCCTTCCCAGCCATGTCCTTGTCCGGCCTGTTTGCCAACG 118
Lama               CCTGGCCTCAGGAGGCGGGTGCCTTCCCAGCCATGCCTCTGTCCAGCCTGTTTGCCAACG 175
Camelus            -----------------------TTCCCAGCCATGCCTCTGTCCAGCCTGTTTGCCAACG 37
Pig                CCTGGACTCAGGAGGTGGGCGCCTTCCCAGCCATGCCCTTGTCCAGCCTATTTGCCAACG 239
Equus              CCTGGCCTCAGGATGTGGGCGCCTTCCCCGCCATGCCGTTGTCTAGCCTGTTTGCCAACG 115
Ailuropoda         CCTGGCCTCAGGAGGTGGGCGCCTTCCCGGCCATGCCCTTGTCCAGCCTGTTTGCTAACG 124
Mink               CCTGGCCTCAGGAGGTGGGCGCCTTCCCGGCCATGCCCTTGTCCAGCCTGTTTGCCAACG 148
Felis              CCTGGCCCCAGGAGGTGGGCGCCTTCCCAGCCATGCCCTTGTCCAGTCTGTTTGCCAACG 166
C.familiaris       CCTGGCCTCAGGAGGTGGGCGCCTTCCCGGCCATGCCCTTGTCCAGCCTGTTTGCCAACG 115
HomeChorionic      CCTGGCTTCAAGAGGCTGGTGCCGTCCAAACCGTTCCGTTATCCAGGCTTTTTGACCACG 233
HomeGh             CCTGGCTTCAAGAGGGCAGTGCCTTCCCAACCATTCCCTTATCCAGGCTTTTTGACAACG 158
                                           * *   ** *  *  * **  * ** ***    * *

Mus                CTGTGCTCCGAGCCCAGCACCTGCACCAGCTGGCTGCTGACACCTACAAAGAGTTCGAGC 236
Rattus             CTGTGCTCCGAGCCCAGCACCTGCACCAGCTGGCTGCTGACACCTACAAAGAGTTCGAGC 235
Cavia              CAGTGCTCCGAGCCCAGCACCTGCATCAGTTGGCTGCTGACACCTACAAAGAATTTGAGC 223
Bostaurus          CTGTGCTCCGGGCTCAGCACCTGCATCAGCTGGCTGCTGACACCTTCAAAGAGTTTGAGC 240
Bosgrunniens       CTGTGCTCCGGGCTCAGCACCTGCATCAGCTGGCTGCTGACACCTTCAAAGAGTTTGAGC 226
Bosindicus         CTGTGCTCCGGGCTCAGCACCTGCACCAGCTGGCTGCTGACACCTTCAAAGAGTTTGAGC 220
Bubalus            CTGTGCTCCGGGCTCAGCACCTGCATCAGCTGGCTGCTGACACCTTCAAAGAGTTTGAAC 178
Ovis               CTGTGCTCCGGGCTCAGCACCTGCATCAACTGGCTGCTGACACCTTCAAAGAGTTTGAGC 178
Lama               CTGTGCTCCGCGCCCAGCACCTGCACCAGCTGGCTGCTGACACCTACAAAGAGTTTGAGC 235
Camelus            CTGTGCTCCGCGCCCAGCACCTGCACCAGCTGGCTGCTGACACCTACAAAGAGTTTGAGC 97
Pig                CCGTGCTCCGGGCCCAGCACCTGCACCAACTGGCTGCCGACACCTACAAGGAGTTTGAGC 299
Equus              CTGTGCTCCGGGCCCAGCACCTGCACCAACTGGCTGCTGACACCTACAAAGAGTTTGAGC 175
Ailuropoda         CTGTGCTCCGGGCCCAGCACCTGCACCAGCTGGCTGCCGACACCTACAAAGAGTTTGAGC 184
Mink               CCGTGCTCCGGGCCCAGCACCTGCACCAGCTGGCTGCCGACACCTACAAAGACTTTGAGC 208
Felis              CCGTGCTCCGGGCCCAGCACCTGCACCAGTTGGCCGCCGACACCTACAAAGAGTTTGAGC 226
C.familiaris       CCGTGCTCCGGGCCCAGCACCTGCACCAACTGGCTGCCGACACCTACAAAGAGTTTGAGC 175
HomeChorionic      CTATGCTCCAAGCCCATCGCGCGCACCAGCTGGCCATTGACACCTACCAGGAGTTTGAAG 293
HomeGh             CTATGCTCCGCGCCCATCGTCTGCACCAGCTGGCCTTTGACACCTACCAGGAGTTTGAAG 218
                   *  ******  ** ** *    *** **  ****    ******* * * ** ** **  

