spacer

ClustalW Results


Results of search
Number of sequences 5
Alignment score 88571
Sequence format Pearson
Sequence type nt
ClustalW version 1.83
JalView
Output file clustalw-20070603-20013500.output
Alignment file clustalw-20070603-20013500.aln
Guide tree file clustalw-20070603-20013500.dnd
Your input file clustalw-20070603-20013500.input

To save a result file right-click the file link in the above table and choose "Save Target As".
If you cannot see the JalView button, reload the page and check your browser settings to enable Java Applets.




Scores Table

SeqA Name         Len(nt)  SeqB Name         Len(nt)  Score
===========================================================
1    M.musculus   5993     2    Rattus       1430     92   
1    M.musculus   5993     3    Homo         1380     57   
1    M.musculus   5993     4    PREDICTED_   4716     54   
1    M.musculus   5993     5    Pongo        3697     68   
2    Rattus       1430     3    Homo         1380     55   
2    Rattus       1430     4    PREDICTED_   4716     73   
2    Rattus       1430     5    Pongo        3697     72   
3    Homo         1380     4    PREDICTED_   4716     94   
3    Homo         1380     5    Pongo        3697     67   
4    PREDICTED_   4716     5    Pongo        3697     94   
===========================================================
PLEASE NOTE: Some scores may be missing from the above table if the alignment was done using multiple CPU mode. Please check the output.




Alignment

CLUSTAL W (1.83) multiple sequence alignment


Homo            ------------------------------------------------------------
PREDICTED_      TGATTCCTCGAAACAATCTTACGGGGCGAGCCGGTTCCATGGGCGCTGAAGAAACATTTC 60
Pongo           ------------------------------------------------------------
M.musculus      ------------------------------------------------------------
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      CTCTTTCAAAGCCTCAATTTTTTGAACGATACGCATTGCTAAAGAGGAAGCAATCAAACC 120
Pongo           ------------------------------------------------------------
M.musculus      ------------------------------------------------------------
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      TATCAGGCGAGCTCTGCCCTCCGCCCAGCGAGCTGCTGCTTCCTGGTGTTAAAACGCTTT 180
Pongo           ------------------------------------------------------------
M.musculus      ------------------------------------------------------------
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      CGGGTCCTCCTGGCGAGTTTTAAGTCACACTGGATCGCTGCTCATTTTCAGAGAGCACCT 240
Pongo           ------------------------------------------------------------
M.musculus      ------------------------------------------------------------
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      CGCACCCATTCACCTGGAAGGCACCCAAGGGGAATCGATTTAGGAAATTCACTTCATGTC 300
Pongo           ------------------------------------------------------------
M.musculus      ------------------------------------------------------------
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      ACCCTAACAACAAAGCACAGCCTGCAGCTTTCACCCATGTGACATCAATGCTAATCCTAT 360
Pongo           ------------------------------------------------------------
M.musculus      ------------------------------------------------------------
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      GTGCGAAACATTTGGGTTCATTCGATTTTTAAAAAATTAGTAACAGAGATGGGGTCTCGC 420
Pongo           ------------------------------------------------------------
M.musculus      ------------------------------------------------------------
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      CATGTTGTCCAGGCTGCTCTCCACCGCCTGGGCTCAAGCCGTTCTCCCGCCTCGGCCTCC 480
Pongo           ------------------------------------------------------------
M.musculus      ------------------------------------------------------------
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      CTCCGCGCTGAGATTACAGGCGGGAGCCACCGCGTCAGCCTCCTCTCGTTTTTCGGCGAC 540
Pongo           ------------------------------------------------------------
M.musculus      ------------------------------------------------------------
Rattus          ------------------------------------------------------------
                                                                            

Homo            ----------------------------------------------------CCGCGGGG 8
PREDICTED_      AGGGCCAGCCCGCCTGCGGGGAGTTCCGTTCGGAGAAACTCTGTGAGGGACGCCGCGGGG 600
Pongo           ------------------------------------------------------------
M.musculus      ------------------------------------------------------------
Rattus          ------------------------------------------------------------
                                                                            

Homo            GCTTCCAAGGGACGCGGCGAAACCAAAACAGTCGCCGGTGGTTCACAAAACCACCTCAGA 68
PREDICTED_      GCTCCCAGGGGACGCGGCGAAATCAAAACAGTCACCGGTGGTTCACAAAACTACCTCAGG 660
Pongo           ------------------------------------------------------------
M.musculus      ------------------------------------------------------------
Rattus          ------------------------------------------------------------
                                                                            

Homo            AAATGCTTCCAAAGGCACGTCTGGCCTCCACAAGGTGACGGCTTTTCAGCCTCCGACTCG 128
PREDICTED_      AAATGCTTCCAAAGGCAGGTCTGGCCTTCACAAGGCGACGGCTCTTCAGCCTCCGACACG 720
Pongo           ------------------------------------------------------------
M.musculus      ------------------------------------------------------------
Rattus          ------------------------------------------------------------
                                                                            

Homo            AACTTGAGTCGTCCACAGCACTAGGCCGCCGCCAGCCCGGGCGAGCTGCCTAGGGACCGC 188
PREDICTED_      AACCTGAGTAGTCCACAGCACTGGGCCGCAGCCAGCCCGGGCAAGCCGCCGAGCGACCGC 780
Pongo           ------------------------------------------------------------
M.musculus      ------------------------------------------------------------
Rattus          ------------------------------------------------------------
                                                                            

Homo            GGACGCCGCAGCAAGCAGCTCCCTGCTCCCGCCACACCCGCCGAGCCAGCCGCGCGGAAC 248
PREDICTED_      GGACGCCGTAGCGAGCAGCCGCCTGCTCCCGCCACACCCGCCGAGCCAGCCGCGCGGAAT 840
Pongo           ------------------------------------------------------------
M.musculus      ------------------------------------------------------------
Rattus          ------------------------------------------------------------
                                                                            

Homo            CCACTCCCCCACCGTGGGCCCGCCTCCCGCCGCCAGCCTGCCCACGATTGGTCGACTGGG 308
PREDICTED_      CCACGCCCCCGCCGTGTGCCCGCCTCCCTCCTCTATCCGGCCCACGATTGGTCGGGTGGG 900
Pongo           ------------------------------------------------------------
M.musculus      ------------------------------------------------------------
Rattus          ------------------------------------------------------------
                                                                            

Homo            CTGCCCGTCGCGAGAGAAGGCGGTGCCTCCGGCAGGCCGGCGCTCCCATTGGCCGGGATG 368
PREDICTED_      GTGCCCGTCGCGAGAGAAGGCGGTGCCTCCCGCAGGCCGGCGCTCCCATTGGTCAGGATG 960
Pongo           ------------------------------------------------------------
M.musculus      ------------------------------------------------------------
Rattus          ------------------------------------------------------------
                                                                            