Mus                GTGCCTACATTCCCGAGGGACAGCGCTATTC---CATTCAGAATGCCCAGGCTGCTTTCT 293
Rattus             GTGCCTACATTCCCGAGGGACAGCGCTATTC---CATTCAGAATGCCCAGGCTGCGTTCT 292
Cavia              GCACCTACATCCCCGAGGGACAGCGTTACTC---CATCCACAACACCCAGACTGCCTTCT 280
Bostaurus          GCACCTACATCCCGGAGGGACAGAGATACTC---CATCCAGAACACCCAGGTTGCCTTCT 297
Bosgrunniens       GCACCTACATCCCGGAGGGACAGAGATACTC---CATCCAGAACACCCAGGTTGCCTTCT 283
Bosindicus         GCACCTACATCCCGGAGGGACAGAGATACTC---CATCCAGAACACCCAGGTTGCCTTCT 277
Bubalus            GCACCTACATCCCGGAGGGACAGAGATACTC---CATCCAGAACACCCAGGTTGCCTTCT 235
Ovis               GCACCTACATCCCGGAGGGACAGAGATACTC---CATCCAGAACACCCAGGTTGCCTTCT 235
Lama               GCACCTACATCCCGGAGGGACAGAGATACTC---CATTCAGAACGCCCAGGCTGCCTTCT 292
Camelus            GCACCTACATCCCGGAGGGACAGAGATACTC---CATTCAGAACGCCCAGGCTGCCTTCT 154
Pig                GCGCCTACATCCCGGAGGGACAGAGGTACTC---CATCCAGAACGCCCAGGCTGCCTTCT 356
Equus              GCGCCTACATCCCCGAGGGACAGAGATACTC---GATCCAGAACGCCCAGGCTGCCTTCT 232
Ailuropoda         GTGCGTACATCCCAGAGGGTCAGAGGTATTC---CATCCAGAATGCGCAGGCCGCCTTCT 241
Mink               GGGCGTACATCCCCGAGGGCCAGAGGTACTC---CATCCAGAACGCGCAGGCTGCCTTCT 265
Felis              GGGCGTACATCCCGGAGGGACAGAGGTATTC---CATCCAGAACGCGCAGGCTGCCTTCT 283
C.familiaris       GGGCGTACATCCCCGAGGGACAGAGGTACTC---CATCCAGAACGCGCAGGCCGCCTTCT 232
HomeChorionic      AAACCTATATCCCAAAGGACCAGAAGTATTCATTCCTGCATGACTCCCAGACCTCCTTCT 353
HomeGh             AAGCCTATATCCCAAAGGAACAGAAGTATTCATTCCTGCAGAACCCCCAGACCTCCCTCT 278
                      * ** ** **  ***  ***   ** **     * **  *  * ***    *  ***

Mus                GCTTCTCAGAGACCATCCCGGCCCCCACAGGCAAGGAGGAGGCCCAGCAGAGAACCGACA 353
Rattus             GCTTCTCAGAGACCATCCCAGCCCCCACCGGCAAGGAGGAGGCCCAGCAGAGAACTGACA 352
Cavia              GCTTCTCGGAGACCATCCCTGCTCCAACGGACAAGGAAGAAGCCCAGCAGAGATCCGACG 340
Bostaurus          GCTTCTCTGAAACCATCCCGGCCCCCACGGGCAAGAATGAGGCCCAGCAGAAATCAGACT 357
Bosgrunniens       GCTTCTCTGAAACCATCCCGGCCCCCACGGGCAAGAATGAGGCCCAGCAGAAATCAGACT 343
Bosindicus         GCTTCTCTGAAACCATCCCGGCCCCCACGGGCAAGAATGAGGCCCAGCAGAAATCAGACT 337
Bubalus            GCTTCTCCGAAACCATCCCGGCCCCCACAGGCAAGAACGAGGCCCAGCAGAAATCGGACT 295
Ovis               GCTTCTCCGAAACCATCCCAGCCCCCACGGGCAAGAATGAGGCCCAGCAGAAATCAGACT 295
Lama               GTTTCTCGGAGACCATCCCGGCCCCCACAGGCAAGGACGAGGCCCAGCAGAGATCGGACG 352
Camelus            GTTTCTCGGAGACCATCCCGGCCCCCACAGGCAAGGACGAGGCCCAGCAGAGATCGGACG 214
Pig                GCTTCTCGGAGACCATCCCGGCCCCCACGGGCAAGGACGAGGCCCAGCAGAGATCGGACG 416
Equus              GCTTCTCCGAGACCATCCCGGCCCCCACGGGCAAGGATGAGGCCCAGCAGAGATCTGACA 292
Ailuropoda         GCTTCTCAGAGACCATCCCGGCCCCCACAGGCAAGGACGAGGCCCAGCAGAGATCCGACG 301
Mink               GCTTCTCGGAGACCATCCCGGCGCCCACCGGCAAGGACGAGGCCCAGCAGAGATCCGACA 325
Felis              GCTTCTCGGAGACCATCCCGGCCCCCACGGGCAAGGACGAGGCCCAGCAGAGATCCGACG 343
C.familiaris       GCTTCTCGGAGACCATCCCGGCCCCCACGGGCAAGGACGAGGCCCAGCAGCGATCCGACG 292
HomeChorionic      GCTTCTCAGACTCTATTCCGACACCCTCCAACATGGAGGAAACGCAACAGAAATCCAATC 413
HomeGh             GTTTCTCAGAGTCTATTCCGACACCCTCCAACAGGGAGGAAACACAACAGAAATCCAACC 338
                   * ***** **  * ** **  * **  *   ** * * **  * ** ***  * *  *  

Mus                TGGAATTGCTTCGCTTCTCGCTGCTGCTCATCCAGTCATGGCTGGGGCCCGTGCAGTTCC 413
Rattus             TGGAATTGCTTCGCTTCTCGCTGCTGCTCATCCAGTCATGGCTGGGGCCCGTGCAGTTTC 412
Cavia              TGGAGCTCCTGCACTTCTCACTGCTGCTCATCCAGTCATGGCTGGGGCCTGTGCAGTTCC 400
Bostaurus          TGGAGCTGCTTCGCATCTCACTGCTCCTCATCCAGTCGTGGCTTGGGCCCCTGCAGTTCC 417
Bosgrunniens       TGGAGCTGCTTCGCATCTCACTGCTCCTCATCCAGTCGTGGCTTGGGCCCCTGCAGTTCC 403
Bosindicus         TGGAGCTGCTTCGCATCTCACTGCTCCTCATCCAGTCGTGGCTTGGGCCCCTGCAGTTTC 397
Bubalus            TGGAGCTGCTTCGCATCTCACTGCTCCTCATCCAGTCGTGGCTTGGGCCCCTGCAGTTCC 355
Ovis               TGGAGCTGCTTCGCATCTCACTGCTCCTTATCCAGTCGTGGCTTGGGCCCCTGCAGTTCC 355
Lama               TGGAGCTGCTCCGCTTCTCGCTGCTGCTCATCCAGTCTTGGCTCGGGCCTGTGCAGTTCC 412
Camelus            TGGAGCTGCTCCGCTTCTCGCTGCTGCTCATCCAGTCTTGGCTTGGGCCTGTGCAGTTCC 274
Pig                TGGAGCTGCTGCGCTTCTCGCTGCTGCTCATCCAGTCGTGGCTCGGGCCCGTGCAGTTCC 476
Equus              TGGAGCTGCTCCGCTTCTCGCTGCTGCTCATCCAGTCGTGGCTCGGGCCCGTGCAGTTGC 352
Ailuropoda         TGGAGCTGCTCCGCTTCTCCCTGCTGCTCATCCAGTCGTGGCTCGGGCCCGTGCAGTTCC 361
Mink               TGGAGCTGCTCCGCTTCTCGCTGCTGCTCATCCAGTCGTGGCTGGGGCCCGTGCAGTTCC 385
Felis              TAGAGCTGCTCCGCTTCTCTCTGCTGCTCATCCAGTCGTGGCTCGGGCCCGTGCAATTCC 403
C.familiaris       TGGAGCTGCTCCGCTTCTCCCTGCTGCTCATCCAGTCGTGGCTCGGGCCCGTGCAGTTTC 352
HomeChorionic      TAGAGCTGCTCCGCATCTCCCTGCTGCTCATCGAGTCGTGGCTGGAGCCCGTGCGGTTCC 473
HomeGh             TAGAGCTGCTCCGCATCTCCCTGCTGCTCATCCAGTCGTGGCTGGAGCCCGTGCAGTTCC 398
                   * **  * ** * * **** ***** ** *** **** ***** * ***  ***  ** *