Homo            GCGGCGGCGGCGCGCGCGGCCCCGGCGAGCAGGGGAAGCCGGTGGCCGCGGCTGCGGAAC 428
PREDICTED_      GCGGCGACGGCGCGCGCGACCC-GGCGACGAGGGGAAGCCGGTGGCCGCGGCTGCGGAAC 1019
Pongo           -------------------------------------------------GGCTGCGGAAC 11
M.musculus      ----------------GGACCCGAAGAGGCGGGGAAAACCGGTGGCCGCGGTGGCGGAAC 44
Rattus          -------------------------------------------GGCCGCGGTGGCGGAAC 17
                                                                 **  *******

Homo            GGGCGGAGGCTGCCGGTTTCGTAACCGTCGCTCCTCCTCGCTGACTCGCGGGCTGTGAGG 488
PREDICTED_      GGGCGGAGGCTGCCGGTTTCGTAACCGTCGCTCCTCCTCGCTGACTCGCGGGCTGTGAGG 1079
Pongo           GGGCGGAGGCTGCCGGTTTCGTAACCGTCGCTCCTCCTGGCTGACTCGCGGGCTGTGAGG 71
M.musculus      GGGCGGAGGTTGCCGGTTTCGTAACCGTCGCTCCTCCTCGCCGACTCGCGGGCTGCGAGG 104
Rattus          GGGCGGAGGCTGCCGGTTTCGTAACCGTCGCTCCTCCTCGCCGACTCGCAGGCTGCGAGG 77
                ********* **************************** ** ******* ***** ****

Homo            CCTGGGTCGGCTC-----GGGCCGCACCGCGCGGGGCCGCTCGGAGTGGAGGCCGCCTGG 543
PREDICTED_      CCTGGGTCGGCTC-----GGGCCGCACCGCGCGGGGCCGCTCGGAGTGGAGGCCGCCTGG 1134
Pongo           CCTGGGTCGGCTT-----GGGCCGCACCGCGCGGGGCCGCTCGGAGTGGAGGCCGCCTGG 126
M.musculus      CCTGGGTCGGGTCGGGTCGGGCCGCGCCGCGCGGGGCCGCTCGGAGTGGAGGCCGTCTGG 164
Rattus          CCTGGGTAGGGTC-----GGACCGCGCCGCGCGGGGCCGCTCGGAGTGGAGGCCGTCTGG 132
                ******* ** *      ** **** ***************************** ****

Homo            GGGCAGGCGGGCTAG----AGGAGCAGGTACATGTGAAGATTTTTTGGCAGCTTAGCGTG 599
PREDICTED_      GGGCAGGCGGGCTGG----AGGAGCAGGTACATGTGAAGATTTTTTGGCAGCTTAGCGTG 1190
Pongo           GGGCAGGCGGGCTGG----AGGAGCAGGTACATGTGAAGATTTCTTGGCAGCTTAGCGTG 182
M.musculus      GGGCGGGCGGGCCGGCCGGAGGCGCAGGTACATGTGAAGATTTTTTGGCAGTTGAGTGTG 224
Rattus          GGGCGGGCGGGCCGGCCGGAGGCGCAGGTACATGTGAAGATTTTTTGGCAGTTGAGTGTG 192
                **** *******  *    *** ******************** ******* * ** ***

Homo            GAAACCATTGATCACCCTGCTCTCATTTCTACCTGTTCTGTGTTGGCAAGGGAGAGTGCC 659
PREDICTED_      GAAACCATTGATCACCTTGCTCTCGTTTCTACCTGTTCTGTGTTGGCAAGGGAGAGTGCC 1250
Pongo           GAAACCATTGATTACCCTGCTCTCATTTCTACCTGTTCTGTGTTGGCAAGGGAGAGTGCC 242
M.musculus      GCCTCCTCGGATCACATTGCTCTGATTTCTACCTATTCTGTGTTGGCAAAGGAACGTGCC 284
Rattus          GCCTTCTCGGATCACACTGCTCTGATTTCTACGTGTTCTGTGTTGGTGGAGGAACGGGCC 252
                *    *   *** **  ******  ******* * ***********    ***  * ***

Homo            CAAATGAGCAAGATATCGCAGCAAAACAGCACTCCAGGGGTGAACGGAATTAGTGTTATC 719
PREDICTED_      CAAATGAGCAAGATATCGCAGCAAAACAGCACTCCAGGGGTGAACGGAATTAGTGTTATC 1310
Pongo           CAAATGAGCAAGATATCGCAGCAAAACAGCACTCCAGGGGTGAACGGAATTAGTGTTATC 302
M.musculus      CAAATGAGCAAGCTGTCGCAGCCAGCCACTACTCCAGGAGTGAATGGAATAAGTGTCATT 344
Rattus          CAAATGAGCAAGCTGTCGCAGCCAGCCTCGACTGCAGGAGTGAACGGGATCAGTGTCATT 312
                ************ * ******* *  *   *** **** ***** ** ** ***** ** 

Homo            CATACCCAGGCACATGCCAGCGGCTTACAGCAGGTTCCTCAGCTGGTGCCTGCTGGCCCT 779
PREDICTED_      CATACCCAGGCACATGCCAGCGGCTTACAGCAGGTTCCTCAGCTGGTGCCTGCTGGCCCT 1370
Pongo           CGTACCCAGGCACATGCCAGCGGCTTACAGCAGGTTCCTCAGCTGGTGCCTGCTGGCCCT 362
M.musculus      CATACTCAGGCACATGCCAGCGGCTTACAGCAGGTTCCTCAGCTGGTGCCCGCTGGGCCT 404
Rattus          CACACTCAGGCACATGCCAGCGGCTTACAGCAGGTTCCTCAGCTGGTGCCCGCTGGGCCT 372
                *  ** ******************************************** ***** ***

Homo            GGGGGAGGAGGCAAAGCTGTGGCTCCCAGCAAGCAGAGCAAAAAGAGTTCGCCCATGGAT 839
PREDICTED_      GGGGGAGGAGGCAAAGCCGTGGCTCCCAGCAAGCAGAGCAAAAAGAGCTCGCCCATGGAT 1430
Pongo           GGGGGAGGAGGCAAAGCCGTGGCTCCCAGCAAGCAGAGCAAAAAGAGCTCGCCCATGGAT 422
M.musculus      GGGGGAGGGGGCAAGGCTGTGCCTCCAAGCAAGCAAAGCAAAAAGAGCTCACCCATGGAT 464
Rattus          GGGGGAGGAGGCAAAGCTGTGCCTCCAAGCAAGCAAAGCAAGAAGAGCTCACCCATGGAT 432
                ******** ***** ** *** **** ******** ***** ***** ** *********