Mus                TCAGCAGGATTTTCACCAACAGCCTGATGTTCGGCACCTCGGACCGT---GTCTATGAGA 470
Rattus             TCAGCAGGATCTTTACCAACAGCCTGATGTTTGGTACCTCGGACCGC---GTCTATGAGA 469
Cavia              TCAGCAGGGTCTTCACCAACAGCCTGGTGTTCGGCACCTCGGACCGT---GTCTATGAAA 457
Bostaurus          TCAGCAGAGTCTTCACCAACAGCTTGGTGTTTGGCACCTCGGACCGT---GTCTATGAGA 474
Bosgrunniens       TCAGCAGAGTCTTCACCAACAGCTTGGTGTTTGGCACCTCGGACCGT---GTCTATGAGA 460
Bosindicus         TCAGCAGAGTCTTCACCAACAGCTTGGTGTTTGGCACCTCGGACCGT---GTCTATGAGA 454
Bubalus            TCAGCAGAGTCTTCACCAACAGCTTGGTGTTTGGCACCTCGGACCGT---GTCTATGAGA 412
Ovis               TCAGCAGAGTCTTCACCAACAGCCTGGTGTTTGGCACCTCGGACCGT---GTCTATGAGA 412
Lama               TCAGCAGGGTCTTCACCAACAGCCTGGTGTTTGGCACCTCGGACCGC---GTCTATGAGA 469
Camelus            TCAGCAGGGTCTTCACCAACAGCCTGGTGTTTGGCACCTCGGACCGC---GTCTATGAGA 331
Pig                TCAGCAGGGTCTTCACCAACAGCCTGGTGTTTGGCACCTCAGACCGC---GTCTACGAGA 533
Equus              TCAGCAGGGTCTTCACCAACAGCCTGGTGTTTGGCACCTCGGACCGC---GTCTATGAGA 409
Ailuropoda         TCAGCAGGGTCTTCACCAACAGCCTGGTGTTTGGCACCTCAGACCGA---GTCTATGAGA 418
Mink               TCAGCAGGGTCTTCACCAACAGCCTGGTGTTCGGCACCTCGGACCGA---GTCTACGAGA 442
Felis              TCAGCAGGGTCTTCACCAACAGCCTGGTGTTCGGCACCTCGGACCGG---GTCTACGAGA 460
C.familiaris       TCAGCAGGGTCTTCACCAACAGCCTGGTGTTCGGCACCTCAGACCGA---GTCTACGAGA 409
HomeChorionic      TCAGGAGTATGTTCGCCAACAACCTGGTGTATGACACCTCGGACAGCGATGACTATCACC 533
HomeGh             TCAGGAGTGTCTTCGCCAACAGCCTGGTGTACGGCGCCTCTGACAGCAACGTCTATGACC 458
                   **** **  * **  ****** * ** ***  *   **** *** *    * ***  *  