Homo            CGAAACAGTGACGAGTATCGGCAACGCCGAGAGAGGAACAACATGGCTGTGAAAAAGAGC 899
PREDICTED_      CGAAACAGCGATGAGTATCGGCAGCGCCGAGAGAGGAACAACATGGCTGTGAAAAAGAGC 1490
Pongo           CGAAACAGTGACGAGTATCGGCAACGCCGAGAGAGGAACAACATGGCTGTGAAAAAGAGC 482
M.musculus      CGGAATAGTGACGAATACCGCCAGCGCAGAGAGCGGAACAATATGGCGGTGAAAAAAAGC 524
Rattus          CGAAATAGCGATGAGTACCGCCAGCGCAGAGAGCGGAACAATATGGCTGTGAAAAAGAGC 492
                ** ** ** ** ** ** ** ** *** ***** ******* ***** ******** ***

Homo            CGGTTGAAAAGCAAGCAGAAAGCACAAGACACACTGCAGAGAGTCAATCAGCTCAAAGAA 959
PREDICTED_      CGGCTGAAAAGCAAGCAGAAAGCACAAGACACGCTGCAGAGAGTCAATCAGCTCAAGGAA 1550
Pongo           CGGTTGAAAAGCAAGCAGAAAGCACAAGACACGCTGCAGAGAGTTAATCAGCTCAAAGAA 542
M.musculus      CGGTTAAAAAGCAAGCAGAAAGCTCAAGATACACTGCAAAGAGTAAACCAGCTCAAGGAA 584
Rattus          CGGTTAAAAAGCAAGCAGAAAGCTCAAGATACACTGCAGAGAGTAAACCAGCTCAAGGAG 552
                *** * ***************** ***** ** ***** ***** ** ******** ** 

Homo            GAGAATGAACGGTTGGAAGCAAAAATCAAATTGCTGACCAAGGAATTAAGTGTACTCAAA 1019
PREDICTED_      GAGAATGAACGGTTGGAAGCAAAAATCAAATTGCTGACCAAGGAATTAAGTGTACTCAAA 1610
Pongo           GAGAATGAACGGTTGGAAGCAAAAATCAAATTGCTGACCAAGGAATTAAGTGTACTCAAA 602
M.musculus      GAGAATGAACGGTTGGAAGCCAAAATTAAGTTGCTGACAAAGGAATTAAGTGTACTGAAA 644
Rattus          GAGAACGAGCGGCTGGAAGCCAAAATTAAGTTGCTGACAAAGGAATTAAGTGTACTGAAA 612
                ***** ** *** ******* ***** ** ******** ***************** ***

Homo            GATTTGTTTCTTGAGCATGCACACAACCTTGCAGACAACGTACAGTCCATTAGCACTGAA 1079
PREDICTED_      GATTTGTTTCTTGAGCACGCGCACAACCTTGCAGACAACGTACAGTCCATTAGCACTGAA 1670
Pongo           GATTTGTTTCTTGAGCATGCGCACAACCTTGCAGACAACGTACAGTCCATTAGCACTGAA 662
M.musculus      GATTTGTTTCTTGAGCATGCGCACAGCCTCGCAGACAACGTGCAGCCCATCAGCACGGAA 704
Rattus          GACTTGTTTCTTGAGCATGCGCACAACCTCGCAGACAATGTGCAGCCCATCAGCACGGAA 672
                ** ************** ** **** *** ******** ** *** **** ***** ***

Homo            AATACGACAGCAGATGGCGACAATGCAGGACAGTAGACCTCACCCTTTCCAGACTTTAGA 1139
PREDICTED_      AATACGACAGCAGATGGCGACAGTGCGGGACAGTAGACCTCACCCTTTCCAGACTTCACA 1730
Pongo           AATACGACAGCAGATGGCGACAATGCAGGACAGTAGACCTCACCCTCTCCAGACTTTAGA 722
M.musculus      ACTACAGCGACAAATTCTGATAACCCAGGGCAGTAGATCT----CCTTCCAGGC-CCAGG 759
Rattus          ACTACGGTGGCAAATTCTGATAACACAGGGCAGTAGATCT----CCTTCCAGGCGCCACA 728
                * ***     ** **   ** *   * ** ******* **    *  ***** *   *  

Homo            GC-TTGTGGCTTGAATGTTAAAGGTGTGACCACCG-ACACCACTCATGTCAATGGCTGAA 1197
PREDICTED_      GC-TTGTGGTTTGAACGTTAAAGGTGTGACCACCG-ACACCACTCATGTCAGTGGCTGAA 1788
Pongo           GC-TTGTGGCTTGAATGTTAAAGGTGCGACCACCG-ACACCACTCATGTCAATGGCTGAA 780
M.musculus      GC-TTGTGACTTGAACATGAGAGGTGTGACCACCCTGCACCCCTTGCTTCAGTGGCTGAA 818
Rattus          GCCTTGTGACTTGAACATGAGAGGTGTGACCACCCTGCACCCCTTGGTTCAGTGGCTGAG 788
                ** *****  *****  * * ***** *******   **** **    *** ******* 

Homo            AGTTGTCCATTTCCATGACTCAAAGACCCATTGGAGGCTATTTTCTGGGATCAGCACTGA 1257
PREDICTED_      AGTTGTCCTTTTCCATGATTCAAAGACCCATTGAAGGTTATTTTCTAGGATCAGCACTGA 1848
Pongo           AGTTGTCCTTTTCCATGACTCAAAGACCCACTGGAGGCTATTTTCTAGGATCAGCACTGA 840
M.musculus      CTCGGTCTCCTTCCAT---------------TGGAGGTTGTTTTCTAGGCTCAACACTGA 863
Rattus          CTCGGTCTTGTTCCAT---------------TGGAGGTTATTTTTTAGGCTCAGCACTGG 833
                    ***   ******               ** *** * **** * ** *** ***** 

Homo            AGAGTTGATTAGCTAAAAATGTTAGCCTTGTAATTCGAATATCTGGTTTTAAATGATAGA 1317
PREDICTED_      AGAGTTGATTAGCTAAAAATGTTAGCCTTGTAATTCGAATATCTGGTTTTAAATGATAGA 1908
Pongo           AGAGTTGATGAGCTAAAAATGTTAGCCTTGTAATTCGAATATCTGGTTTTAAATGATAGA 900
M.musculus      ACAGCTGATTAGCCA-------------TGTAATT----TATCTGGTCTTAAATGATAAT 906
Rattus          ACAGCTGGTTAGCCA-------------TGTAATT----TATCTGGTCTTAAATGATAAT 876
                * ** ** * *** *             *******    ******** **********  

Homo            GGTTTTTGTGGGAATCAAAATCCCCCAAATGTTAAGGTATATGGTAAAAAAAAAAAAAAA 1377
PREDICTED_      GATTTTTGTGGGCGTCAAAATCCCCCAAATGTTAAGGTATATGGTAAAAAAAAAAAAGAA 1968
Pongo           TATTTTTGTGGGGATCAAAATCCCCCAAATGTTAAGGTATATGGTAAAAAAAGAAATATC 960
M.musculus      GGATTTTTGAAGCACTAAAAG-----GA--TTTAGGGTTTATCGTTAAAACAAAATTCCT 959
Rattus          GGATTTTTGAAGCACTAAAAG-----AAAACTTAGGGTTTATGGTTAAAATAAAATTCCT 931
                   ****    *    ****       *   *** *** *** ** **** * **     

Homo            AAA--------------------------------------------------------- 1380
PREDICTED_      CCATCTGGGATCCCGATGTTCTTAATAAATCCTGACTTCCCAAGAAGTGCTTCTTTTTTA 2028
Pongo           TGG-----GATCCCGATGTTCTTAATAAATCCTGACTTCCCAAGAAATGCTTCTTTTTTA 1015
M.musculus      GGA-------CTTTAATATTCTTAATAAATCCTCACTTCCCCAGAAATGGCTCTTTTGTA 1012
Rattus          GGC-------CTTTAATATTCTTAATAAATCCTCACTTCCCCAGAAATGCTTCTTTTGTA 984
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      AGTTGACAAAAGGAATGGGGAACTGGCAGGCCATGCAGAAGGTTCTTGGTATTAATGGGT 2088
Pongo           AGTTGACAAAAGGAATGGGGAACTGGCAGGCCATGCAGAAGGTTCTTGGTTTTAATGGAT 1075
M.musculus      -----------GGAATGGGACAATGGAAGGTCATGTAGAAGGTACTGGGTTCTAATGAG- 1060
Rattus          -----------GGAAGGGGAAAATGGAAGGTCATATTGAAGGTTCTGGGTTCTAATGAG- 1032
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      AGACTGAATTGGATTAAGAAAAGTTGAATGCCAA-----ATCTATTTGTGATTTTCTTCT 2143
Pongo           AGGCTGAATTGGATTAAAAGTTGAATGCCGCCTATGGTAATCTATTTGTGATTTTCTTCT 1135
M.musculus      AGAATACCTTGGATTAAGAAAAGCTGAATTCTAGC---CGGGCGGTGGTGGCACACGCCT 1117
Rattus          ATAATACCTTGGACTAGGAAAAGCTGAATTC----------------------------- 1063
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      GAATTATGTATTATAAATTCATAGAGCTATAGAAAGCAATGAGTGAGTAATTTGGAGTGA 2203
Pongo           AAATTATGTATTATAAATTCATAGAGCTATAGAAAGCAATAAGTGTGTAATTTGGAGTGA 1195
M.musculus      TTAATCCCAGCACTTAGGAGACAGAGGCAGGCGGATTTCTGAGTTCGTTGCCAGCCTGGT 1177
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      TTTTATGTATGGCATAAACTTTGTTTTAACATAATTAGTACTGTTTTCCCCCAAAAGTAC 2263
Pongo           TTTTATATATGGCATAAACTTTGTTTTAACGTAATTAGTACTGTTTTCCCCCAAAAGTAC 1255
M.musculus      CTACAAAGTGAGTCCTAGGTCAGCCAGGGCTATACAGAAAAACCCTGTCTCGAAAAACAA 1237
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      AAGTTTTTGAATAGTGATGTCAGGTTAAGTAAAGAAACCTCATCACATCTTACAGACATT 2323
Pongo           AAGTTTTTGAATAGTGATGTCAGGTTAAGTAAAGAAACCTCATCACATCTTATAGGTATT 1315
M.musculus      AAACAAATAAACAAAAAAAACAAAACAAACAAACAAAAAGAAAAGC-TGAATTCCATCTG 1296
Rattus          ------------------------------------------------------CATCTG 1069
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      GTGTGGCCAATTGGCTTAAAATATACAAATAACATTTAGGAAGCAAATAGATTAAACACG 2383
Pongo           GTGTGGCCAATTGACTTAAAAAATACAAATAACATTTAGGAAGCAAATAGATTAAACACA 1375
M.musculus      GGTTCCTCAGTTTGTGATTTTATTCTAAATTGTGTATGGTAAATTCTGGGGCTACAAAAA 1356
Rattus          TGTTCTTCAATTTGTGATTTTATTCTAAATTGTGTATGATAAATTCTAGGGCTATAGAAA 1129
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      AAAATAAAACTAAAGCATAGGAATTATGTTTTTGGGATACCTTTGCGCTTAGATTGGCAT 2443
Pongo           AAAATAAAACTAAAGCATAGGAATTATGTTTTTGGGATACCTTTGGGCTTAGATTGGCAT 1435
M.musculus      CCAGTCCTAATAATTTGGCCCTATTTTATAGATGT-ATAAACCTGTGTTAGCATTGTCAG 1415
Rattus          CCAGCCATAATAATTTGGCCCAATTTTATAGATGT-ATAAACCTGTGTTAGCATAATCAG 1188
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      TATTTTATTCTAAAAACCCAACTCAGTGGTGTAGAGAAACTTGTGTACCAGAATTTTAGT 2503
Pongo           TGTTTTATTCTAAAAACCCAACTCAGTGGTGTAGAGAAACTTGTGTACCAAAATTTTAGT 1495
M.musculus      CATTGTTTTTTCCAACA--TACATATTTTTAAAAATGACTTTAGGTGAAGTAAAGAAACC 1473
Rattus          CATCGTTTTTTCCAACACATACACATTTTAAAAAATGACCTTAGGTGAAGTAAAGAAATC 1248
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      TTGTGCAGGTGCTAGTAAAGTAAGTGTTTTTTTGGATACAATTTTGACAGCCAAGTTAGT 2563
Pongo           TTCTGCAGATGCTA-----GTAAGTGTTTGTTTGGATACAATTTTGACAACCAAGTTAGT 1550
M.musculus      CCATCTG-TCATGTTGAGGAGGTGGTTAAAA-TACAAAGTGTGTTTAGGAAGGAA-GAAG 1530
Rattus          CCATCAGGTCACGTCGAG-AGGTGGTTAAAAATACAAGTTGTGTTTAGGAAGGAAAGAGG 1307
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      AAACAAAATGTCTTAACAGTTTGATGACACAACGTACTAATTAGGGTTTGGAATATTA-T 2622
Pongo           AAACAAAATGTCTTAACAGTTTGATGACACAAGCTATTGATTAGGGTTTGGAATATTAAT 1610
M.musculus      TGGTCTTGGGCTTTTTTTTTTTTTCCCTTTTGTTTGTTTTAAAGGGCATAGAGTGCGATT 1590
Rattus          TGGTTTTGTGCTTTT---------CCCCCTTGTTTGTTTTAAAGGGCATAGAGTGTGATT 1358
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      TCAGAAGGTAGTTTCTCTTGTGTTCAAAATAGCTACCATGGG-GCCATTATTTTTAAAAT 2681
Pongo           TCAGAAAGTAGTTTCTCTTGTGTTCAAAATAGCTGCCATGGG-GCCATTATTTTTAAAGT 1669
M.musculus      GAACTTTGAGGGGCCTTCTGCTTATTAGATAAGCATGGTCTCTGTCCTAAAAAACAGCAT 1650
Rattus          GAACTTTGGGGGGCCTTCTGCTTATTGGATGAGCATTATCTGTATCCTAAAAGACAGTAG 1418
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      CAAAAATTTATTCTGAAGGCTCATTTTGGTATTTGATCTTAACCAAGTGACTGTTAGAGA 2741
Pongo           CAAAATTTTCTTCTGAAGGCTCATTTTGGTATTTGATCTTAACCAAGTGATTATTAGAGA 1729
M.musculus      CTACTGTGTACTGACATTTTAGTTTCTGTGGACGCAAGTAAATGCAGCATTTGGTTTGGG 1710
Rattus          CCACCGTGTACT------------------------------------------------ 1430
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      AATGTATCAACTCCATGCCATCTCCCAAAATAATTGTCTAAGAAAACTTGAAAGTGTAAG 2801