Mus                AACTGAAGGACCTGGAAGAGGGCATCCAGGCTCTGATGCAGGAGCTGGAAGATGGCAGCC 530
Rattus             AACTGAAGGACCTGGAAGAGGGCATCCAGGCTCTGATGCAGGAGCTGGAAGACGGCAGCC 529
Cavia              AACTGAAGGACCTGGAGGAGGGCATCCAGGCGCTGATGCGGGAACTAGAAGATGGCACCC 517
Bostaurus          AGCTGAAGGACCTGGAGGAAGGCATCCTGGCCCTGATGCGGGAGCTGGAAGATGGCACCC 534
Bosgrunniens       AGCTGAAGGACCTGGAGGAAGGCATCCTGGCCCTGATGCGGGAGCTGGAAGATGGCACCC 520
Bosindicus         AGCTGAAGGACCTGGAGGAAGGCATCCTGGCCCTGATGCGGGAGCTGGAAGATGGCACCC 514
Bubalus            AGCTGAAGGACCTGGAGGAAGGCATCCTGGCCCTGATGCGGGAGCTGGAAGACGGCACCC 472
Ovis               AGCTGAAGGACCTGGAGGAAGGCATCCTGGCCCTGATGCGGGAGCTGGAAGATGTTACCC 472
Lama               AGCTGAAGGACCTAGAGGAAGGCATCCAGGCCCTGATGCGGGAGCTGGAAGATGGCAGCC 529
Camelus            AGCTGAAGGACCTAGAGGAAGGCATCCAGGCCCTGATGCGGGAGCTGGAAGACGGCAGCC 391
Pig                AGCTGAAGGACCTGGAGGAGGGCATCCAGGCCCTGATGCGGGAGCTGGAGGATGGCAGCC 593
Equus              AGCTGAGGGACCTAGAGGAAGGCATCCAGGCCCTGATGCGGGAGCTGGAAGACGGCAGCC 469
Ailuropoda         AGCTGAAGGACCTGGAGGAAGGCATCCAAGCGCTGATGCGGGAGCTAGAAGACGGCAGCC 478
Mink               AGCTGAAGGACCTGGAGGAAGGCATCCAAGCGCTGATGCGGGAGCTGGAAGACGGCAGCC 502
Felis              AGCTCAAGGACCTGGAGGAAGGCATCCAAGCCCTGATGCGGGAGCTGGAAGATGGCAGCC 520
C.familiaris       AGCTCAAGGACCTGGAGGAAGGCATCCAAGCCCTGATGCGGGAGCTGGAAGATGGCAGTC 469
HomeChorionic      TCCTAAAGGACCTAGAGGAAGGCATCCAAACGCTGATGGGGAGGCTGGAAGACGGCAGCC 593
HomeGh             TCCTAAAGGACCTAGAGGAAGGCATCCAAACGCTGATGGGGAGGCTGGAAGATGGCAGCC 518
                     ** * ****** ** ** *******   * ******  *   ** ** ** *  *  *

Mus                CCCGTGTTGGGCAGATCCTCAAGCAAACCTATGACAAGTTTGACGCCAACATGCGCAGCG 590
Rattus             CCCGTATTGGGCAGATCCTCAAGCAAACCTATGACAAGTTTGACGCCAACATGCGCAGCG 589
Cavia              CCCGTGCCGGGCAGATCCTCAAGCAAACCTATGACAAATTTGACACCAACTTACGCAGCA 577
Bostaurus          CCCGGGCTGGGCAGATCCTCAAGCAGACCTATGACAAATTTGACACAAACATGCGCAGTG 594
Bosgrunniens       CCCGGGCTGGGCAGATCCTCAAGCAGACCTATGACAAATTTGACACAAACATGCGCAGTG 580
Bosindicus         CCCGGGCTGGGCAGATCCTCAAGCAGACCTATGACAAATTTGACACAAACATGCGCAGTG 574
Bubalus            CCCGGGCTGGGCAGATCCTCAAGCAGACCTATGACAAATTTGACACAAACATGCGCAGTG 532
Ovis               CCCGGGCTGGGCAGATCCTCAAGCAGACCTATGACAAATTTGACAGAAACATGCGCAGTG 532
Lama               CCCGGGCTGGGCAGATCCTCAGGCAAACCTACGACAAGTTTGACACAAACTTGCGCAGTG 589
Camelus            CCCGGGCTGGGCAGATCCTCAGGCAAACCTACGACAAATTTGACACAAACTTGCGCAGTG 451
Pig                CCCGGGCAGGACAGATCCTCAAGCAAACCTACGACAAATTTGACACAAACTTGCGCAGTG 653
Equus              CCCGGGCTGGGCAGATCCTCAAGCAAACCTACGACAAGTTTGACACAAACTTGCGCAGTG 529
Ailuropoda         CCCGGGCTGGGCAGATCCTGAAGCCAACGTATGACAAGTTTGACACAAGCCTGCGCAGCG 538
Mink               CCCGGGCCGGGCCGATCCTGAAGCAAACCTACGACAAGTTTGACACAAACCTGCGCAGCG 562
Felis              CCCGGGCCGGGCAGATCCTGAAGCAAACCTACGACAAGTTTGACACAAACTTGCGCAGTG 580
C.familiaris       CCCGGGCCGGGCAGATCCTGAAGCAGACCTACGACAAGTTTGACACGAACCTGCGCAGTG 529
HomeChorionic      GCCGGACTGGGCAGATCCTCAAGCAGACCTACAGCAAGTTTGACACAAACTCGCACAACC 653
HomeGh             CCCGGACTGGGCAGATCTTCAAGCAGACCTACAGCAAGTTCGACACAAACTCACACAACG 578
                    ***    ** * **** * * **  ** **   *** ** ***   * *   * **   