Pongo           AATGTATCAACTCCATGCCATCTCCCAAAATAATTGTCTAAGAAAACTTGAAAGTGTAAG 1789
M.musculus      GGAGAAACCATTTTTTGTCAGCCAAGTTAGTAAATAAAATGCCTTGGCTTGATGATACAG 1770
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      GTTTTAACCTTTAATTTATTTCTCTTAAATACGTCTTTTGATATTGTTTTTGTGACATTT 2861
Pongo           GTTTTAACCTTTAATTTATTTCTCTTAAATACATCTTTTGATATTGTTGTTGTGACATTT 1849
M.musculus      ACCATGATTTACAATACTACTAATTCATTTGGTTTCTCCTGTGTTTGTTCAAAATAACTG 1830
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      CTTTTTCTGGTTAGTGGACTTTCCAGACTTTGTACCACTGCTTCTGTTTATTCATTTATA 2921
Pongo           CTTTTTCTGGTTAGTGGGCTTTCCAGACTTTGTACCACTGCTTCTGTTTATTCATTTATA 1909
M.musculus      CCAATGGGGCCATGATTTTTAAAGGTAAAGTGTTCGTGTGTGTGTGCTTGTGTGAAGAGG 1890
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      TGCTTTTGTGTCCCATAAATTATTTTAGAAAATGCTGATAAAACTCAGGAGATTGACATT 2981
Pongo           TGCTTTTGTGTCCCATAAATTATTTTAGAAAATGCTGATAAAACTCAGGATATTGACATT 1969
M.musculus      CACCTTTTGTTGTTTGATCTCAACTGAACAATTATTAGAAAAATGAATCAACTTTATGCC 1950
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      TTTGTTGAGATAAAAAA--TGACAGTTGCTAAAGTAGGGACTCTCTAGAGTCTGGCTTAC 3039
Pongo           TTTGTTGAGACTAAAAA--ATGGCAGTCGCTAAAGTAGGGA-CTCTAGAGTCTTGCTTAT 2026
M.musculus      ATCTCTCAAAAGACTAGTCAAAGAAAACTTGAAAGTATGAGGTTTGAATCTTTAATTTAT 2010
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      GTCGGTGTTGGTAGTTTAGATTGTCTTTGTCAACGTTTTTTCTTTTTTTTGTTTTGTTTT 3099
Pongo           GTCAGTGTTGGTAGTTTAGATTGTCTTTGTCAACGTTTTCT-TCTCTTTTCTTTTGCTTT 2085
M.musculus      TTCCTAAATTTTTAAATTTTTATTTCTTTGAGGAATCTTTTTCTAGTTTAGTGGGCTGTT 2070
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      GTTTTCTTTCTCTTTTTTTCTTAGCACACTTCTAGCTCAAATTTGTGTATTTTTTGTGTG 3159
Pongo           CTTTTCTTTCTCTTTTTTTCTTAGCACAGTTCCAGCTCAAATTTATGTATTTTTTGTGTG 2145
M.musculus      CTTCCAGACCTCATGTGTTATTGCTTCCATTAGTATGCTTTTGTGTTCTGTATAACTTAT 2130
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      CCTGGGCTGGAGATGAGAGACTGAGTCATAACTGATTTAAAAGTTTGTGTGACCAGGTAT 3219
Pongo           CCTGGGCTGGAGATGAGAGACTGAGTCATAACTGATTTCAAAGTTTGTGTTACCAGGTAT 2205
M.musculus      TTTAGAGAGAAAATGCTGATAAAACTCAGGATATTGACTCTTGTTGTGAAACTGAAAAGC 2190
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      CTTATTTGAACATGGTCATTTTTGGCCACGTTGCTGTTTCATACTAGGACTTGGGATGAT 3279
Pongo           CTTATTTGAACATGGTCATTTTTGGCCACGTTGCTGTTTCATACTAGGACTTGGGATGAT 2265
M.musculus      TGGGTGTCTGTAGGGTCTGCTCTTATCAGTGTTGTATTTAGATCGTCTTCTTGGTAACTC 2250
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      GTAGCCAGAATGAAACTCAAGTTGCACCCTCT--GGTTGGTGGAAGAGTGCTGACCGCGC 3337
Pongo           GTAGCCAGAATGAAACTCAAGTTGCACCCTCC--GGTTGGTGGAAGAGTGCTGACCGTGC 2323
M.musculus      ATAGTTTGTGCACAGCTCCAGTGTCAGTTTGTTAGTTCCTGAGACGGTAGCTAAACATGG 2310
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      CGTTTCTTGGCAG---AAGACATCATGGTGCCCAGGAACTCAGCAAAGCCATTATTAGAG 3394
Pongo           CGTTTCTGGGCAGGAGAAGACATCATGGTGCCCAGCAACTCAGCAAAGCCATTCTTAGAG 2383
M.musculus      GTCTTGTGTGATCAAAGTTTGGGTTCTGGGAATCTTGTTTGAATGTGGTCATTTCTGGCC 2370
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      TTCTGAGGCCCTTCTGAATGTAAAACAGGAGCCCAGGAGATGCTGTCCCAGGAGGGCTAT 3454
Pongo           TCATGAGGCCCTTCTGAATGTAAAACCGGAGCCTAGGAGAAGCTGTCCCAGGAGGGCTGT 2443
M.musculus      CTGTGTTCTACTAGGACTTGGTAACCCCAGTGTCGCTCAGGTTGCTCCCTAGTATGGCAG 2430
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      TAACTCCCTATAGAGCCAGGAGACAGGAGGGGGGTTTCTAGGGTCCAACACCAGCTTACC 3514
Pongo           TAACTCCCTATAGAGCCAGGAGACAGGATGGGGGTTTCTAGGGTCCAACACCAGCTTATC 2503
M.musculus      GAAGTTGCTGACTGTTCGGGACAGAAGCTTTCAGGGCCCTGGAGCTCAGCAGAGCTGAAG 2490
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      TTGGGAGTATGGATCTACCCATGAAGGATGAGAGATGTTTTGAATAACTAGCCAGGACAC 3574
Pongo           TTGGAGTATGGATCTACCCATGAAGGATGAGAGATGTTTTGAATAACTAGCCAGGACACA 2563
M.musculus      ACAGGAGCCGACACTGTTCTTTGGGAGCCAAGAAATGAGTGGGGTTTTAAAAATTAGGGC 2550
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      ACCACAGGATCCTCCTGGATCCTTAGCAGCTGATTGGTATTACATAATTAATTGGAGATG 3634
Pongo           CCCACAGGATCCTACTGGCTCCTTAGCAGCTGATTGGTGTTACATAATTAACTTAATTGG 2623
M.musculus      TCAGTACCATTTTACCTGGGTTGGAATACCATCTACTCCTAAAGATTGAGAGATGGTTTG 2610
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      CATTAGGTCACTTGAATGTATAAGCACCTGTGGTAGGTGCTACAGACATTTCAGTCTCTG 3694
Pongo           CGATGCATTAGGTCACTTGAATGTATAAGCAAGCACCTATGGTAGGCGCTACAGACATTT 2683
M.musculus      GATAACTAACAAGGACTCACCCATATAATCCTAATCTTCATCAGTGGATT---GATAATT 2667
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      ATTTACTAAAAAAAATCTTTGG-GAATTCGATGCCCCCATGGAATTTATGGTTACGAGTT 3753
Pongo           AAATCTCTTGGGAATTCTATGCCGCCCCCCCCCCCCCCATGGAATTTATGGTTACCAGTT 2743
M.musculus      ACGTAATGAATTTAATTGGTGACACAGTTAGGTCCCACTTGAACATGTATGAGGCTAGGC 2727
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      ATGTGCATTGACTTAAGTATCTTGAAAAAGAAACTTGAGGGAAATCATCAGGGGTGTGGA 3813
Pongo           ATATGAATTGACTTAAGTATCTTGAAAAAGAAACTTTAGAGAAATCATCAGGGGTGTGTA 2803
M.musculus      AGACTTCCGGAAACTCTTACTTCTAAACACCAGCTTTCACAAATGGATGTTCTTGTGGAA 2787
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      CTCAGTATTTCAAATCAGAACACAAGATTGGATCTTTTGGAAAAATGGGTTCAAGCTTTC 3873