Mus                ACGACGCGCTGCTCAAAAACTATGGGCTGCTCTCCTGCTTCAAGAAGGACCTGCACAAAG 650
Rattus             ATGACGCTCTGCTCAAAAACTATGGGCTGCTCTCCTGCTTCAAGAAGGACCTGCACAAGG 649
Cavia              ACGACGCACTGCTCAAGAACTACGGGCTGCTCTCCTGCTTCAGGAAGGACCTGCACAGGA 637
Bostaurus          ACGACGCGCTGCTCAAGAACTACGGTCTGCTCTCCTGCTTCCGGAAGGACCTGCATAAGA 654
Bosgrunniens       ACGACGCGCTGCTCAAGAACTACGGTCTGCTCTCCTGCTTCCGGAAGGACCTGCATAAGA 640
Bosindicus         ACGACGCGCTGCTCAAGAACTACGGTCTGCTCTCCTGCTTCCGGAAGGACCTGCATAAGA 634
Bubalus            ACGACGCGCTGCTCAAGAACTACGGTCTGCTCTCCTGCTTCCGGAAGGACCTGCACAAAA 592
Ovis               ATGATGCGCTGCTCAAGAACTACGGTCTGCTCTCCTGCTTCCGGAAGGACCTGCACAAGA 592
Lama               ATGACGCGCTGCTCAAAAACTACGGGCTGCTCTCCTGCTTCAAGAAGGACCTGCACAAGG 649
Camelus            ATGACGCGCTTCTCAAGAACTACGGGCTGCTCTCCTGCTTCAAGAAGGACCTGCACAAGG 511
Pig                ATGACGCGCTGCTTAAGAACTACGGGCTGCTCTCCTGCTTCAAGAAGGACCTGCACAAGG 713
Equus              ATGATGCACTGCTCAAGAACTACGGGCTGCTCTCCTGCTTCAAGAAGGACCTGCACAAGG 589
Ailuropoda         ACGACGCACTGCTCAAGAACTACGGGCTGCTCTCCTGCTTCAAGAAGGACCTGCACAAGG 598
Mink               ACGACGCGCTGCTCAAGAACTATGGGCTGCTCTCCTGCTTCAAGAAGGACCTGCACAAGG 622
Felis              ACGACGCGCTGCCCAAGAACTATGGGCTCCTGTCCTGCTTCAAGAAGGACCTGCACAAGG 640
C.familiaris       ACGATGCGCTGCTTAAGAACTACGGGCTGCTCTCCTGCTTCAAGAAAGACCTGCATAAGG 589
HomeChorionic      ATGACGCACTGCTCAAGAACTACGGGCTGCTCTACTGCTTCAGGAAGGACATGGACAAGG 713
HomeGh             ATGACGCACTACTCAAGAACTACGGGCTGCTCTACTGCTTCAGGAAGGACATGGACAAGG 638
                   * ** ** ** *  ** ***** ** ** ** * *******  *** *** ** * *   

Mus                CGGAGACCTACCTGCGGGTCATGAAGTGTCGCCGCTTTGTGGAAAGCAGCTGTGCCTTCT 710
Rattus             CAGAGACCTACCTGCGGGTCATGAAGTGTCGCCGCTTTGCGGAAAGCAGCTGTGCTTTCT 709
Cavia              CTGAGACCTACCTGCGGGTCATGAAGTGTCGCCGCTTTGTGGAGAGCAGCTGTGCCTTCT 697
Bostaurus          CGGAGACGTACCTGAGGGTCATGAAGTGCCGCCGCTTCGGGGAGGCCAGCTGTGCCTTCT 714
Bosgrunniens       CGGAGACGTACCTGCGGGTCATGAAGTGCCGCCGCTTCGGGGAGGCCAGCTGTGCCTTCT 700
Bosindicus         CGGAGACGTACCTGAGGGTCATGAAGTGCCGCCGCTTCGGGGAGGCCAGCTGTGCCTTCT 694
Bubalus            CGGAGACGTACCTGCGGGTCATGAAGTGCCGCCGCTTCGGGGAGGCCAGCTGTGCCTTCT 652
Ovis               CGGAGACGTACCTGAGGGTCATGAAGTGTCGCCGCTTCGGGGAGGCCAGCTGCGCCTTCT 652
Lama               CTGAGACCTACCTGCGGGTCATGAAGTGTCGCCGCTTTGTGGAGAGCAGCTGTGCCTTCT 709
Camelus            CTGAGACCTACCTGCGGGTCATGAAGTGTCGCCGCTTTGTGGAGAGCAGCTGTGCCTTCT 571
Pig                CTGAGACATACCTGCGGGTCATGAAGTGTCGCCGCTTCGTGGAGAGCAGCTGTGCCTTCT 773
Equus              CTGAGACGTACCTGCGGGTCATGAAGTGTCGCCGCTTCGTGGAAAGCAGCTGTGCCTTCT 649
Ailuropoda         CTGAGACCTACCTGCGGGTCATGAAGTGTCGTCGCTTCGTGGAAAGCAGCTGTGCCTTCT 658
Mink               CCGAGACGTATCTGCGGGTCATGAAGTGTCGCCGCTTCGTGGAAAGCAGCTGTGCCTTCT 682
Felis              CTGAGACGTACCTGCGGGTCATGAAGTGTCGCCGCTTCGTGGAGAGCAGCTGCGCCTTCT 700
C.familiaris       CCGAGACGTACCTGCGGGTCATGAAGTGTCGCCGCTTCGTGGAAAGCAGCTGTGCCTTCT 649
HomeChorionic      TCGAGACATTCCTGCGCATGGTGCAGTG---CCGCTCTGTGGAGGGCAGCTGTGGCTTCT 770
HomeGh             TCGAGACATTCCTGCGCATCGTGCAGTG---CCGCTCTGTGGAGGGCAGCTGTGGCTTCT 695
                     ***** *  *** *  *  ** ****    ****  * ***   ****** *  ****

Mus                AGCCACTCACCA----GTGTCTCTGCTGCACTCTCCTGTGCCTCCCTGCCCCCTGGCAAC 766
Rattus             AG---------------------------------------------------------- 711
Cavia              AGTTGCACA-------GTGTTTCTGT--CACCCGCCTGCTTCTCTCCGTACCCTGGAAAG 748
Bostaurus          AGTTGCCAGCCATCTGTTGTT--TGCCCCTCCCCCGTGCCTTCCTTGA--CCCTGGAAGG 770
Bosgrunniens       AGTTGCC----------------------------------------------------- 707
Bosindicus         AGTTGCCAGCCATCTGTTGTT--TGCCCCTCCCCCGTGCCTTCCTTGA--CCCTGGAAGG 750
Bubalus            AG---------------------------------------------------------- 654
Ovis               AGTTGCCAGCCATCTGTTGTTACTACCCCTCCCCTGTGCCTTCCTAGA--CCCTGGAAGG 710
Lama               AGTTGCTGGGCAA-T-CTGTT---ACCCCTCCCCAGCACCTCCCCTGA--CCCTGGAAAG 762
Camelus            AG---------------------------------------------------------- 573
Pig                AGTTGCTGGGCATCT-CTGTT---GCCCCTCCCCAGTACCTCCCCTGGTGCCCTGGAAAG 829
Equus              AGT-GCTGGGCTTCT-CTGTT---ACCCCTCCTCAGTGCCTCCCTTGA--TCCTGGAGAG 702
Ailuropoda         AG---------------------------------------------------------- 660
Mink               AGTTCGCGGGCTTTC-CTTTCA--GCCCGGCCCCACAGCCTCCCCTGA--CCCTGGAAAG 737
Felis              AGTTCCTGGGCATCG-TGGTCA--GCCCCTCCCCAGTGCCTCCCC-AA--CCCTGGGAAG 754
C.familiaris       AGTTGCTGGGCATCT-CTGTCA--CCCCCTCCCCAGAGCCTCCCC-AA--CCCTGGGA-G 702
HomeChorionic      AGGTGCCCGAGTAGCATCC-TGTGACCCCTCCCCAGTGCCTCTCCTGG--CCCTGAAGGT 827
HomeGh             AGCTGCCCGGGTGGCATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGG--CCCTGGAAGT 753
                   **                                                          