Pongo           CTCAGTATTTCAAATCAGAACACAAGATTGGAACTTTTGGAAAAATGGGTTCAAGCTTTC 2863
M.musculus      TTTGTGGTTACCAGTGCTAGGACTTTAAAAAGCTGTAGGGAGGTCAGTGCTCAAGGTATC 2847
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      CTGTTACCCATGGAAGTTTAAAGTTTAGCACAAGCAAGCAGTTAGGCAGAGAACAAAAAT 3933
Pongo           CTATTACCTATGGAAATGCAAAGTTTAGCAGAAGCAAGCAATTAGGCAGAGAACAAAAAT 2923
M.musculus      AAATCAGAACATACAAATGAGGTCCATCTTTGCTCTTACCTTTGTAAAAGAGATTGTTAG 2907
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      GTTAACCATTGTGTTCTCTGTCTTCCTGAAGTGGTTGGAAAT-------TGTAATTTGAT 3986
Pongo           GTTAAGCATGGTGTTGTCTATCTTACTGAAGTGGTTGGAAATGAAAGCTTTTAATTTGAT 2983
M.musculus      CACAAGCAAGTAGTTCCATACTGAACACAAATGTTTGGACTCAAATGTTCTTACTCAAGT 2967
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      AGATTTATCAGTATAAAATTAGGGAAACCAAGT---GTGGGGAATGAATCCATTTAGAGT 4043
Pongo           AGATTTATCAGTATAAAATTAGGGAAACCATGT---GTGGGGAATGAATCAATTTAGAGC 3040
M.musculus      GGGAATGATGTTTAATTTGATAGATTTCTCTGTAAAGTTGGGGGAAACTAGGTTTGGGGA 3027
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      TTTGGGAACTGTAAGGTGACTTCTGTAACTTTCGTTCTGTGTGTGACCTGTGAACCATTA 4103
Pongo           TTTGGGAATTGTAAGGTGACTTTTGTAACTTTTGTTCTGTGTGTGACCTGTGAACCATTA 3100
M.musculus      ATGGGTAAACTTAAGGCTTTGGAAACTGTAGAGTGACTTTTGAAAGTCTTGTTACCGGGG 3087
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      GGATGTGATCTGCCCTTGTGGGCAGGTCCAGCAGTTTAGGAGTTAGGCTGTAGCGTAAGT 4163
Pongo           GGATGTGATCTGCCCTTGTGGGCAGGTCCAGCAGTTTAGGAGTTAGGCTTTAGCATAAAT 3160
M.musculus      GACCTTTAGAGTTTGATCTGCCTTGTGGACAGGTTGGTGGCTTAGGAATCAAACTGTAGT 3147
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      TTCTAGCTGCATAAGATGAGTCTCCTGGGATAGGTGCGCTTTGGCTGGTTTTGGCCGCAA 4223
Pongo           TTCTAGCTGCATC---TGAGTCTCCTGGGGTGGGTGCTCTTTGGCTGGTTTTGGCTGCGG 3217
M.musculus      GTGAATTAGCCTTGTCTCTGTCTCCTGGGATGGCTGCCCTTTGACGAGTTCTGGGCATAG 3207
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      ATGGTGAGATCAGAGCAGCTCTTCCTGCTGCTGGCCCCTGAAATCAGTTGTTGGGATGCC 4283
Pongo           ATGGTGAGATCAGAGCAGCTCTTCCTGCTGCTGGCCCCTGCAATCAGTTGTTGGGATGCC 3277
M.musculus      AGGGGGAATCAGAGCCACCCTCTCTGTCTAGCCCTTTGGGTCACAGGTGACTTTGGGATC 3267
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      ATTGCAGATACTAAGTAGTAAGATT-TTAA----ACACCACCAGGTCTGAAATGCAGGTC 4338
Pongo           AGTGCAGATACTAAGTAGTAAGATT-TTAATCAAACATGACCAGGTCTGAAGCGCAGGTC 3336
M.musculus      TCAGTAAGGATTTAACTAAAATATGACTGGGTGTTTGAAATTGGGTCATGAGGCCATTCA 3327
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      ATGAGTGTGAAATTCTCCAATTTACATAACAAGTAGAAGTATAGACAGTTTTTAACATTT 4398
Pongo           ATGAGTGTGAAATTCTCAAATTTACATAAAAAGTAGAAGTATAGACAGTT--TAACATTT 3394
M.musculus      GTTTTTACGGTTCTCAATTTATGAAACTAGAAACATGTACAGTTTGATAAGAAAGGATGC 3387
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      GGTATTAAAGGAGAGGAAATTGTAGCAGCTTTTCACGTTTCCTAATCCCCATTAGAGGGC 4458
Pongo           GGTATTAAAGGAGAGGAAATTGTAGCAGCTTTTCACGTTTCCTAATCCCCATTAGAGGGC 3454
M.musculus      AGCTGCTTTTGTTTCTTAACCCTCTCACCCCTTTCCAGGGAAGCTTCGTGCCTGGACAAC 3447
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      TTGAGACCTTGTATCTGAACAGCCCATTTCACACTCAGTGCTTTTTGATGCCTTAGAAAT 4518
Pongo           TTGAGACCTTGTACCCGAACAACCCATTTCGCACTCAGTGCTTTTTCATGCCTTAGAAAT 3514
M.musculus      CCATGGAGCTTGTAGAGTGCTCCTGATGCCTTAGAAATAGGAAAAGACGCCTGTTTGTGT 3507
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      AGGAGAATTGTTTTGTTTGACAAAAGTTGGGAAGGAAAAAGTCCGTTCTGCAGCTGTTAG 4578
Pongo           AGGAGAATTGTTTTGTTTGACAAAAGCTGGGAAGGAAAAAGTCCATTCTGCAGCTGTTAG 3574
M.musculus      GACAGGCTGGGGAAGATTCCATTCCACAGCTAATCAGATCTGCCTCAGGAAAAATACTAA 3567
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      ATCTGCCTCTCAGGAAAAAGTACTAACTTGTTCTTTTTGTTCCTGGCTTTCATCAATTTG 4638
Pongo           ATCTGCCTCTCAGGAAAAAGTACTAACTTGTTCTTTTTGTTCCTGGCTTTCATCAGTTTG 3634
M.musculus      CTTGTTCTATCTGTTCCTGGCCTTCAGTTTGTGAGATTACTCTATTTTTTTAAAATATAA 3627
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      TGAAATTTCTCTATTTTTTTAAATATAATTTTATTTCTTTCAACAAATTTAAAATAAAAA 4698
Pongo           TGAGATTTCTCTATTTTTTTAAATAGAATTTTATTTCTTTCAACAAAAAAAAAAAAAAAA 3694
M.musculus      TTTTATTTCTTTCAACGAATTTAAAAATAAAAAACACCTTTTGGAACAACGACTTTTTCT 3687
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      ACAACTTTGGAACAATGA------------------------------------------ 4716
Pongo           AAA--------------------------------------------------------- 3697
M.musculus      TCGTGGGTTTCTTTATCTTGGACATGAGCAAGAAGTTCATTTGTAATTGGCCCCAAAGAG 3747
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      ------------------------------------------------------------
Pongo           ------------------------------------------------------------
M.musculus      CCTGCAAGGTGCCTCTTGCTGTTGTCCTGGGCTGGAGTGCATGGACAGCGGGGTACTTTG 3807
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      ------------------------------------------------------------
Pongo           ------------------------------------------------------------
M.musculus      TGCAAGTTTGGATTTCCCTGAGTTGACAGGGAAGGAGTTGTCTCTAAACTTGGAATGCAG 3867
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      ------------------------------------------------------------
Pongo           ------------------------------------------------------------
M.musculus      CTTCAGTTGATTGTAGTTGTTTGGTCTAACTTAAAACTGCATCCCAGTGTAGGGGGCAGG 3927
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      ------------------------------------------------------------
Pongo           ------------------------------------------------------------
M.musculus      ATGAAAGGGCTGCCTGTGTCCTGGTGGGTCCTAGCCTATGGTTTCCATTTGAGGTGTATC 3987
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      ------------------------------------------------------------
Pongo           ------------------------------------------------------------
M.musculus      CCCAACACTACATTTTAGAGTATGAATACCATCTTGACTTACACAGGGTATATGCCTGGA 4047
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      ------------------------------------------------------------
Pongo           ------------------------------------------------------------
M.musculus      TATGGAAGTGTACTGGCTGATTTCAGAAATAAAACAAGACTCTAAGAAACAGAATTGTGT 4107
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      ------------------------------------------------------------
Pongo           ------------------------------------------------------------
M.musculus      GTTGGGGGTGGGGGGTGGGGCAGGAAGAGGCCATTTAGACGCTTTACTTTGGTCCTTTTA 4167
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      ------------------------------------------------------------
Pongo           ------------------------------------------------------------
M.musculus      GTCTTTTCGTGTTTGGGGAAATAAGTTTCTAATTGTTGTGTGGTTGTGAAAATTGTGTGG 4227
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      ------------------------------------------------------------
Pongo           ------------------------------------------------------------
M.musculus      CTGATTATGGTGGTATACACCTGTAACCCCAGTATTACAGAGATGAAGGTTGAGTTTAAG 4287
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      ------------------------------------------------------------
Pongo           ------------------------------------------------------------
M.musculus      GCCAATTTGAGTTTGAGTACCATTGAGACCCTGTCTTAAAAATGAAAAAAAAGAAAATAA 4347
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      ------------------------------------------------------------
Pongo           ------------------------------------------------------------
M.musculus      TTTCTATGGGTGGTGCAGAACAGAATTCCTTTGACTTCGTTGTAATTTTTTGTTTGTTTT 4407
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      ------------------------------------------------------------
Pongo           ------------------------------------------------------------
M.musculus      TCAGTTTTAGTGAGATGGTCTTGTAGCCAGTGCTGGCCTTCAACTTGATATTCAGCCAAG 4467
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      ------------------------------------------------------------
Pongo           ------------------------------------------------------------
M.musculus      TATGACCTTGAACTTCTGGCCTTCCTGCCTCCACCTCTCAAGTGCTAGGATTACAGGTAT 4527
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      ------------------------------------------------------------
Pongo           ------------------------------------------------------------
M.musculus      GTACCACTACTTGTATATGACACTGGGTCTTGAACCTGGGGCTTTGTGTGTGCTAGGTGA 4587
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      ------------------------------------------------------------
Pongo           ------------------------------------------------------------
M.musculus      GCTCTAGCAACAGAGCTGGAGCTCCTGCTCTAGTTCGTTTATTCCTAGTAACTTGTGTTA 4647
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      ------------------------------------------------------------
Pongo           ------------------------------------------------------------
M.musculus      GAAGTTTATACTTTGTGACAAAATCAGGTCTTAATAAAAAATACTTTTAGAATGAAAAAA 4707
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      ------------------------------------------------------------
Pongo           ------------------------------------------------------------
M.musculus      AAAAAAAAAAAMMUSCULUSIGEBP-GENEFRIMMUNGLBULINENHANCERBINDINGP 4766
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      ------------------------------------------------------------
Pongo           ------------------------------------------------------------
M.musculus      RTEINCACGAGCTCGCGGGCTGCGAGGCCTGGGTCGGGTCGGGTCGGGCCGCGCCGCGCG 4826
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      ------------------------------------------------------------
Pongo           ------------------------------------------------------------
M.musculus      GGGCCGCTCGGAGTGGAGGCCGTCTGGGGGCGGGCGGGCCGGCCGGAGCGCAGGTACATG 4886
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      ------------------------------------------------------------
Pongo           ------------------------------------------------------------
M.musculus      TGAAGATTTTTTGGCAGTTGAGTGTGGCCTCCTCGGATCACATTGCTCTGATTTCTACCT 4946
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      ------------------------------------------------------------
Pongo           ------------------------------------------------------------
M.musculus      ATTCTGTGTTGGCAAAGGAACGTGCCCAAATGAGCAAGCTGTCGCAGCCAGCCACTACTC 5006
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      ------------------------------------------------------------