Mus                TGCCACCCCTGCGCT--------TTGTCCTAATAAAATTAAGATGCATCATAAAAAAAAA 818
Rattus             ------------------------------------------------------------
Cavia              TGCCACTCCAGTGCCCACTGTCCTTGTCCCAATAAAACTGAGCTGCATCATAAAAAAAAA 808
Bostaurus          TGCCACTCC-------CACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGC------ 817
Bosgrunniens       ------------------------------------------------------------
Bosindicus         TGCCACTCC-------CACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGC------ 797
Bubalus            ------------------------------------------------------------
Ovis               TGCCACTCCAGT-GCCCACTGTCCTTTCCTAATAAAGCGAGGAAATTGCATCACAAAAAA 769
Lama               TGCCACTCCAGT-GCCCACCACCCTTTCCTAATAAAATGAGGTTTT-GCATCAA------ 814
Camelus            ------------------------------------------------------------
Pig                TGCCACCCCAAT-GCCTGCTGTCCTTTCCTAATAAAACCAGGTT---GCATCG------- 878
Equus              TGCCCCTCTAGT-GCCTACCCATCTTTCCTAATAAAATAAAATT---GCATCGTAAAAAA 758
Ailuropoda         ------------------------------------------------------------
Mink               GGCCTCTCCCGGTGTCCTCTGTGCTTTCCTAATAAAATGAAATTGC-------------- 783
Felis              TGCCGCTCCAGG-GTCCACTGTGCTTTCCTAATAAAATTAAGTTGCATCATAAAAAAAAA 813
C.familiaris       TGCCGCTCCAGG-GTCCACTGTGCTTTCCTAATAAAGTTAAGTTGCATCATAAAAAAAAA 761
HomeChorionic      -GCCACTCCAGTGCCCACCAGCCTTGTCCTAATAAAATTAAGTTGTATCATTTAAAAAAA 886
HomeGh             TGCCACTCCAGTGCCCACCAGCCTTGTCCTAATAAAATTAAGTTGCATCA---AAAAAAA 810
                                                                               

Mus                AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 878
Rattus             ------------------------------------------------------------
Cavia              AAAAA------------------------------------------------------- 813
Bostaurus          ------------------------------------------------------------
Bosgrunniens       ------------------------------------------------------------
Bosindicus         ------------------------------------------------------------
Bubalus            ------------------------------------------------------------
Ovis               AAAAAAAAAAAGGGGGGGGGGGGGGGGGGGGG---------------------------- 801
Lama               ------------------------------------------------------------
Camelus            ------------------------------------------------------------
Pig                ------------------------------------------------------------
Equus              AAAAAA------------------------------------------------------ 764
Ailuropoda         ------------------------------------------------------------
Mink               ------------------------------------------------------------
Felis              ------------------------------------------------------------
C.familiaris       AAAAAAAAA--------------------------------------------------- 770
HomeChorionic      AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 946
HomeGh             AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA-------------------------- 844
                                                                               

Mus                AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA--- 935
Rattus             ------------------------------------------------------------
Cavia              ------------------------------------------------------------
Bostaurus          ------------------------------------------------------------
Bosgrunniens       ------------------------------------------------------------
Bosindicus         ------------------------------------------------------------
Bubalus            ------------------------------------------------------------
Ovis               ------------------------------------------------------------
Lama               ------------------------------------------------------------
Camelus            ------------------------------------------------------------
Pig                ------------------------------------------------------------
Equus              ------------------------------------------------------------
Ailuropoda         ------------------------------------------------------------
Mink               ------------------------------------------------------------
Felis              ------------------------------------------------------------
C.familiaris       ------------------------------------------------------------
HomeChorionic      AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAATTTAAAAAAAAAAAAAAAAAAAAAAA 1006
HomeGh             ------------------------------------------------------------
                                                                               

Mus                -----
Rattus             -----
Cavia              -----
Bostaurus          -----
Bosgrunniens       -----
Bosindicus         -----
Bubalus            -----
Ovis               -----
Lama               -----
Camelus            -----
Pig                -----
Equus              -----
Ailuropoda         -----
Mink               -----
Felis              -----
C.familiaris       -----
HomeChorionic      AAAAA 1011
HomeGh             -----
                        
PLEASE NOTE: Showing colors on large alignments is slow.

spacer
spacer