Pongo           ------------------------------------------------------------
M.musculus      CAGGAGTGAATGGAATAAGTGTCATTCATACTCAGGCACATGCCAGCGGCTTACAGCAGG 5066
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      ------------------------------------------------------------
Pongo           ------------------------------------------------------------
M.musculus      TTCCTCAGCTGGTGCCCGCTGGGCCTGGGGGAGGGGGCAAGGCTGTGCCTCCAAGCAAGC 5126
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      ------------------------------------------------------------
Pongo           ------------------------------------------------------------
M.musculus      AAAGCAAAAAGAGCTCACCCATGGATCGGAATAGTGACGAATACCGCCAGCGCAGAGAGC 5186
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      ------------------------------------------------------------
Pongo           ------------------------------------------------------------
M.musculus      GGAACAATATGGCGGTGAAAAAAAGCCGGTTAAAAAGCAAGCAGAAAGCTCAAGATACAC 5246
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      ------------------------------------------------------------
Pongo           ------------------------------------------------------------
M.musculus      TGCAAAGAGTAAACCAGCTCAAGGAAGAGAATGAACGGTTGGAAGCCAAAATTAAGTTGC 5306
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      ------------------------------------------------------------
Pongo           ------------------------------------------------------------
M.musculus      TGACAAAGGAATTAAGTGTACTGAAAGATTTGTTTCTTGAGCATGCGCACAGCCTCGCAG 5366
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      ------------------------------------------------------------
Pongo           ------------------------------------------------------------
M.musculus      ACAACGTGCAGCCCATCAGCACGGAAACTACAGCGACAAATTCTGATAACCCAGGGCAGT 5426
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      ------------------------------------------------------------
Pongo           ------------------------------------------------------------
M.musculus      AGATCTCCTTCCAGGCCCAGGGCTTGTGACTTGAACATGAGAGGTGTGACCACCCTGCAC 5486
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      ------------------------------------------------------------
Pongo           ------------------------------------------------------------
M.musculus      CCCTTGCTTCAGTGGCTGAACTCGGTCCCCCTCCATTGGAGGTTGTTTTCTAGGCTCAAA 5546
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      ------------------------------------------------------------
Pongo           ------------------------------------------------------------
M.musculus      ACTGAAAAGCTGATTACCCATGTAATTTATCTGGTCTTAAATGATAATGGATTTTTGAAG 5606
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      ------------------------------------------------------------
Pongo           ------------------------------------------------------------
M.musculus      CACTAAAAGGATTTAGGGTTTATCGTTAAAACAAAATTCCTGGACTTTAATATTCTTAAT 5666
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      ------------------------------------------------------------
Pongo           ------------------------------------------------------------
M.musculus      AAATCCTCACTTCCCCAGAAATGGCTCTTTTGTAGGAATGGGACAATGGAAGGTCATGTA 5726
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      ------------------------------------------------------------
Pongo           ------------------------------------------------------------
M.musculus      GAAGGTACTGGGTTCTAATGAGAGAATACCTTGGATTAAGAAAAGATGAATTCTAGCCGG 5786
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      ------------------------------------------------------------
Pongo           ------------------------------------------------------------
M.musculus      GCGGTGGTGGCACACGCCTTTAATCCCAGCACTTAGGAGACAGAGGCAGGCGGATTTTGA 5846
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      ------------------------------------------------------------
Pongo           ------------------------------------------------------------
M.musculus      GTTCGTTGCCAGCCTGGTCTACAAAGTGAGTCCTAGGTCAGCCAGGGCTATACAGAAAAA 5906
Rattus          ------------------------------------------------------------
                                                                            

Homo            ------------------------------------------------------------
PREDICTED_      ------------------------------------------------------------
Pongo           ------------------------------------------------------------
M.musculus      CCTCGTGCCGAATTCGATATCAAGCTTATCGATACCGTCGACCTCGAGGGGGGGCCCGGT 5966
Rattus          ------------------------------------------------------------
                                                                            

Homo            --------------------------
PREDICTED_      --------------------------
Pongo           --------------------------
M.musculus      ACCCAATTCGCCCTATCAGTGAGTCA 5992
Rattus          --------------------------
                                          
PLEASE NOTE: Showing colors on large alignments is slow.




Guide Tree

(
(
M.musculus:0.07442,
Rattus:0.00460)
:0.21054,
(
Homo:0.11141,
PREDICTED_:-0.05707)
:0.12028,
Pongo:0.04236);


Cladogram

Right-click on the above tree to see display options.
Problems printing? Read how to print a Phylogram or Cladogram.
spacer
spacer